ID: 906461050

View in Genome Browser
Species Human (GRCh38)
Location 1:46035322-46035344
Sequence CCCTAGGAGCCTGGGCCCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906461042_906461050 -6 Left 906461042 1:46035305-46035327 CCTTTCCCGTCCAGAGACCCTAG 0: 1
1: 0
2: 0
3: 14
4: 150
Right 906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG 0: 1
1: 0
2: 3
3: 24
4: 206
906461035_906461050 29 Left 906461035 1:46035270-46035292 CCCCTAAAGGAGCAGGAGAGAGT 0: 1
1: 0
2: 1
3: 18
4: 185
Right 906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG 0: 1
1: 0
2: 3
3: 24
4: 206
906461036_906461050 28 Left 906461036 1:46035271-46035293 CCCTAAAGGAGCAGGAGAGAGTG 0: 1
1: 0
2: 8
3: 44
4: 393
Right 906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG 0: 1
1: 0
2: 3
3: 24
4: 206
906461037_906461050 27 Left 906461037 1:46035272-46035294 CCTAAAGGAGCAGGAGAGAGTGG 0: 1
1: 0
2: 4
3: 42
4: 415
Right 906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG 0: 1
1: 0
2: 3
3: 24
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906461050 Original CRISPR CCCTAGGAGCCTGGGCCCAA TGG Exonic
900393840 1:2445055-2445077 CCCTAGGACCCTGGGCTGATGGG + Intronic
900598389 1:3492823-3492845 GCCAAGGAGCCTGGGCCTAGGGG + Intronic
900669173 1:3839351-3839373 TACTAGGACCCTGAGCCCAATGG - Intronic
902438987 1:16416923-16416945 CACTGTGAGCCTGGGCCCCAAGG - Intronic
902817220 1:18923218-18923240 CCCTGGGTGCCTGCGTCCAAGGG - Intronic
903040860 1:20529173-20529195 CCCTAGAAGGCTGGGCGCAGTGG - Intergenic
903357208 1:22755494-22755516 CCCTGGGAGCATGGGCCAGAAGG - Intronic
903779840 1:25814200-25814222 CCCGAGGTGCCTGGGCCCTGTGG - Intronic
904490455 1:30855679-30855701 CACTAGGAGTCTGTGCCCAGAGG + Intergenic
904499556 1:30906343-30906365 CCCTGGGAGTCTGAGCCCAGAGG - Intronic
905261800 1:36724479-36724501 CCTTAGAAGCGTGGGCCCATTGG + Intergenic
905524296 1:38624765-38624787 CCCCAGCAGCCTGAGCCCCACGG + Intergenic
905535074 1:38714939-38714961 CTCTAGGATCCAGAGCCCAAAGG + Intergenic
905731677 1:40302889-40302911 ACCTAGGGGCCAGGGCCCATCGG - Intronic
906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG + Exonic
906936069 1:50214944-50214966 CGTCAGGAGCCTGGGCTCAAAGG - Intergenic
907276199 1:53317846-53317868 CCCAAGGAACCTGGGCCTCAGGG + Intronic
907520356 1:55019719-55019741 CCCCAGCAGCCCGGGCCCCAGGG - Intergenic
912459538 1:109821710-109821732 CCCCAGGTGCCAGGGCCCAGAGG - Intergenic
916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG + Intronic
916797290 1:168178979-168179001 GCCTAGGAGGCTGGGCCGGAGGG + Exonic
916815230 1:168345261-168345283 CCTTAAAATCCTGGGCCCAAGGG + Intergenic
917551104 1:176030346-176030368 CTCTAACAGCCTAGGCCCAAAGG + Intronic
918814862 1:189169470-189169492 TCCTAGGAGGCAGGGACCAAGGG + Intergenic
922556426 1:226535906-226535928 CCCTTCGAGACTGGGCTCAAGGG + Intergenic
922795007 1:228335518-228335540 CCCACGGGGCCTGGGCCCAGAGG - Intronic
1065066309 10:21968932-21968954 TCCTAGGAGCCTGGGCACAGTGG + Intronic
1066277641 10:33884599-33884621 CCCAAGGAGGCTGGGTGCAAAGG - Intergenic
1067222231 10:44352602-44352624 CTCAATGAGCCTGGGGCCAAGGG - Intergenic
1068113273 10:52706796-52706818 ACCAGGGAGCCTGTGCCCAATGG - Intergenic
1070712149 10:78690633-78690655 CCTTTGCAGCCTGGGCCCCAGGG + Intergenic
1072635433 10:97174599-97174621 CCCCAGGAGCCCAGGCGCAAGGG - Intronic
1073210620 10:101798927-101798949 CCTTACGAGCATGGACCCAAAGG - Exonic
1074979758 10:118610089-118610111 CCTTAGCAGCCAGGGCCCCATGG - Intergenic
1075592460 10:123702826-123702848 ACCTAGAAGGCTGGGCACAAAGG - Intergenic
1076053688 10:127354366-127354388 CTCTTGGCTCCTGGGCCCAAGGG - Intronic
1076725162 10:132409680-132409702 CCCTTCTAGCCTGGGCCCAGTGG - Intronic
1076905551 10:133359010-133359032 CCCTAGGAGCCTGTCCCCATGGG + Intergenic
1077097518 11:805280-805302 CCCGAGGGGGCGGGGCCCAAGGG - Intronic
1077444273 11:2583090-2583112 CCCCAGGAGGCTGGGCCCCTGGG - Intronic
1078552002 11:12287681-12287703 CCCCAGGACACTGGGACCAAGGG - Intronic
1079562144 11:21834955-21834977 CCCAAGAAATCTGGGCCCAAGGG - Intergenic
1080663132 11:34313487-34313509 TCCGGGGAGCCTGGGCCCCAAGG - Intronic
1081585935 11:44383661-44383683 CCTTAGGATCCTGCACCCAATGG - Intergenic
1083307471 11:61768870-61768892 CCCTAGGGGGCTGGGCCTCAGGG - Intronic
1084352859 11:68615781-68615803 CCCTCCGTGCCTGGGCCCACAGG + Intergenic
1084446010 11:69204221-69204243 TCCTAGGCGCGTGGGTCCAAAGG + Intergenic
1084452271 11:69246218-69246240 CCCTTGGAGTCTGAGCTCAAGGG + Intergenic
1084910365 11:72382547-72382569 AGCTTGGAGCCTGGGCCCACTGG - Intronic
1085385120 11:76153155-76153177 CCCTGGGACCCTGTGCCCCAGGG + Intergenic
1085643337 11:78207203-78207225 CCCTAGAATCCTGGGACCACAGG + Intronic
1085702216 11:78755454-78755476 CCCGAGGAGGCTGGGCGCAGTGG - Intronic
1089477907 11:118780615-118780637 CCTTAGGAGACTGTGACCAAGGG - Intronic
1089508125 11:118978705-118978727 CCCTAGGATCCTAGGCCTTAAGG - Intronic
1089692793 11:120197353-120197375 GCCGAGGAGCCTGGGCAGAAAGG + Intergenic
1090181801 11:124705957-124705979 CCCGAGTAGCCTGGGACCACAGG - Intergenic
1092002566 12:5044283-5044305 CCCAAGGAGCCGGCGCCAAAGGG + Exonic
1093960289 12:25265066-25265088 CAATAGGAGACTGTGCCCAAAGG - Intergenic
1095952590 12:47789962-47789984 ACACAGGAGCCAGGGCCCAAGGG + Intronic
1096528102 12:52225743-52225765 TCCTAGAACCCTGGACCCAAAGG + Intergenic
1096534347 12:52261580-52261602 CCATGGGAGCTTGGGACCAAGGG + Intronic
1096995116 12:55833482-55833504 CCCTTGGAGCCCTGGCCCAGTGG + Intergenic
1098326916 12:69312623-69312645 CCCTAGCAGCTTGGGGCCAGGGG - Intergenic
1098560299 12:71865268-71865290 CTCTAGCAGCTTGGGCCCAGGGG + Intronic
1102327341 12:111998528-111998550 CCCTATGAGGCTGGGCGCAGTGG + Intronic
1103867334 12:124063583-124063605 ACCTGGGAACCTGGGTCCAAAGG + Intronic
1104215604 12:126729833-126729855 AGCGAGGAGACTGGGCCCAAAGG + Intergenic
1104684508 12:130776057-130776079 CCTGAGGAGCCCGGCCCCAAAGG + Intergenic
1105330602 13:19412146-19412168 GCCTAGGGGCCTGAGCCCAAGGG + Intergenic
1105918673 13:24940921-24940943 GCCTAGGGGCCTGAGCCCAAGGG + Intergenic
1106028917 13:25980553-25980575 CCCTAGGACCCTGCTCACAAAGG - Intronic
1108601450 13:51998751-51998773 CCTGAGAAGCCTGGGCCCAAAGG + Intronic
1108662009 13:52595960-52595982 GCCTAGTGGCCTGAGCCCAAGGG - Intergenic
1109212412 13:59548991-59549013 CCCTAGCAGCTTGGGCCCAGGGG - Intergenic
1110433512 13:75454143-75454165 CCCTGGGAGCCTGGGACTACAGG + Intronic
1110570830 13:77001249-77001271 CTGTAGGACCCTGGGTCCAAAGG - Exonic
1113421965 13:110177922-110177944 CCCTTGGAACCTGTGGCCAAAGG + Exonic
1114620819 14:24094964-24094986 CCCGAGGGACCTGGGCCCAGGGG + Intronic
1125492494 15:40158647-40158669 CCCTCGGCGCCTGGGCACGAAGG + Intergenic
1125734968 15:41918562-41918584 CCCCAGGAGTGTGTGCCCAATGG - Intronic
1126215990 15:46155896-46155918 CCATAGGAACCTGGGACAAAGGG - Intergenic
1127165577 15:56243169-56243191 CCCTGGCAGCCCGGGCACAAGGG + Exonic
1127403213 15:58612801-58612823 CCCTAGCACCTTGGGCCCAGCGG - Intronic
1129070444 15:72946239-72946261 CCCTAGCAGCAGGGGCCCCAAGG + Intergenic
1129573550 15:76715821-76715843 CCCTAGCAGCTTGGGCCCAGGGG - Intronic
1129707841 15:77804886-77804908 CATTATGAGCCTGGGGCCAAGGG + Intronic
1132536501 16:483996-484018 CCCTGAGAGCATGTGCCCAAGGG - Intronic
1133629136 16:7602391-7602413 CCCTGGGAGGCTGGGACCAGTGG + Intronic
1133916474 16:10113380-10113402 CCTAAGGAGCCAGGACCCAAGGG - Intronic
1137754320 16:50889429-50889451 CCCCAGCAGCCTTGGCCCAGTGG + Intergenic
1138241336 16:55429598-55429620 CACTAGGGGTCTGGGACCAAAGG + Intronic
1139418036 16:66830553-66830575 AACGAGGAGCCTGGGCGCAACGG + Intronic
1139712846 16:68789770-68789792 CCCCAGGAGGCTGGGCCCGGTGG + Intronic
1141030243 16:80581387-80581409 CCCTAGGAAACTGAGCCCGAGGG + Intergenic
1141816326 16:86412021-86412043 CCCCAGGGGCCTTGGCCAAATGG - Intergenic
1142264726 16:89058463-89058485 CCCTGGGGGCCTGGGTCCCAGGG - Intergenic
1142577338 17:918244-918266 CCCCAGAACCCTGGGCCCAAAGG + Intronic
1142893388 17:2959459-2959481 CCCTCTGAGGCTGGGCCCAGGGG - Intronic
1143117098 17:4587273-4587295 CCCCGGGAGCCAGGGCTCAAGGG - Intronic
1143295042 17:5864735-5864757 CCATAGGAGCTTTGGCCCCATGG + Intronic
1144438504 17:15261646-15261668 GCCCAGGAGCCTGGACCGAAGGG + Intronic
1146278787 17:31531757-31531779 CCTTAGGACCCTGGGACCAAGGG + Exonic
1147734281 17:42625098-42625120 CCCCATCAGCCTGGGCCCCAAGG + Intergenic
1148558305 17:48591658-48591680 CCCTAGGAGACTTGGGCCTAGGG + Exonic
1148861007 17:50604335-50604357 CCATAGGACCCAGGGGCCAAGGG - Intronic
1155414486 18:25582181-25582203 CCATAGCAGCCTGGGCCACAGGG + Intergenic
1157195016 18:45614018-45614040 CCCTACCATCCTGGGCCCAGAGG + Intronic
1159026575 18:63187958-63187980 CCCTATGAGCAGGGGCCAAATGG - Intronic
1159925725 18:74267756-74267778 CCCAAAGAGCCTGAGCCAAATGG + Intronic
1160938634 19:1609784-1609806 GCTTGGGAGCCTGGGCCCCATGG - Exonic
1160968327 19:1756206-1756228 CCCTGGGAGCCTGGACCCACAGG + Intronic
1161773112 19:6241993-6242015 CCCTGGGAGCCTGGGAGCCAGGG + Intronic
1161806190 19:6444342-6444364 CCCTAGGACCCTGGCTTCAAAGG + Intronic
1164722836 19:30444787-30444809 CCCGAGGTGCCTGTGCCCATGGG + Exonic
1164750249 19:30648432-30648454 ACCAAGGAGCCTGGCCCCGATGG + Intronic
1165092153 19:33393118-33393140 CCCTAGGAGGCTGGGCTGATGGG - Intronic
1165914327 19:39248380-39248402 CCCTGGGACCCTGGCCCCACCGG - Intergenic
1166716124 19:44968928-44968950 CCCTAAGACCCTGGACCCCAGGG + Intronic
1168317113 19:55489206-55489228 ACCCAGGAGTCTGGGCCCAGGGG + Intronic
1168526541 19:57093123-57093145 CTCAAGGCGCCTGGGCTCAACGG - Intergenic
1168551708 19:57301903-57301925 CCCTAGCAGCTTGGGCCCAAAGG + Intergenic
927850412 2:26495116-26495138 GCCTAGGAGCCTGGTCCCGCAGG + Intronic
933778794 2:85787553-85787575 CCCAAGGAGCCTGGACCCAAGGG - Exonic
934188010 2:89763461-89763483 CGGTGGGAGCCGGGGCCCAAGGG + Intergenic
935124201 2:100208630-100208652 CCCCAGGACACTGGGCCCTAGGG - Intergenic
936404187 2:112187616-112187638 CCCTAGAAGCCTGGGTGCACTGG - Exonic
937665585 2:124483324-124483346 CACTAGGAGCTTGGGACCAGTGG + Intronic
937962570 2:127471943-127471965 ACCCAGGGTCCTGGGCCCAAAGG - Intronic
938069668 2:128301785-128301807 CCCATGGAGGCTGGGCCCAGCGG - Intronic
939317320 2:140567512-140567534 CCCTAGCAGCTTGGGCTCAGTGG - Intronic
939453429 2:142401315-142401337 CTCTAGCAGCTTGAGCCCAAGGG - Intergenic
942360424 2:175167242-175167264 CCCTAGGGACCAGGGCCGAAAGG - Intronic
945476114 2:210284800-210284822 CCCTAGCAGCTTGGGCCCAGAGG + Intergenic
948089716 2:235282725-235282747 GCTTAAGAGCCTGGGCCCACAGG + Intergenic
948412319 2:237773680-237773702 CTCTAGCACCCTGGGCCCTAGGG + Intronic
948674419 2:239588662-239588684 CCATGGGAGCCTGGGCCCCTGGG - Intergenic
1170500978 20:16974991-16975013 CGCTAGCAGCCTGGGCGCCACGG + Intergenic
1171255794 20:23688288-23688310 CCCTAAGGGGCTGTGCCCAAGGG + Intronic
1173287792 20:41688776-41688798 TACTAGGAGTCTGGGCGCAAAGG - Intergenic
1174418786 20:50385720-50385742 CCCTGGGAACTTAGGCCCAACGG + Intergenic
1175533674 20:59692240-59692262 CCCTACAAGCCTGTACCCAACGG + Intronic
1175912756 20:62412623-62412645 GCCTCGGAGCCTGGGGACAAAGG - Exonic
1176385137 21:6135340-6135362 CCCCAGGGGCCTGGGCACAGTGG - Intergenic
1176742409 21:10616480-10616502 GCCTAGGGGCCTGAGCCCAAGGG - Intergenic
1179277918 21:39908653-39908675 CCCCAGCTGCCTCGGCCCAAAGG + Intronic
1179547890 21:42124640-42124662 GCCTAGGAGCCAGGGCCAGAAGG + Intronic
1179633991 21:42695948-42695970 CCCAAGGATCTTGGGCCCAAGGG + Intronic
1179738336 21:43402912-43402934 CCCCAGGGGCCTGGGCACAGTGG + Intergenic
1180564288 22:16649690-16649712 GCCTAGGGGCCTGAGCCCAAGGG - Intergenic
1180801466 22:18634001-18634023 CACTACGCGCCTGGGCCCACGGG - Intergenic
1180852701 22:19029541-19029563 CACTACGCGCCTGGGCCCACGGG - Intergenic
1181003381 22:19998377-19998399 CCCTGGGAGCCTGTGGCCAAAGG + Intronic
1181220255 22:21361260-21361282 CACTACGCGCCTGGGCCCACGGG + Intergenic
1183927589 22:41217052-41217074 CTCCAGGAGCCTGGACCCCAAGG - Intronic
1184713643 22:46268102-46268124 CCCCAGGACCCGGGGCCCGAGGG - Intronic
1184892692 22:47389483-47389505 CCCCAGAAGCCTGGGCCCCGTGG - Intergenic
1185093136 22:48786926-48786948 ACCTGGGAACCTGGGCCCAGAGG - Intronic
1185245222 22:49769737-49769759 TGCTCAGAGCCTGGGCCCAAAGG + Intergenic
950121367 3:10484346-10484368 CCCGAGGAGCCTGTGCCCACGGG - Intronic
950442076 3:13016066-13016088 ACTTAGCAGCTTGGGCCCAAAGG + Intronic
951294456 3:20917325-20917347 CCCATGGAGCCTGGGACAAAAGG - Intergenic
952386512 3:32845342-32845364 CCCCAGGAGCCAGGGCAAAAAGG + Intronic
953449118 3:42991645-42991667 GCCTGGGTGCCTGGGCCCAGCGG + Intronic
953475824 3:43205264-43205286 CCCAAGTAGTCTGGCCCCAAAGG + Intergenic
953519939 3:43632237-43632259 CCCTAGGAGGCTGGCCTCTATGG + Intronic
953926462 3:46985170-46985192 CGCTGGATGCCTGGGCCCAAGGG - Intronic
953984498 3:47430965-47430987 TCCTGGGACCCTGGGCACAAAGG + Intronic
954688548 3:52383727-52383749 GCACAGCAGCCTGGGCCCAATGG - Intronic
954881228 3:53837349-53837371 CCCGAGCAGCCAGGGCACAAGGG - Intronic
955392872 3:58534072-58534094 CCTCAGGAGCCTGGGCTCAGAGG - Exonic
957929937 3:86864232-86864254 AACTTGGAGCCTGGGGCCAAGGG + Intergenic
958822231 3:98988697-98988719 CCCTAGGAGCCTTGGCTGAAGGG + Intergenic
961048223 3:123724267-123724289 CCATAGGAGGCTGGGCGCAGTGG - Intronic
961823055 3:129585059-129585081 CCCCATGAGCCTGGGGCCAGGGG + Intronic
962814886 3:138988658-138988680 CCCTAAGAGACAGAGCCCAAAGG - Intergenic
962900057 3:139754244-139754266 CCCTTGGAGCCTTAGCCCAAAGG + Intergenic
964811276 3:160667435-160667457 CCCTAGGAGTTTGGGCAGAAAGG - Intergenic
968190831 3:196665943-196665965 CCCCAGGAGGCTGGCCTCAATGG + Intronic
969533696 4:7742891-7742913 CCCTAGGATCGTGGTCCCAGAGG + Intergenic
983588004 4:169376172-169376194 CCCTAGGAGCTTGGGTCCAGGGG - Intergenic
984752251 4:183289269-183289291 CCCTAGAAGCCAGGGCCTAAGGG - Intronic
986129237 5:4911708-4911730 CCCTTGGAGCCTGGGAGCTATGG + Intergenic
986346145 5:6837169-6837191 CCCAGGGGGCCTGGGCCCTAAGG + Intergenic
988642065 5:33050607-33050629 CCCCAGGAGCTTGGGCCCAAGGG - Intergenic
990928728 5:61061564-61061586 CTCTATCATCCTGGGCCCAAGGG - Intronic
992519966 5:77540579-77540601 CCCTACGAGCCTGGGACTAAAGG - Intronic
992947800 5:81826453-81826475 TTTTAGGAGCCTGGGCCTAAGGG - Intergenic
997467578 5:134098649-134098671 GCCTAGAGGCCTGGGGCCAAGGG - Intergenic
997723199 5:136097413-136097435 CCCAAAAAGCCTGGGCCCAGAGG + Intergenic
999106489 5:149075514-149075536 CCCCAGTAGCTTGGGCCCAGGGG - Intergenic
999252105 5:150188884-150188906 CCCTTTGAGCCTGGCCACAAAGG - Intergenic
999263811 5:150253620-150253642 CTCTAGGGGCCTGGGCTCACAGG + Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1002329418 5:178431186-178431208 CACTGGCAGCCTGGGCCCACTGG - Intronic
1004664828 6:17740424-17740446 CACTAGGGGCTTGGGCCCCAAGG + Intergenic
1006068643 6:31480780-31480802 CCCAAGGCTCCTGGGCGCAATGG - Intergenic
1006629446 6:35420532-35420554 CCCTAGCTGCCTGGTCCCCAGGG - Intronic
1007716484 6:43859002-43859024 TGCTCGGAGCCTGTGCCCAAAGG - Intergenic
1007939688 6:45768478-45768500 TCCTAGCAGCCTAGGCCAAAAGG - Intergenic
1011511934 6:88111108-88111130 ACCTAGGAGCCCGTGCCTAAAGG - Intergenic
1017710455 6:157162961-157162983 CCCTGGAAGCCAGAGCCCAAGGG + Intronic
1019895567 7:3979805-3979827 CCTTAGGAGCCTGGTCCCTCTGG - Intronic
1022505837 7:30908275-30908297 CCCTAGGAGGCTGGGCTCCAGGG - Intergenic
1023113840 7:36841129-36841151 CTCTAGGAGCAAGTGCCCAAGGG - Intergenic
1023887358 7:44368593-44368615 CCCTAGCTGCTTGGGCCCAGGGG - Intergenic
1025252218 7:57359275-57359297 CCCTGGGAACTTAGGCCCAATGG - Intergenic
1026896559 7:74013129-74013151 CCCCATCAGCCTGGGCCCATAGG + Intergenic
1031729260 7:125277576-125277598 ACCTAGGAGACTGAGGCCAAAGG + Intergenic
1034449865 7:151131592-151131614 ACCCTGGAGCCTGGGCCCAGAGG - Intronic
1035063934 7:156091809-156091831 CCCCAGGAGGCTGATCCCAAGGG + Intergenic
1035673355 8:1436985-1437007 CCCTACACGCCTGGGCCGAACGG - Intergenic
1037189535 8:16106101-16106123 CCCATGGAACCAGGGCCCAAGGG + Intergenic
1038545854 8:28425144-28425166 CCCCAGGAGCCAGGGACAAACGG - Intronic
1041814891 8:61959266-61959288 CCCTGTGAGCCTGGGCCTTATGG - Intergenic
1048444632 8:134484157-134484179 CCCGAGGAGCCAGTGCACAAAGG + Intronic
1048503302 8:134997984-134998006 CCCCAGGAGCCTGGGCACAGTGG - Intergenic
1049148659 8:141020328-141020350 ACCTGGGAGCCTGGGCCCGCGGG + Intergenic
1049313564 8:141946934-141946956 GCCCAGGAGCCTTGGCCCAGAGG - Intergenic
1052764308 9:32625270-32625292 TCCTAGGAGCCTTGTCCCACAGG + Intergenic
1052801307 9:32970638-32970660 TCCTAAGAGCCTGGGGCCAAAGG + Intergenic
1054793086 9:69274051-69274073 GCCTTGGAGCTTGAGCCCAAGGG - Intergenic
1055085181 9:72306425-72306447 GCCCAGGATCCTGGGCTCAAGGG - Intergenic
1059686790 9:116645485-116645507 CCCAAGGAGCTAGGGTCCAATGG + Intronic
1059787292 9:117599215-117599237 CTCTAGCAGCTTGAGCCCAAGGG - Intergenic
1060741090 9:126097980-126098002 CCCTAGGAGGCAGTCCCCAAAGG - Intergenic
1062024892 9:134335766-134335788 CCCTGGGAGCCAGGGCCCCGAGG - Intronic
1062173698 9:135149195-135149217 CCCCAGAAGCCTGAGCCTAAGGG + Intergenic
1062249952 9:135588925-135588947 CCCTTGGAGCCCCTGCCCAAGGG + Intergenic
1062375907 9:136261827-136261849 CCCTGGGGGCCTGAGCTCAAAGG + Intergenic
1194596745 X:95868113-95868135 CCCTAGGGGCTCAGGCCCAAGGG - Intergenic
1195757680 X:108215517-108215539 TCCTAGGAGCCTGGCCTCTATGG + Intronic
1196457067 X:115898394-115898416 GCCAAGGAGCCTGGGCTCAGGGG - Intergenic
1196683911 X:118495296-118495318 CCCTAGCCGCCTGGGCCCTGGGG + Intergenic
1198807138 X:140503950-140503972 CGCCATGAGCCTGGGCCCCATGG - Exonic