ID: 906463737

View in Genome Browser
Species Human (GRCh38)
Location 1:46057981-46058003
Sequence GGCCTCCAGGGCTTGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906463737_906463748 13 Left 906463737 1:46057981-46058003 CCTCCCATCAAGCCCTGGAGGCC 0: 1
1: 1
2: 6
3: 31
4: 314
Right 906463748 1:46058017-46058039 AGTTTCGTGAGCTGGGCCCAGGG 0: 1
1: 6
2: 91
3: 518
4: 1003
906463737_906463747 12 Left 906463737 1:46057981-46058003 CCTCCCATCAAGCCCTGGAGGCC 0: 1
1: 1
2: 6
3: 31
4: 314
Right 906463747 1:46058016-46058038 GAGTTTCGTGAGCTGGGCCCAGG 0: 1
1: 0
2: 6
3: 107
4: 703
906463737_906463743 -10 Left 906463737 1:46057981-46058003 CCTCCCATCAAGCCCTGGAGGCC 0: 1
1: 1
2: 6
3: 31
4: 314
Right 906463743 1:46057994-46058016 CCTGGAGGCCTAGAGGAAAAAGG 0: 1
1: 2
2: 25
3: 70
4: 384
906463737_906463745 5 Left 906463737 1:46057981-46058003 CCTCCCATCAAGCCCTGGAGGCC 0: 1
1: 1
2: 6
3: 31
4: 314
Right 906463745 1:46058009-46058031 GAAAAAGGAGTTTCGTGAGCTGG 0: 1
1: 0
2: 3
3: 69
4: 453
906463737_906463746 6 Left 906463737 1:46057981-46058003 CCTCCCATCAAGCCCTGGAGGCC 0: 1
1: 1
2: 6
3: 31
4: 314
Right 906463746 1:46058010-46058032 AAAAAGGAGTTTCGTGAGCTGGG 0: 1
1: 0
2: 2
3: 70
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906463737 Original CRISPR GGCCTCCAGGGCTTGATGGG AGG (reversed) Intronic