ID: 906447689

View in Genome Browser
Species Human (GRCh38)
Location 1:45917512-45917534
Sequence CCTCCACGGCAGTGGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906447689_906447700 29 Left 906447689 1:45917512-45917534 CCAGCCGCCCACTGCCGTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 152
Right 906447700 1:45917564-45917586 GACAATTGCTTCTGGCCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 174
906447689_906447698 21 Left 906447689 1:45917512-45917534 CCAGCCGCCCACTGCCGTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 152
Right 906447698 1:45917556-45917578 TGGGCCTTGACAATTGCTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 101
906447689_906447696 1 Left 906447689 1:45917512-45917534 CCAGCCGCCCACTGCCGTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 152
Right 906447696 1:45917536-45917558 AAGGAAACTTGCTGTGAATCTGG 0: 1
1: 0
2: 1
3: 21
4: 214
906447689_906447697 2 Left 906447689 1:45917512-45917534 CCAGCCGCCCACTGCCGTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 152
Right 906447697 1:45917537-45917559 AGGAAACTTGCTGTGAATCTGGG 0: 1
1: 0
2: 0
3: 10
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906447689 Original CRISPR CCTCCACGGCAGTGGGCGGC TGG (reversed) Intronic
900478912 1:2888945-2888967 CCTCCAGGGCAGAGGACGGTGGG - Intergenic
900553060 1:3266040-3266062 CATCCAGGGCGGTGTGCGGCCGG + Intronic
900763478 1:4488329-4488351 CCTCTACAGCAGAGGGCAGCTGG - Intergenic
901068177 1:6504464-6504486 CCTCCTCCACAGTGGGGGGCTGG + Intronic
901199784 1:7460183-7460205 CCGCCACGGGAGAGGACGGCGGG - Intronic
903389473 1:22953834-22953856 CTTCTACGGCAGCGGGCGGCCGG - Exonic
906447689 1:45917512-45917534 CCTCCACGGCAGTGGGCGGCTGG - Intronic
906922619 1:50080802-50080824 CCTCCAAGACAGTGAGCTGCAGG + Intronic
912306370 1:108571724-108571746 CCTCCTAGGAAGTGGGCGGCAGG - Intronic
912928035 1:113930102-113930124 CCTCAGCGGCAGTGAGCGGCCGG - Intronic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
919207657 1:194437717-194437739 GCTCCACGGCAGTGTGCTGGAGG - Intergenic
922476706 1:225911530-225911552 CCTCCTCGGCCGCGGGCGGCCGG + Intronic
923494491 1:234512673-234512695 CCTGCAGGGCAGGGGGCCGCTGG - Intergenic
1067220777 10:44342809-44342831 CCTCCATGGCAGCTGGCTGCAGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1069815109 10:71188712-71188734 CCTCCCCAGCAGTGGGCAGAAGG + Intergenic
1071527596 10:86367091-86367113 CCTCGAGGGCAGTTAGCGGCCGG - Intergenic
1071676488 10:87660097-87660119 CCTCCCCGGGAGGGGGCGTCGGG + Intronic
1073044386 10:100628174-100628196 CCTCCACGGCTGTCAGAGGCGGG - Intergenic
1076783187 10:132735726-132735748 TCTCCACAGCAATGGGAGGCCGG + Intronic
1077085306 11:747201-747223 CCTGCACGACACGGGGCGGCTGG - Intergenic
1077269133 11:1666848-1666870 CCTCCCGGGCGGTGGGGGGCCGG - Intergenic
1077271414 11:1683866-1683888 CCTCCCGGGCGGTGGGGGGCCGG + Intergenic
1079295100 11:19225975-19225997 CCTCCAGCGGAGTGGGCTGCAGG + Intronic
1081464163 11:43300915-43300937 CCTGCACTGCAATGGGCAGCAGG + Intergenic
1083281391 11:61629206-61629228 CCTCTACGGCAGTGTCGGGCTGG + Intergenic
1084128621 11:67118024-67118046 CCGCCACGGCCCAGGGCGGCAGG + Intergenic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084204742 11:67584851-67584873 CCTCCACTCCAGAGGGCTGCGGG - Intronic
1084371904 11:68750654-68750676 CCTCCATGGCGCAGGGCGGCGGG + Exonic
1087118092 11:94544898-94544920 CCTCCTCGGCAGTGTGCGCCTGG - Exonic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1090329678 11:125921273-125921295 CCTCCACCGCATAGGGCGGACGG + Exonic
1091563249 12:1630141-1630163 GCTCCCCGGGAGGGGGCGGCGGG - Intronic
1092171106 12:6374648-6374670 CCTCCTCCGCCGTGGGCTGCTGG + Exonic
1095825804 12:46530380-46530402 CCTCCAGTGCTGTGGGCTGCAGG - Intergenic
1096054906 12:48642467-48642489 CCTCCCAGACAATGGGCGGCCGG - Intergenic
1096110584 12:49026956-49026978 CCAGAAGGGCAGTGGGCGGCAGG - Exonic
1104057213 12:125239734-125239756 CCTCCACGGCAGCGCTCGCCGGG - Intronic
1104983814 12:132585687-132585709 CCTCCAGTGCAGTGAGCGCCAGG + Intergenic
1105698556 13:22915599-22915621 GCGCCACGGGAGTGGGCGGGAGG + Intergenic
1106498722 13:30307218-30307240 ACGCCAGGGCAGTGGGCTGCGGG - Intronic
1106548793 13:30753728-30753750 CCTGCAGGGAAGTGGGCTGCTGG - Intronic
1107559708 13:41547980-41548002 GCTCCATGGGAGTGGGAGGCCGG - Intergenic
1113904735 13:113813916-113813938 CCTCCAGGGCTGTGGGTGCCTGG + Exonic
1113932695 13:113976674-113976696 CCTACAGGGCAGTGGGAGGTGGG - Intergenic
1122276810 14:100594858-100594880 GCTCCACGGCAGTCAGGGGCTGG + Intergenic
1122951555 14:105047816-105047838 CCTCGAGGGCTGTGGGCGGAGGG - Intergenic
1124373075 15:29114432-29114454 CTTCCACGGCAGTGTGAGGATGG + Intronic
1127414951 15:58749232-58749254 CCGCCAGGGCGGTGGGGGGCGGG + Intronic
1128154871 15:65385899-65385921 CCTCCACGTCTGAGGGTGGCGGG + Exonic
1129660110 15:77548710-77548732 CCTCTACGGCTCTGGGAGGCTGG - Intergenic
1129942826 15:79513000-79513022 CCTCCAAGGCAGTGTGAGGTGGG - Intergenic
1130949129 15:88571707-88571729 CCTCAAAGGCAGTGGGCTGCAGG + Intergenic
1132523464 16:401969-401991 CCTCCACGTCGGGCGGCGGCTGG - Exonic
1132600926 16:772644-772666 CCTCCGAGGCAGTGGGGGGTTGG + Intronic
1132638023 16:962904-962926 CCTCCAAGGCAGTGGGAGCAGGG + Intronic
1132970112 16:2683000-2683022 CCTCAAAGGCAGTGGACGCCAGG - Intronic
1133018053 16:2954001-2954023 CCTCCTCGTCAGTGGGGGCCTGG - Intergenic
1134079308 16:11314180-11314202 CTTCCACTGCTATGGGCGGCGGG + Intronic
1136269806 16:29141785-29141807 CCTCCACGGCACAGGGGGGGCGG + Intergenic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1142030750 16:87837265-87837287 CCTCCAGGGCTGTGGGCTGCAGG - Intronic
1142373209 16:89694348-89694370 CCTCCCTGGGAGTGGGAGGCTGG - Intronic
1142801279 17:2347601-2347623 CCTCCAGGGGAGGGGGCGACAGG - Intronic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1142980496 17:3668487-3668509 CCACCACGGCGGTGACCGGCTGG + Exonic
1144680670 17:17191713-17191735 TCTCAAGGGCAGTGGGGGGCAGG - Exonic
1144847037 17:18225537-18225559 CCTGCACGGGGGTGGGCGCCGGG - Intergenic
1144998189 17:19285496-19285518 CTTCCACCGCAGTGGGCTGCGGG + Intronic
1147324989 17:39665821-39665843 CATCCTCGGCCGTGGGCTGCAGG + Exonic
1147608172 17:41785923-41785945 CCTCCACGCCGGTGGGAGCCCGG - Intronic
1147884939 17:43678046-43678068 CCGCCAAGGCAGTGGGAGACCGG - Intergenic
1152699279 17:81811125-81811147 GGTCCAGGTCAGTGGGCGGCAGG + Exonic
1152738281 17:82008063-82008085 CCTCGACTGCTGTGGGCGACAGG - Intronic
1154115883 18:11613250-11613272 CCTCCCAGACAATGGGCGGCTGG - Intergenic
1154120332 18:11647475-11647497 CCTCCCAGACAATGGGCGGCCGG - Intergenic
1154162960 18:11993660-11993682 CAGCCAGGGCAGTGGGCGGACGG + Intronic
1154483245 18:14856483-14856505 CCTCCCAGACAATGGGCGGCTGG + Intergenic
1154483664 18:14858103-14858125 CCTCCCAGACAATGGGCGGCTGG + Intergenic
1157862021 18:51150451-51150473 CCTCCACGGCACTGGGCCCTGGG - Intergenic
1160155622 18:76431957-76431979 CCGCCAGGGCAGTGGTGGGCGGG - Intronic
1160532392 18:79573100-79573122 CCTCCTCTGCAGTGGGCTGTGGG - Intergenic
1160984851 19:1833783-1833805 CCTCCACGTCACTGGGCAGCCGG - Intronic
1161200093 19:3009750-3009772 CTCCCAAGGCAGTGGGAGGCGGG - Intronic
1161552757 19:4923286-4923308 CCTCGACAGCAGGAGGCGGCAGG - Intronic
1161585377 19:5102680-5102702 CTTCACCGGCAATGGGCGGCGGG + Intronic
1162531270 19:11237658-11237680 TCTCCAGGGCAGTGCCCGGCCGG + Exonic
1163723716 19:18910784-18910806 CCTGCACAGCAGTGGGGGGCTGG - Intronic
1165326267 19:35116164-35116186 CCTCCCCAGCCATGGGCGGCAGG - Intronic
1166811235 19:45515871-45515893 CCTCCAGGGCAGTGGGGGAGGGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925922425 2:8646701-8646723 CCCCCAGGGCAGTGGGCTGTGGG - Intergenic
926239517 2:11074417-11074439 CATCTAAGGCAGTGGCCGGCAGG + Intergenic
927562718 2:24084836-24084858 CCTCCACCGGAATGGACGGCTGG + Exonic
927685042 2:25164692-25164714 CCTCCATGGAAGTGCGTGGCTGG - Exonic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
941112088 2:161427111-161427133 CCTCGGCGGGAGTAGGCGGCGGG - Intronic
942326568 2:174781368-174781390 CCACCATGGCAGGGGGCTGCAGG - Intergenic
945674775 2:212842915-212842937 GTTCCACAGCAGTGGGTGGCTGG + Intergenic
947874201 2:233457751-233457773 CCCCGACTGCAGTGGGCAGCAGG + Intronic
948716611 2:239869513-239869535 CCTCCATAGCAGTGGGGTGCAGG + Intergenic
949009619 2:241671099-241671121 CCACCACGGCAGAGGGGGGTGGG - Intronic
1168780188 20:482605-482627 CCTCCACGGTACAGGGCTGCAGG + Exonic
1170595022 20:17798744-17798766 CCTCCAGGGCAGCTGGAGGCAGG - Intergenic
1172657820 20:36547858-36547880 CAGCCACAGCAGTGGGCGCCCGG - Intronic
1175900942 20:62359707-62359729 CCTCCACGGCTGGGCGCAGCGGG + Intronic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176022333 20:62968163-62968185 CCCCCAGGGCAGTGGGTGGGTGG + Exonic
1176286815 21:5022861-5022883 CGTGGACGGCAGTGGGCGGCGGG + Intronic
1178584315 21:33859880-33859902 CTTCCACGGCATCGGGTGGCAGG - Intronic
1178961900 21:37073265-37073287 CCTCCACGTCAGCCGACGGCGGG - Intronic
1179870366 21:44240614-44240636 CGTGGACGGCAGTGGGCGGCGGG - Intronic
1180783304 22:18533901-18533923 CCTCCACTGCATGTGGCGGCAGG + Intergenic
1181126868 22:20707946-20707968 CCTCCACTGCATGTGGCGGCAGG + Exonic
1181240203 22:21473253-21473275 CCTCCACTGCATGTGGCGGCAGG + Intergenic
1181672491 22:24432262-24432284 CCTCTGCGGCAGTGGGAGACAGG + Exonic
1183154679 22:36066024-36066046 TCTCGAGAGCAGTGGGCGGCGGG - Intergenic
1183321973 22:37170450-37170472 TCTCCACGGCTGGGGGCAGCGGG - Intronic
1183363524 22:37395377-37395399 CCTCCACGGCCCTGGGAGACGGG + Intronic
1183667393 22:39253682-39253704 CCGGCAGGGCAGTGGGCTGCAGG + Intergenic
1184035687 22:41917091-41917113 CCTCCAGGGCAGTGGGCAGAGGG - Intergenic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
952241420 3:31533665-31533687 CCGCCACGCCAGGAGGCGGCAGG + Intronic
952872018 3:37909465-37909487 GCTCCAGGGCAGTGCGGGGCAGG - Intronic
954736876 3:52714611-52714633 CCTCCAGGGCAGTGGGCTCTGGG - Intronic
956295543 3:67709363-67709385 CCTCCATGGGAGTGGGGAGCTGG + Intergenic
956462550 3:69485810-69485832 CCCCCAAGGCAGTGGGCTGCAGG + Intronic
959262349 3:104098344-104098366 CATCCACAGCAGTGGGCGACAGG - Intergenic
961519273 3:127457234-127457256 TCTCCAGGGCAGCGGCCGGCAGG - Intergenic
961546711 3:127639324-127639346 GCTCCAAGCCAGTGGGCAGCAGG - Exonic
962867749 3:139461730-139461752 CCTCCATGGCAGTGCTTGGCTGG + Intronic
963049534 3:141129194-141129216 CCTCCACAGCAGAGGTGGGCAGG - Intronic
965364675 3:167783979-167784001 CTGCCAGGGCAGTGGGCAGCAGG - Intronic
967985645 3:195093933-195093955 CCTCCACGGACGTGGGCTGGGGG - Intronic
968459638 4:718156-718178 GCTGCACGTCAGTGGGCGGCCGG - Intronic
968509058 4:987396-987418 CCTCCACCTGAGTGGGCGCCGGG + Intronic
969485586 4:7470765-7470787 CCCACAAGGCAGTGGGAGGCAGG + Intronic
972765767 4:42151606-42151628 CCGCCACGGCCGGGGGCAGCGGG - Intronic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
983838525 4:172424575-172424597 CCTCCAGTTCAGTGGGCGGAGGG + Intronic
986018083 5:3775296-3775318 CCGCCACGGGAGAGGTCGGCAGG - Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
997598997 5:135126790-135126812 TTTCCTGGGCAGTGGGCGGCGGG + Intronic
999263053 5:150249367-150249389 CCTCCACAGTACTGGGCAGCTGG + Intronic
1001571619 5:172733866-172733888 CCTCCCCGGCTGTGGGCTGGAGG + Intergenic
1002792814 6:448133-448155 CCTCCATGGCAGTGGCCTGGAGG - Intergenic
1006470140 6:34224053-34224075 CCTCCCCTGCGCTGGGCGGCGGG + Intergenic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1019407656 7:892149-892171 CCTCCATGGCCTTGGGCCGCAGG + Intronic
1019414747 7:922120-922142 CCTCCAGGGCTGTGGGAGTCGGG - Intronic
1019497146 7:1345989-1346011 TCTCCTCGGCAGTGGGCGGTGGG - Intergenic
1020677330 7:11197538-11197560 GCTCCACCTCAGTGGGCAGCTGG - Intergenic
1033595392 7:142855099-142855121 GCTCTACAGCAGCGGGCGGCGGG + Exonic
1035694445 8:1584474-1584496 CCTCCACTACCGTGGGCTGCTGG + Intronic
1037877168 8:22553954-22553976 CCTGGAGGGCAGTGGGCGGGTGG + Intronic
1041106996 8:54453962-54453984 CCTCCAAGGCAGGGGGCGCGCGG + Intergenic
1041511601 8:58659672-58659694 CCTCCTCGGCAGGCGGCGGCGGG - Intronic
1045510891 8:102810957-102810979 CCTCCAGGGCTGTGCGCGGGCGG + Intergenic
1048298902 8:133237323-133237345 CCTCCAAGGTGATGGGCGGCAGG + Exonic
1049777963 8:144415157-144415179 CCTCCACGTCCCTGGGGGGCAGG - Intronic
1057189150 9:93076788-93076810 GCTCCATGGCAGTGGGAGCCAGG + Intronic
1057443738 9:95099542-95099564 CCTCCAAGACAGGTGGCGGCCGG - Exonic
1057549067 9:96038979-96039001 TCTCCACGGCTGTGGGCAGGAGG - Intergenic
1061397547 9:130351633-130351655 CCTCTAAGGCAGCGGGCAGCTGG - Intronic
1061429176 9:130520325-130520347 CATTCACAGCAGTGGGCAGCAGG - Intergenic
1061902104 9:133678212-133678234 CCTCCACCACAGTGGCCAGCAGG + Intronic
1062337884 9:136080370-136080392 ACCCCACTGCAGTGGGCTGCTGG - Intronic
1192212425 X:69136567-69136589 CCCCCACGGCTGTGGGCGGTAGG + Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic