ID: 906457743

View in Genome Browser
Species Human (GRCh38)
Location 1:46011650-46011672
Sequence GTGATGTGATGAGCTCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906457743 Original CRISPR GTGATGTGATGAGCTCTGCG GGG (reversed) Intronic
900125052 1:1065206-1065228 GTGTTGTGGTGGGGTCTGCGGGG + Intergenic
900488354 1:2934240-2934262 CTGGTGTGATGAGCTCGCCGAGG + Intergenic
901324407 1:8358310-8358332 GCGATGCCATGCGCTCTGCGTGG + Exonic
901473604 1:9474130-9474152 GTGATGTGAAGTGCTTTGCACGG + Intergenic
904979043 1:34481058-34481080 GTGCTGTGATGATCTCTACAAGG - Intergenic
905927736 1:41763979-41764001 CTTATGTGATGACCTCTGCTGGG - Intronic
906457743 1:46011650-46011672 GTGATGTGATGAGCTCTGCGGGG - Intronic
907770438 1:57457023-57457045 GCAATGTGATGAATTCTGCGAGG + Intronic
910981865 1:92966017-92966039 GTGATGTGAAGAGCCTTGAGAGG + Intergenic
912934787 1:113993665-113993687 ATGCTGTGGGGAGCTCTGCGGGG - Intergenic
924209249 1:241748000-241748022 GACATGTGACGAGCTCTGTGAGG - Intronic
1064718600 10:18204678-18204700 TGGATGTGTTAAGCTCTGCGAGG + Intronic
1067467552 10:46512325-46512347 GGGAGGTGTTGAGCTCTGCATGG + Intergenic
1067619634 10:47872280-47872302 GGGAGGTGTTGAGCTCTGCATGG - Intergenic
1067944749 10:50682716-50682738 TTGATGCCATGGGCTCTGCGGGG + Intergenic
1070642577 10:78180261-78180283 GTAATGTGCTGAGGTCTGCCTGG - Intergenic
1073494853 10:103881634-103881656 TTGATGTGATAAGCTCTTCGTGG - Intergenic
1073802283 10:107055154-107055176 GTGATGTGGTGTGCTCTTCAAGG - Intronic
1074838706 10:117326325-117326347 GTGATTTGCTGAACTCTGTGTGG - Intronic
1078240580 11:9527267-9527289 GTGATATGATGAGGTCTCAGCGG - Intronic
1084112628 11:67023661-67023683 GCGATGCGATGCGCACTGCGCGG - Intronic
1084456291 11:69269943-69269965 GTGGTGTGAGGAGCCCTGGGTGG + Intergenic
1086577374 11:88355071-88355093 GTGATAGGCTGAGCTCTGCTGGG + Intergenic
1089766832 11:120774100-120774122 GTGCTGTGATCAGCTCTGTCTGG - Intronic
1091304981 11:134531044-134531066 GGGATGTGATGTGGTGTGCGTGG + Intergenic
1092449673 12:8590312-8590334 ATGCTCTGATGAGCTCTGCTAGG - Intergenic
1097998225 12:65913710-65913732 GAGAAGTCATGAGCTCTGAGTGG - Intronic
1098779032 12:74660781-74660803 GTGATCTGATTAGCTGTGGGTGG - Intergenic
1103447108 12:121001603-121001625 GTGACCTGCTGAGCTCTGAGAGG + Exonic
1108004549 13:45933962-45933984 GTGAAGTCCTGAGCGCTGCGGGG + Intergenic
1108643451 13:52404632-52404654 GTGATGTGATGTGTTCTGCAAGG - Intronic
1108939802 13:55938760-55938782 GTAATGTGATGAGCTCTTTGGGG - Intergenic
1113636130 13:111920308-111920330 GTGCTGTGATGAGCAGTGCCAGG + Intergenic
1113808619 13:113123982-113124004 GTGGTGGGATGAGATCAGCGTGG + Intronic
1113847633 13:113401662-113401684 GGGCTGTGCTGAGCTCTGGGGGG - Intergenic
1114909890 14:27178155-27178177 GTGGTGTGATGAGCTTTGGGAGG - Intergenic
1126270832 15:46815159-46815181 TTCATGTTATGAGCTCTCCGTGG + Intergenic
1135354241 16:21756338-21756360 ACCATGTGATGAGCTCTGTGAGG - Intronic
1135452733 16:22572479-22572501 ACCATGTGATGAGCTCTGTGAGG - Intergenic
1138213778 16:55185125-55185147 GTGATGTGATGGGCACAGCAAGG + Intergenic
1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG + Intergenic
1155363543 18:25028142-25028164 CTGAGGTGCTGAGCTCTGCAGGG - Intergenic
1159058947 18:63494438-63494460 ATGATGTGATGTGGTCTCCGTGG + Intronic
1159142064 18:64409314-64409336 GTCTTGAGATGAGCTCTGAGTGG + Intergenic
1160457324 18:79011474-79011496 GTGATCTGATGGGCCCAGCGGGG - Intergenic
927932072 2:27051789-27051811 GAGAGGTGAGGGGCTCTGCGCGG + Exonic
932224692 2:70030284-70030306 GTGGTGTGCTGAGCTCTGAGTGG + Intergenic
932684390 2:73855726-73855748 GTGCTGTGATGAGCTCACTGTGG - Intronic
937380855 2:121374990-121375012 GTGAGGTGATGAGATATGGGAGG + Intronic
937909153 2:127067120-127067142 GTGACGTGGAGAGCTCTGGGTGG - Intronic
939441892 2:142260658-142260680 GTGCTGTGCTGTGCTCTGCTGGG + Intergenic
941977847 2:171424836-171424858 GTGAGGACATGAGCTCTGGGAGG + Intronic
945848626 2:214979113-214979135 GTGAGGTGATGAGCTCTTTTAGG + Intronic
947886206 2:233573783-233573805 GGTATGTGATTAGCTCTGTGAGG - Intergenic
1173559850 20:43995350-43995372 GTGATTTTATGAATTCTGCGGGG - Intronic
1179113929 21:38472592-38472614 GCAATGTGATGAGCTCAGCGGGG - Intronic
1183082911 22:35468239-35468261 GTGCTTTGATGAGCTCTGCTAGG + Intergenic
1184157736 22:42679441-42679463 GTGAGGAGATGAGATCTGGGAGG + Intergenic
1184827535 22:46963301-46963323 GCAGTGTGATGAGCACTGCGTGG - Intronic
950254468 3:11493148-11493170 GTGATGAGATCAGCTCTCAGTGG + Intronic
952538973 3:34346008-34346030 GTGCTGTGATGAGACCTGCAGGG + Intergenic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954641339 3:52100140-52100162 GTGAAGTGATGAGCTCCTGGTGG - Intronic
958955045 3:100458111-100458133 GTGAGGAGATGAGATCTGGGAGG - Intergenic
961543753 3:127618012-127618034 GTGAGATGATGGGCTCTGTGAGG - Exonic
963594073 3:147303442-147303464 GTGCTCTGGTGAGCTCTGAGGGG + Intergenic
967223132 3:187266038-187266060 TTGATATGATGACCTCTGAGAGG - Intronic
967721736 3:192822906-192822928 GTGATCTCATCACCTCTGCGTGG - Intronic
968332953 3:197887354-197887376 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968332962 3:197887405-197887427 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968332973 3:197887454-197887476 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968332986 3:197887502-197887524 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968332997 3:197887551-197887573 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968333011 3:197887600-197887622 GTGATGGGAAGGGCTCTGCTAGG - Intronic
968333024 3:197887650-197887672 GTGATGGGAAGGGCTCTGCTAGG - Intronic
968333036 3:197887698-197887720 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968333048 3:197887746-197887768 GTGATGGGAAGGGCTCTGCTGGG - Intronic
968333062 3:197887796-197887818 GTGATGGGAAGGGCTCTGCTAGG - Intronic
969363750 4:6681892-6681914 TTGGTGTGATGAGCTCTGGATGG - Intergenic
975297646 4:72752004-72752026 GTGCTGTGCTGAGCTCTCCAGGG - Intergenic
975508277 4:75164004-75164026 GTGAAGTGAAGAGCTCCACGGGG + Intergenic
985810056 5:2076083-2076105 GTGCTGTCATGAGCCCTGCCAGG + Intergenic
996034216 5:118739974-118739996 GTGATGTGAGGGCCTCTGTGTGG - Intergenic
1003757472 6:9137806-9137828 GTGAGGTGATGAGGTGTGAGCGG - Intergenic
1003890034 6:10555973-10555995 TTGAAGTGATGAGCTCTGGCAGG - Intronic
1013087371 6:106867878-106867900 GTGATGTGTTGAGCTCGACAAGG - Intergenic
1018855802 6:167674005-167674027 GTGGTTTGTTGAGCTCTGGGTGG + Intergenic
1022504009 7:30899479-30899501 GTGATGTAGTGAGGTCTGCTGGG + Intergenic
1031837758 7:126699125-126699147 GTTAAGTGATTAGCTCTGCCTGG - Intronic
1032546941 7:132751529-132751551 TTGATTTCATGAGCTCTGCCTGG - Intergenic
1038375125 8:27032574-27032596 GTGATCTGGTGAGCACTGAGGGG + Intergenic
1038912632 8:31983613-31983635 TTCATGTGATGTGCTCTGCTGGG + Intronic
1041215306 8:55594701-55594723 GAGATGTGATGTGCTCTCCGTGG - Intergenic
1044463060 8:92469894-92469916 GAGATGTAATGAGTTCTGAGAGG + Intergenic
1049396945 8:142405277-142405299 GTCATGTGATGACCTCTTCCAGG - Intergenic
1049504719 8:142989997-142990019 GTGATGTGCTGTGGTGTGCGTGG + Intergenic
1052135867 9:24909135-24909157 GTGTTCTGATGAGCTGTGCAGGG - Intergenic
1055637011 9:78288879-78288901 GTGATTTGATGTTCTCTCCGTGG + Intergenic
1057187404 9:93064654-93064676 GTGTTGTGCTGAGCCCTGTGGGG - Intronic
1058335132 9:103818615-103818637 GTGACCTGCTGAGCTCTGCGTGG - Intergenic
1058603079 9:106692183-106692205 GTAAAGTGATGGGCTCTGCTTGG - Intergenic
1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG + Intergenic
1194274001 X:91857387-91857409 GTGATGACATGAGTTCTGGGAGG - Intronic
1195432515 X:104805148-104805170 GTAATGTGATTAACTCTGGGTGG - Intronic
1196145590 X:112313342-112313364 GAGATAAGATGAGCTCTGAGTGG + Intergenic
1200591238 Y:5078804-5078826 GTGATGACATGAGTTCTGGGAGG - Intronic