ID: 906468703

View in Genome Browser
Species Human (GRCh38)
Location 1:46108743-46108765
Sequence TGGTGGGTGTGGAGGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 7, 3: 99, 4: 727}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906468703 Original CRISPR TGGTGGGTGTGGAGGCAAGA AGG (reversed) Intronic
900300851 1:1976388-1976410 TGGTGAGAGGGGAAGCAAGAGGG - Intronic
900935625 1:5764699-5764721 GGGTGGGTGTGAGGGCATGAGGG - Intergenic
901056290 1:6450050-6450072 TGCAGGCTGTGGAGGGAAGAAGG - Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
902106812 1:14044162-14044184 TGGTGGGTGATTAGGCAAGCAGG - Intergenic
902262069 1:15233692-15233714 TAGAGGGTGTGGGGGCAGGAGGG - Intergenic
902531557 1:17093944-17093966 TGGTGTGGGTGGAGGCAGGGAGG + Intronic
902638657 1:17751747-17751769 TGGTGGGTGTAGAGGGCACAGGG - Intergenic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902792975 1:18781625-18781647 TGGTGGGGGTGGTGACAAGGAGG + Intergenic
903066312 1:20701639-20701661 AGGTGGGTGGGGAGGCAGGAAGG + Intronic
903277896 1:22233249-22233271 GGCTGGGTGTGGGGGCAAAACGG + Intergenic
903338568 1:22640701-22640723 TGGAGGGTGGGGAGGCGGGAAGG + Intergenic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
903550318 1:24153412-24153434 AGGGGAGTGTGGAGGCAAGATGG - Intergenic
903550333 1:24153453-24153475 AGGGGAGTGTGGAGGCAAGATGG - Intergenic
903593072 1:24471878-24471900 AGCTGGGAGTGGAGGCAGGAGGG + Intronic
903835366 1:26200198-26200220 TGGTGGGTGGGCACTCAAGATGG - Intronic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
906274525 1:44506265-44506287 TGGCGGGTGTGGAGGGGTGAAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906687587 1:47772424-47772446 TGGTGGCTGAGGCGGAAAGAAGG + Intronic
907328778 1:53658036-53658058 TGGTGGGTGCGGTGGCTGGAGGG - Intronic
907908932 1:58810343-58810365 TGGTGTGTATGGAGTCTAGAGGG + Intergenic
909624438 1:77700037-77700059 TGGTGGGGGTTGAGGGATGAGGG + Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910476344 1:87611406-87611428 TGGTGTGTGAGGAAGAAAGAAGG - Intergenic
911043158 1:93607830-93607852 TGGTGGGTGCAAAGGCAGGAAGG - Intronic
911312767 1:96316370-96316392 AGGTGGGTGGGAAGGCAAGATGG - Intergenic
911597148 1:99810614-99810636 TGGTGGGTGATGAGGTCAGAGGG + Intergenic
912233037 1:107817673-107817695 AGGGGGGTGAGGAGGCAAGGAGG + Intronic
912409168 1:109467562-109467584 TGGTGGGTTTGGGGGCAGGACGG - Intronic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915468416 1:156111838-156111860 TGATGGGAGTGGTGGCTAGAGGG - Intronic
915622278 1:157092964-157092986 TGACGGGAGAGGAGGCAAGAAGG + Exonic
915761775 1:158320667-158320689 TGGAGGGGGAGGAGCCAAGATGG - Intergenic
915916723 1:159945038-159945060 TGGTGTGTGGGGAGACTAGAAGG - Intronic
915916749 1:159945181-159945203 TGGGGGGTGGGGAGACCAGAAGG - Intronic
917129927 1:171730731-171730753 TGGTGGTTCTGGGGGCAAGGAGG + Intronic
917349684 1:174063954-174063976 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
918055966 1:181022539-181022561 TGGGGGGAGGGGAGGCAAGTTGG - Intronic
918067701 1:181112732-181112754 TGGAGGATGTGGAGGCAGGGAGG + Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919247092 1:195002664-195002686 TGCTGGGTGTTGAGGCAGGGTGG - Intergenic
919265506 1:195259248-195259270 TGGTGGGTGGGGCAGAAAGAGGG - Intergenic
919618346 1:199835260-199835282 TGGTGTCAGTGGAGGCAAGTGGG + Intergenic
920753234 1:208702691-208702713 ACCTGGGTGTGGAGCCAAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922209925 1:223479048-223479070 TGGGGGGTGAGGAGGTGAGAGGG + Intergenic
922209956 1:223479127-223479149 TGGGGGGTGAGGGGGCGAGAAGG + Intergenic
922317412 1:224454923-224454945 TGGAGGGGGTGGTGGCAAGCAGG + Intronic
922726206 1:227924129-227924151 TCGTGGGTGTGAAGGCAAGTGGG - Exonic
923039017 1:230306394-230306416 TGGTGGGGGTGGAGGAGGGAAGG + Intergenic
923094886 1:230767401-230767423 TGGGTGGTGTGGAAGGAAGACGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923476359 1:234335337-234335359 GGGTGGGAGTGCAGGCAGGATGG - Intergenic
924057658 1:240139744-240139766 TGTAGGGTGTGGTGGGAAGATGG + Intronic
924294425 1:242570899-242570921 TGGTGAGAGAGGAAGCAAGAAGG + Intergenic
924417183 1:243868989-243869011 TGGTAGGTGTGGAGATAATAGGG - Intergenic
924517563 1:244779427-244779449 TTGTGGGTGGGGAGCCAAGAGGG - Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1065230761 10:23595916-23595938 TGATAGGGGTGGAGCCAAGACGG - Intergenic
1065437089 10:25714045-25714067 TTGTGGGTGTGTAGACAAAAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066639122 10:37537978-37538000 TGCAGGGGGTGGAGCCAAGATGG + Intergenic
1067170239 10:43900025-43900047 TGGTGGGATTGGAGGCTTGAAGG + Intergenic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1068540839 10:58293511-58293533 TGGTGGGGGTGGGGGAAAGGGGG + Intergenic
1069256410 10:66336361-66336383 TGCTGGGGGTGGAGCTAAGATGG - Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069647055 10:70008066-70008088 TCTGGGGGGTGGAGGCAAGAAGG - Intergenic
1069826628 10:71258742-71258764 TGGTGACTCTGGAGGCAAGTGGG - Intronic
1069895740 10:71679141-71679163 TGCTGGGTGTGGAGGCAGCCTGG - Intronic
1070157032 10:73841484-73841506 GGGTGAGGGTGGGGGCAAGAGGG + Intronic
1070722964 10:78769447-78769469 TGGTGGGGCTGAAGGAAAGAAGG - Intergenic
1071122563 10:82296449-82296471 TGGTGGTGGTGGAGGAAAGCAGG + Intronic
1072641045 10:97211498-97211520 TGGTGGGTGTGGATACAGGGAGG - Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073083038 10:100871788-100871810 TGGAGGGTTTGGATGCATGATGG + Intergenic
1073477139 10:103761756-103761778 TGGGAGGTGTGCAGGCAAGAAGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073676651 10:105654952-105654974 TGGTGGGAGCAGAAGCAAGAGGG - Intergenic
1074286626 10:112103922-112103944 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1075500974 10:122973877-122973899 TGGTGAGAGAGGAAGCAAGAGGG + Intronic
1075930104 10:126288538-126288560 AGGTGGGTGTGGTGACATGATGG + Intronic
1076316522 10:129545659-129545681 TGGTGGTCGTAGAGGCCAGACGG - Intronic
1076498455 10:130915141-130915163 TGGGGTGTGAGGAGGCAGGACGG - Intergenic
1077106362 11:844173-844195 TGGTGGCTGTGGAGGTGAGGGGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077350909 11:2092807-2092829 TGGTTGGGGTGTAGGAAAGAGGG - Intergenic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077948172 11:6925781-6925803 TGGTGGGTGTGGAGACACAGAGG - Intergenic
1078865247 11:15291246-15291268 TGGTGGTTGTGGCAGCAGGAGGG + Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079173362 11:18116940-18116962 TGTTGGGAGTGGAGCCTAGAGGG + Intronic
1079367566 11:19822640-19822662 TGGTGGTTGTGCAGGCAAGTAGG + Intronic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1080383401 11:31796591-31796613 CGGTGGGGGTGGAAGCAAGGGGG + Intronic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1081169196 11:39846652-39846674 TGGTAGGGGAGGAGCCAAGATGG + Intergenic
1081468996 11:43352100-43352122 TGATGGGGGAGGAGCCAAGATGG - Intergenic
1081469763 11:43359037-43359059 TGCTGAGTGTGGCGGCACGAGGG + Exonic
1081742343 11:45449398-45449420 GGGTGGGTGTGTAGGCAGGTGGG + Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082315991 11:50723233-50723255 TGGTGGGGGTGGAGGGGGGAGGG - Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082906051 11:58309743-58309765 TGATGGGAGTGGAGCCAAGATGG - Intergenic
1082914743 11:58420508-58420530 TGGTGGGAGTGGGGGAAATAGGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083386224 11:62312331-62312353 TGGTTACTGAGGAGGCAAGAAGG - Intergenic
1083509225 11:63191676-63191698 TTGGGGGGGTGGAGCCAAGATGG - Intronic
1083702351 11:64487767-64487789 TGTTGGATGTGGGGGCATGAGGG - Intergenic
1084150546 11:67286096-67286118 TGCTGGGGGTTGGGGCAAGAGGG - Exonic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084825064 11:71723724-71723746 TAGCGGGGGTGGAGCCAAGATGG + Intergenic
1084925976 11:72511516-72511538 TGGAGAGTTTGGAGCCAAGATGG - Intergenic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1085297056 11:75437255-75437277 TGGCGGCTCTGGAGGTAAGAGGG - Intronic
1085329595 11:75636847-75636869 AGTTGGGTCAGGAGGCAAGAAGG - Intronic
1085348628 11:75784059-75784081 TGTTGGGGGTGGGGGCAAGAGGG + Intronic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1087064160 11:94011725-94011747 TGGTAGGTGTGGAGGAACCAAGG + Intergenic
1087732302 11:101792783-101792805 TGGTGAGGGTGGGGGCAAAAGGG - Intronic
1088203108 11:107361807-107361829 TGTTGGGGGAGGAGCCAAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088484178 11:110325229-110325251 AGGTGGTTGGGGAGGCCAGAAGG + Intergenic
1089065353 11:115658548-115658570 TGGAAGGTGTGGAGGAATGAGGG - Intergenic
1089975212 11:122726124-122726146 TGGCAGGTGTGGAGACAACAGGG - Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1091615953 12:2051941-2051963 GGGTGGATGTGGAGGCGAGGAGG + Intronic
1091671493 12:2455200-2455222 AAGTGGGCGTGGAGTCAAGAGGG - Intronic
1091889968 12:4045496-4045518 TGGTGGGGGTGGGGGCAAGGCGG - Intergenic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1092324082 12:7510422-7510444 TGGGAGGGGTGGAGCCAAGATGG - Intergenic
1092418040 12:8307164-8307186 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
1092706425 12:11290227-11290249 TGGTGAGGCTGGAGCCAAGACGG + Intergenic
1092954162 12:13534085-13534107 TGGTGGCAGTGGAGGAAAAAAGG - Intergenic
1093314300 12:17628678-17628700 TGGAGGGGGTGCAGCCAAGATGG - Intergenic
1093320319 12:17705526-17705548 TGGCGGGGGTTGAGCCAAGATGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094603485 12:31931020-31931042 TGGTGGGTGGGGAAGCCAGTGGG - Intergenic
1094679443 12:32654965-32654987 TGGTAGGTGGGAAGGCAAAAGGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095201392 12:39388264-39388286 TGGTGAGAGAGGAAGCAAGAAGG - Intronic
1095625664 12:44311479-44311501 TGGTGGGTGTAGATGCAAACTGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096996649 12:55842442-55842464 TGATGGGAGTGGAGGTAAGCAGG + Intronic
1097059531 12:56272224-56272246 TGGGGGGTGGGGAGGTCAGAAGG + Exonic
1097190981 12:57219590-57219612 AGGAGGGTGTGGAGGCAGGAGGG - Intronic
1097296191 12:57965561-57965583 GGGTGGGGGTGGGGGCATGAGGG + Intergenic
1098608103 12:72419505-72419527 TGGTGAGAGTGGGAGCAAGAGGG + Intronic
1098794701 12:74874865-74874887 TGGTGGAGGAGGAGCCAAGATGG + Intergenic
1098919548 12:76291403-76291425 TGGTGGGTGAGGAGACATGGAGG - Intergenic
1098922953 12:76319621-76319643 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099106703 12:78506426-78506448 TGGTAGGGGAGGAGCCAAGATGG + Intergenic
1099561020 12:84174073-84174095 TGGAGGGGGTGGAGGCAGAAGGG + Intergenic
1099652647 12:85447979-85448001 TGGTAGGAGTTGAGGCCAGAAGG + Intergenic
1100292609 12:93232225-93232247 AGGTGTGTGTGGCAGCAAGATGG - Intergenic
1101221179 12:102642360-102642382 TGGTGAGAGAGGAAGCAAGAAGG - Intergenic
1101401832 12:104394687-104394709 TTGAGGGGGTGGAGCCAAGATGG - Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101811718 12:108113258-108113280 TGGTGGGTGTGGAGGTAGCCTGG + Intergenic
1102012871 12:109629566-109629588 AGATGGGGGTGGTGGCAAGATGG - Intergenic
1102046122 12:109831478-109831500 TGAGGCGTGTGAAGGCAAGAAGG - Intronic
1102238993 12:111312083-111312105 TGCTGCCTGGGGAGGCAAGAAGG - Exonic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102360590 12:112284368-112284390 TGTGGGGTGTGGAGATAAGAGGG + Intronic
1102368702 12:112362626-112362648 TGGTGGTGGTGGAGGCAGGTGGG + Intronic
1102467251 12:113137134-113137156 TGCTGGGTGGGGAGTCAAGAAGG - Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1102923254 12:116808591-116808613 TGGGGGGTGTGGAGCCAGGCGGG - Intronic
1103186696 12:118964252-118964274 AGGTGGGTGGGGGAGCAAGAAGG - Intergenic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104503639 12:129310194-129310216 TGGTGGCTGTGAGGGCAAGGAGG + Intronic
1104693054 12:130840808-130840830 TGGTGGTGGCAGAGGCAAGAAGG - Intergenic
1105807304 13:23961770-23961792 TGGTAGGTGTGGAGGCACAGAGG - Intergenic
1106054748 13:26227811-26227833 AGCTGGGTGTGGATGCAAGCTGG - Intergenic
1106177996 13:27347613-27347635 TGGGAGTTGTGGGGGCAAGAGGG + Intergenic
1106617201 13:31340588-31340610 TTTTGGGGGTGGAGCCAAGATGG + Intergenic
1106991749 13:35428264-35428286 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1107044000 13:35976170-35976192 GGGTGGGTTTGGAGGCAGGTTGG + Intronic
1107153302 13:37137765-37137787 TGGAGGGTGAGGAGGAATGAAGG - Intergenic
1107208907 13:37828281-37828303 TGGAGGGGGAGGAGCCAAGATGG - Intronic
1107435506 13:40377421-40377443 CGGTGGATGACGAGGCAAGAGGG + Intergenic
1107960081 13:45549655-45549677 TGGTGGTTGTGGAGCCTTGACGG + Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1109156368 13:58915079-58915101 TGATTGATGTGGAGTCAAGAGGG + Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1110267875 13:73558887-73558909 TGGTGTGTGCTGAGGAAAGAGGG - Intergenic
1110435887 13:75478036-75478058 AGGGAGGTGTGGAGCCAAGAGGG + Intronic
1110458004 13:75711740-75711762 TGTAGGGGGTGGAGCCAAGATGG - Intronic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1110568197 13:76977337-76977359 TGGTGGGGCTGGAGGCATGGAGG - Intergenic
1110586421 13:77199024-77199046 TAGGGGGGGAGGAGGCAAGATGG + Intronic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1111584579 13:90268291-90268313 AGGTGGATGGGGAGGCCAGAAGG + Intergenic
1113040623 13:106100605-106100627 TGGGGGGTGGGGAGGCAGGAAGG + Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113285204 13:108838906-108838928 TGGTGCTTGTGGAAGGAAGAAGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113683020 13:112257415-112257437 TGGTGAGGCTGGGGGCAAGAGGG - Intergenic
1113713709 13:112488730-112488752 TGGTGGGTGTGGAGACCTGGGGG - Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114872933 14:26679356-26679378 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
1114973312 14:28061792-28061814 TGAAGGGAGTGGAGGTAAGAAGG - Intergenic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1116015822 14:39405496-39405518 GGGGGGGTGTGGAGGCATGGTGG + Intronic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117807824 14:59513177-59513199 TGAGGGGGGTGGAGCCAAGATGG + Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1119190105 14:72675600-72675622 TGGAGGAAGTGGAGGCCAGAGGG - Intronic
1119505273 14:75167421-75167443 TGGTGGGGGTGGGGGCGAGGAGG - Intronic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1120515605 14:85465926-85465948 TGGTGAGAGAGGAGGCAAGACGG - Intergenic
1120828798 14:88979749-88979771 TGGTGGGTGATGAGGAAATAAGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121437148 14:93927492-93927514 TGGCGGGTGTGGGGGCAGGCTGG + Intronic
1121647017 14:95525547-95525569 GGGCGGGTGGGGGGGCAAGAAGG - Intergenic
1121691938 14:95884283-95884305 TGGTGGGAGAGGAGGTGAGATGG - Intergenic
1121774868 14:96584042-96584064 TGCTGGGTGGGGAGGCAGCAGGG - Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122438130 14:101712750-101712772 TGGTGGGTGGGGAGAGATGACGG - Intergenic
1122499851 14:102190089-102190111 TGAAGGGTGGAGAGGCAAGATGG + Intronic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122772601 14:104104016-104104038 AGGTGGGAGAGGAGCCAAGAAGG - Intronic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125344257 15:38702900-38702922 GGGTGGTTGTGTAGGCAAGTTGG - Intergenic
1126542571 15:49839349-49839371 CGGGGGGGGTGGAGCCAAGATGG - Intergenic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126788103 15:52195686-52195708 TGGGAGGTGGGGAGGCTAGAAGG - Intronic
1126885164 15:53141457-53141479 TGTTGGGGGAGGAGCCAAGATGG - Intergenic
1128379531 15:67102188-67102210 TGGTGGGCCTCGAGGCAGGAAGG - Intronic
1129132668 15:73514452-73514474 TGGCGGGGGAGGAGCCAAGATGG - Intronic
1129172780 15:73818061-73818083 TGGTGTTTGTGGAGGCCAGGTGG + Intergenic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130190430 15:81730277-81730299 TGATGGGAGAGGAGCCAAGATGG + Intergenic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1130709050 15:86261312-86261334 TGGAGGGGGTGAAGGCAAGCAGG + Intronic
1130924218 15:88373150-88373172 TGCTGGAGGTGAAGGCAAGAAGG + Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131438511 15:92441358-92441380 AGAGGGGTGTGGAAGCAAGAAGG + Intronic
1132029781 15:98430255-98430277 TGGGGGGTGTGGAGTGTAGATGG - Intergenic
1132231977 15:100191142-100191164 TGGTGTTTGAGGAGGCAGGAGGG - Intronic
1133034462 16:3027205-3027227 TGGTGGGTGTGGAGGATCGGAGG - Exonic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133660398 16:7910827-7910849 TTGTGGATGTGAAGGCAAAAGGG + Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1134687430 16:16168616-16168638 GGGTGGGTGTGGTTGCAAAAGGG + Intronic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136428479 16:30184152-30184174 TGGTGGGGGAGGAGGCAGGGTGG + Intronic
1136468074 16:30458944-30458966 TGGTGGGTGGGGAGCCAGGCTGG + Intergenic
1136889517 16:33958594-33958616 TGGCGGGGGAGGAGCCAAGATGG - Intergenic
1138166008 16:54802346-54802368 TGGAGGGTGTGGATGGCAGATGG + Intergenic
1139531681 16:67545625-67545647 TGGTGGGTGGGTGGGCAAGGTGG - Intronic
1140308918 16:73830413-73830435 TGGAGGGGGAGGAGCCAAGATGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141636414 16:85316444-85316466 TGGGAGGTGTGGGTGCAAGATGG - Intergenic
1141845286 16:86604237-86604259 TGGTGGGAGTGGGAGCAGGAGGG - Intergenic
1141897035 16:86964827-86964849 TGGCGGGGGTGGGGGCGAGAGGG - Intergenic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1142703102 17:1676451-1676473 TGGTGGGGGAGTGGGCAAGAGGG - Intronic
1143089599 17:4441515-4441537 TTGTGGGTGTTGAACCAAGATGG - Intronic
1144630902 17:16871953-16871975 TGGCTGGTGCGGGGGCAAGAGGG + Intergenic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1146079878 17:29769950-29769972 TGGTGGATCTGTAGGCTAGAAGG - Intronic
1146453231 17:32991091-32991113 TGGTGGGTGTGCAGGGATGTTGG - Intronic
1146803390 17:35845009-35845031 AGGTGGCTATGGAGGCAAAATGG + Exonic
1146902090 17:36595210-36595232 TGGAGGGTGGGGAGGAGAGAGGG + Intronic
1147238089 17:39072289-39072311 TGCTGGGTGGGGAGGCAGGGGGG - Intronic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148443716 17:47725471-47725493 AGCTGGGAGTGGGGGCAAGAAGG - Intergenic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148743381 17:49905565-49905587 GGGTAGGAGTGGGGGCAAGAAGG - Intergenic
1149394485 17:56225439-56225461 TGGCCAGTGAGGAGGCAAGATGG - Intronic
1149568867 17:57658162-57658184 TGGGGGCTGTGGACCCAAGATGG + Intronic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1150602679 17:66664197-66664219 TGGTGGTTTGGGAGGCAGGATGG + Intronic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1151163604 17:72185903-72185925 TGGTGGCTGAGCAGGCAGGAGGG + Intergenic
1151815124 17:76468016-76468038 TGGGGGGTGGGGAGGTTAGAGGG - Intronic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152211732 17:79006041-79006063 TGCTGTCTGTGGAGGCAGGATGG - Intronic
1152228858 17:79104819-79104841 TTGAGGGTGTGAGGGCAAGAGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152595372 17:81235331-81235353 TGGTGGGTGTGCAGTGAGGATGG - Intronic
1152720457 17:81921082-81921104 TGGTGGGTGTGGAAGCAGCGTGG + Exonic
1152963942 18:97540-97562 AGGTGGCTGTGGCAGCAAGAGGG - Intergenic
1153576257 18:6524661-6524683 TAGTGGGTGAGGATGCAAGTAGG + Intronic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1154031191 18:10755864-10755886 TGGAGGATGAGGAGGCAGGATGG + Intronic
1154295751 18:13145812-13145834 TGGTGAGAGAGGAAGCAAGAGGG + Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156220090 18:35042078-35042100 TGGAGAGTGTGCAGGAAAGATGG + Intronic
1156481925 18:37441738-37441760 TGGTGAGTGGGGAGGCAAGCTGG - Intronic
1156514936 18:37671394-37671416 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1156516688 18:37686146-37686168 TGGTGGGGGTGGGGGCAAATGGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157283030 18:46358595-46358617 TGGTGGCTGTGGAGAAAGGAGGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157899934 18:51505068-51505090 TGATGGGTGAGGAGTGAAGAGGG + Intergenic
1158054395 18:53261333-53261355 ACGAGGGTGTGGAGCCAAGATGG - Intronic
1159010944 18:63058037-63058059 TGGTGGATGTGGGGGCACCAGGG + Intergenic
1159245255 18:65797409-65797431 TGGTTGGTGTGCAGGAAAGCAGG + Intronic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160245025 18:77151334-77151356 TGGTGGGTGTGTTGGCAAGGAGG + Intergenic
1160294340 18:77623721-77623743 AGGTGGGTGTGCAGGTGAGAAGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160821896 19:1062806-1062828 TGGTGTGGGTGGAGCCAACATGG - Intronic
1161028821 19:2048724-2048746 GGGTGGGTGGGGAGGCAGGAGGG - Intronic
1161082386 19:2317726-2317748 TGGCTGGTCTGGGGGCAAGAAGG + Intronic
1161104474 19:2436660-2436682 GGGTGGCCGTGGAGGCGAGAGGG - Intronic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1162054102 19:8052586-8052608 TGGGGAGTGGGGAGGCAAGGGGG + Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162939180 19:13997756-13997778 TGGTAGGAGTGGAGGCAGGCAGG + Intronic
1163186301 19:15641612-15641634 TGGTGAGTGTGGCAGCAGGACGG + Exonic
1163218410 19:15897393-15897415 TGGTGAGTGTGGCAGCAGGATGG - Exonic
1163563143 19:18032869-18032891 TGGGGGGTGGGGAGGTCAGAAGG - Intergenic
1163886290 19:19967457-19967479 TGGTGGGGGTGGGGCCAAGATGG - Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1164475969 19:28576237-28576259 TGGTGGGAGTGGAATCATGAGGG + Intergenic
1164552803 19:29225776-29225798 TGGTGGGGGAGGAGCCAAGATGG + Intergenic
1164980964 19:32614094-32614116 AGGTGGGTGTGGCTGTAAGAGGG + Intronic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165979354 19:39706694-39706716 TGGAGGGGGTGGAGGAGAGAAGG + Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1168305562 19:55433340-55433362 TGGTGGGCGTGCAGGCTGGACGG + Exonic
1168636131 19:57998958-57998980 TGATGGGTGTGGAAAGAAGAGGG - Intronic
1168645421 19:58056256-58056278 TGGGGGCTGTGGAGGCAGCAGGG - Intergenic
1168716497 19:58531438-58531460 TGGAGGGTGTGGTGTCAACATGG - Intronic
925417278 2:3679350-3679372 TGGTGGGGCTGGAGGCTGGAGGG + Intronic
926120251 2:10237841-10237863 GGCTGGGGGTGGAGGCAGGATGG - Intergenic
926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG + Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
928949354 2:36800630-36800652 TGGAGGGTGTGGAGGCGTGCAGG - Intronic
929537025 2:42790154-42790176 TGGGAGGCATGGAGGCAAGACGG + Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929649781 2:43666482-43666504 TGTTGGGGGAGGAGCCAAGATGG - Intronic
930383048 2:50656251-50656273 GGGTGGGTTTTGAGCCAAGAAGG - Intronic
930911750 2:56637374-56637396 GGGTGGGGGAGGAGCCAAGATGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931597153 2:63960123-63960145 TGGTGGGTGGGGAGTTAACAGGG + Intronic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933550315 2:83768299-83768321 TGGGGGGGGAGGAGCCAAGACGG + Intergenic
933573499 2:84040620-84040642 GGGTGGGTGAGGAGGCAGCATGG + Intergenic
933658800 2:84909741-84909763 TGGTGGTGGTGGTGGCAATAGGG - Intergenic
934476874 2:94599532-94599554 TAATGGGTCTGGTGGCAAGAGGG - Intronic
934494382 2:94784520-94784542 GGGTGGGTGTGGACGGAAAAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935858391 2:107299952-107299974 TAGAGGGTGTGGAGCCAAGATGG - Intergenic
936348320 2:111691986-111692008 TGTTGGGTGTGGAGGTGAGGTGG - Intergenic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
937662063 2:124442267-124442289 TGGTGGCAGTGGATGCAAGAAGG + Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938605625 2:132889904-132889926 TGAGTGGTGTGGAGGAAAGAAGG + Intronic
938720130 2:134060264-134060286 TGGGGGGGGTGGAGCCAAGATGG + Intergenic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
939051738 2:137315516-137315538 TAGTGGGGGAGGAGCCAAGATGG - Intronic
939108485 2:137977911-137977933 TGGGGGGTGGGGAGGCAAGGTGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939436216 2:142181062-142181084 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
940156021 2:150658061-150658083 TGGTGGGAGAGGGAGCAAGAGGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940835939 2:158522614-158522636 TGGAGGGGGAGGAGCCAAGATGG + Intronic
940982951 2:160023876-160023898 TGGTGGGGGTGGGGGCAGCAAGG - Intronic
941017340 2:160372326-160372348 TGGTGGGTGTAGGGGCAACAGGG - Intronic
941053970 2:160766496-160766518 GGGGGGGGGTGGAGCCAAGATGG + Intergenic
941125205 2:161576324-161576346 AGGTGGATGGGGAGGCCAGAAGG - Intronic
942539732 2:177003060-177003082 TGGTGAGAGTGGGAGCAAGAAGG + Intergenic
944098161 2:195993225-195993247 AGCTGGGAGTGGAAGCAAGATGG + Intronic
944663252 2:201938609-201938631 TGAAGGGTGTGGAGGCAGGCTGG + Intergenic
945027017 2:205629427-205629449 TAGGGGGTCGGGAGGCAAGATGG - Intergenic
945205675 2:207329346-207329368 TGGTAGGGGTGGAAGTAAGATGG + Intergenic
945254437 2:207791893-207791915 TGGGGGGCGGGGGGGCAAGAGGG + Intergenic
945429927 2:209752190-209752212 TGGTGGGGGAGGAGCCAAGATGG - Intergenic
945667085 2:212756646-212756668 TGTTGGGGGTGCAGCCAAGATGG + Intergenic
946357182 2:219195247-219195269 TGGGGGGTGGGGAGGTAGGAGGG - Intronic
946667556 2:222066828-222066850 TGATGGGCTTTGAGGCAAGAGGG + Intergenic
946816999 2:223589327-223589349 TGGTGAGTGTGGGTGCAAAATGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947498710 2:230657150-230657172 GGGTGGGTGGGGAGTCACGAAGG + Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
948820798 2:240544491-240544513 TGGGGGGGGAGGAGCCAAGATGG + Intronic
1169208461 20:3752905-3752927 GGGTGGATGGGGAGGCCAGAGGG + Exonic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171232739 20:23500506-23500528 TGGTGGAATGGGAGGCAAGAGGG + Intergenic
1171748272 20:29021936-29021958 TGGGGGGGGAGGAGCCAAGAAGG + Intergenic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172789211 20:37490953-37490975 TGGAGAGTGTAGAGGGAAGATGG - Intergenic
1172951690 20:38726660-38726682 TGGAGGCTGGGGAGGCAAGCAGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173384080 20:42572381-42572403 TGGTGGGTGGTGAGGCCAGAGGG - Intronic
1173759312 20:45545924-45545946 TGGTGGGGGTGTAGGCAGTAGGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174292860 20:49521340-49521362 TTTTGGGAGTGGAGCCAAGAGGG - Intronic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174479547 20:50821122-50821144 TGGCGGCTGTGGAGTCAGGAAGG - Intronic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1176115688 20:63430978-63431000 GGGTGGGGATGGAGGCACGAGGG + Intronic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1176319512 21:5296562-5296584 TGGGTTGTGGGGAGGCAAGAGGG + Intergenic
1176375855 21:6086626-6086648 TGGCGGCTGTGGAGGCGAGTGGG - Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1178169154 21:30019397-30019419 TGCTGGGGCTGGAGGCAGGATGG + Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178965061 21:37109072-37109094 CGGTAGGGGTGGAGCCAAGATGG + Intronic
1179477150 21:41654363-41654385 TGGTGGGTATTGAAGCCAGATGG + Intergenic
1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG + Intergenic
1180575116 22:16766365-16766387 AGGTGGTGGTGGAGCCAAGATGG + Intergenic
1180855640 22:19043078-19043100 TGCTGGGTGAGTAGGCAGGAGGG + Intronic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1181310343 22:21941283-21941305 TGGAGGGTGGGCTGGCAAGAAGG + Intronic
1181758732 22:25043108-25043130 TGGGGGGTGGGGAGGAAAGGAGG + Intronic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1183210789 22:36449960-36449982 AGGGGGTTGTGGAGGAAAGAAGG - Intergenic
1183468331 22:37991642-37991664 AGGTGGATGTGGAGGCACCATGG + Intronic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1183718725 22:39549790-39549812 TGGTGGGTGGGGAGTAAGGATGG - Intergenic
1183724851 22:39582808-39582830 GGGTGGGTGGGGAGTAAAGATGG - Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185411491 22:50685288-50685310 TGGTGGGTGTGGGGCCAGGCTGG + Intergenic
949205238 3:1430337-1430359 TGGTTTGTGTGAAGGCAAGCTGG + Intergenic
949814226 3:8040940-8040962 TGGTGGGTGTGGGGGCACGGTGG + Intergenic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950116950 3:10457053-10457075 TGGTGAGTGTGGATGTAAGCAGG + Intronic
950254351 3:11492472-11492494 TGGAGGGGCTGGAGCCAAGATGG - Intronic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
950849343 3:16047934-16047956 TGGTGGGTGGGTAGGTGAGACGG + Intergenic
951042765 3:18005801-18005823 TGGTTGAGGTGGAGCCAAGATGG - Intronic
951124174 3:18963815-18963837 TGGTGAGAGAGGAGCCAAGATGG - Intergenic
951175027 3:19589112-19589134 GGGTGTATGAGGAGGCAAGATGG - Intergenic
951321984 3:21255737-21255759 TTGTGGGGGAGGAGCCAAGATGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952885237 3:38007860-38007882 TGGTGGGTGGACAGGCAGGAGGG + Intronic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954747346 3:52794697-52794719 TGGGAGGAGTGGAGGCAGGAAGG - Intergenic
955041118 3:55318750-55318772 AGATGGGTGTTGAGTCAAGAAGG + Intergenic
955816803 3:62852409-62852431 TGATGGGGGAGGAGCCAAGATGG - Intronic
956737662 3:72250555-72250577 AGGTGGATGTGGGGCCAAGAGGG - Intergenic
957003629 3:74916968-74916990 TGGTGGGTGTGTAGGATTGAGGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957516002 3:81251688-81251710 TGGTAGGTGTGGAGCAGAGAAGG - Intergenic
958108904 3:89114325-89114347 TGGTGGGTGTGGTGGCAGCAAGG - Intronic
958704761 3:97641424-97641446 GGGTGGGGGAGGAGCCAAGATGG + Intronic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
958771252 3:98428614-98428636 TGGTGGCTGTCCAGGCCAGAAGG - Intergenic
959193041 3:103140314-103140336 TTGTGTGTGTGAAGGCAGGAAGG + Intergenic
960067835 3:113393825-113393847 TGGTGAGAGAGGAAGCAAGAGGG - Intronic
960509541 3:118531827-118531849 TTGTGGGTGTTCAGTCAAGATGG + Intergenic
960878278 3:122318339-122318361 TGGTGGATATGGTGGCAATAAGG + Intergenic
960919584 3:122732868-122732890 AGGTGGGGGTGGTGCCAAGATGG + Intergenic
961197321 3:125013661-125013683 TGGTGGGTGTGTAGGACGGAAGG + Exonic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961895740 3:130166542-130166564 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
962356781 3:134700862-134700884 TGATGGGAGGGGAGCCAAGAAGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962752055 3:138440779-138440801 TGTTGGGCTTGGAGGAAAGAGGG - Intronic
962902229 3:139771568-139771590 GGGTGGCTGTGCAGGCAAAATGG + Intergenic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964563056 3:158019673-158019695 TGGGGGGGGAGGAGCCAAGATGG + Intergenic
964578196 3:158198794-158198816 TGCGGGGGGTGGAGCCAAGATGG - Intronic
966563672 3:181351917-181351939 TGGTGAGAGTGGGAGCAAGAGGG - Intergenic
966875748 3:184320692-184320714 GGGTGGGTGTGGAGGCAGTGCGG - Exonic
966882376 3:184357700-184357722 TGGCGAGAGTGGTGGCAAGAGGG + Intronic
966948161 3:184792266-184792288 TGGTGGGGGTTGAGGCCAGCTGG - Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968445615 4:650693-650715 TGGAGGCTGCGGAGGCGAGAAGG + Intronic
968568015 4:1325121-1325143 GGGTGTGTGGGGAGGCAAGGAGG + Intronic
968816242 4:2823358-2823380 TGGTGGGTGAAGGGGCAAGGTGG - Intronic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969263672 4:6050168-6050190 TGGTGGCTGTGGTTGCTAGAAGG - Intronic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969905877 4:10395794-10395816 TGGGAGGGTTGGAGGCAAGATGG + Intergenic
971268406 4:25114663-25114685 AGGTGGGGGTGGTGGCAAGCAGG - Intergenic
971438731 4:26656002-26656024 TGGAGGGGGTGGAGCCAAGATGG - Intronic
971488801 4:27189842-27189864 TGCAAGTTGTGGAGGCAAGAGGG + Intergenic
973227495 4:47802490-47802512 TGGTGGTTGTGGTGGCCACAGGG + Intronic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974147015 4:57961602-57961624 TGTTTGGGGTGGAGGCAAAAAGG + Intergenic
974547622 4:63333598-63333620 GGTTGGGTGTGGAGCCAAGATGG + Intergenic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
975211332 4:71703623-71703645 TGGTGGGGGTGGAAACCAGATGG + Intergenic
975211370 4:71703981-71704003 TGGTGGGGGTGGAAACCAGATGG - Intergenic
975518896 4:75276589-75276611 TGGTGGAGGAGGAGCCAAGATGG - Intergenic
975996496 4:80321758-80321780 TGGTGGGTGTGGAGACAGGAAGG - Intronic
976528013 4:86115780-86115802 TGGAGGGAGAGGAGCCAAGATGG - Intronic
976925017 4:90485505-90485527 GGGGGGGGGTGGAGCCAAGATGG - Intronic
977178438 4:93842836-93842858 TGTTTGGTGAGGAGGTAAGAAGG + Intergenic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977653117 4:99492125-99492147 TGAGGGGGGTGGAGTCAAGATGG + Intergenic
978412593 4:108441571-108441593 TTGGGGGGGTGGAGCCAAGATGG - Intergenic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979972682 4:127157145-127157167 TGGTGGTTGTGGGGGGACGATGG - Intergenic
980010435 4:127588927-127588949 TTGTGGGGGAGGAGCCAAGATGG + Intergenic
980116077 4:128680111-128680133 TGGTGGCAGTGGAGGCTAAAAGG - Intergenic
980262006 4:130461567-130461589 AGGGAGGGGTGGAGGCAAGAGGG + Intergenic
980438303 4:132809546-132809568 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
980894566 4:138849887-138849909 TGGAGGCTGTGGAGGCAGGAGGG - Intergenic
980988505 4:139718392-139718414 AGGCTGGTGTGGAGGCAAGGAGG + Exonic
981085385 4:140677932-140677954 GGGTAGGTGTGGAGACAGGAAGG - Intronic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981688422 4:147480837-147480859 TGGGGGATGTGGAGGAGAGAGGG - Intergenic
981720866 4:147800123-147800145 TGCTGGCTGTGGAGGCAGAAGGG + Intronic
981839558 4:149094716-149094738 TGCCGGGGGTGGAGCCAAGATGG - Intergenic
981870998 4:149486406-149486428 TGGTGGTGGTGGTGGCAACAGGG - Intergenic
982000226 4:151015381-151015403 AGGTGTGTGTGGTGGCAGGAAGG + Intronic
982240716 4:153296636-153296658 GGGTTGGGGTGGAAGCAAGAAGG + Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983577821 4:169277179-169277201 TGGAGGGTGGGCAGGGAAGAGGG - Intergenic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
984815359 4:183831110-183831132 TGGTGGGTGTGGAGGCGTGAGGG + Intergenic
985174851 4:187189808-187189830 TTGTAGGTGTAAAGGCAAGAAGG - Intergenic
985338539 4:188922213-188922235 TGGTGGGAATTGAGGCAAGGAGG - Intergenic
985747372 5:1654932-1654954 TGGTGGGGGTGGGGCCAAGCTGG - Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986738337 5:10683663-10683685 TGGAGGGCGTGGAGGCAGAATGG + Intronic
987299624 5:16585806-16585828 TGGTGGGAGCAGTGGCAAGAGGG + Intronic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987614231 5:20251638-20251660 TGGTGGGGGATGAGGCAGGAGGG + Intronic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
989226383 5:39034326-39034348 TTTTGGGGGTGGAGCCAAGATGG + Intronic
989569423 5:42931677-42931699 TCGAGGGGGTGGAGCCAAGATGG + Intergenic
991209397 5:64087183-64087205 TTGAGGGGGTGGAGCCAAGATGG + Intergenic
992016155 5:72577314-72577336 GGGAGGGGGTGGAGCCAAGATGG + Intergenic
992043220 5:72858421-72858443 AGGTGGGTGTGAAGGCAGGAGGG - Intronic
992280873 5:75175744-75175766 TGGTTGGGGTGGAGCCAAGATGG + Intronic
993123125 5:83799624-83799646 TGGGGGGGGAGGAGCCAAGATGG - Intergenic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
993434047 5:87869546-87869568 TGGTGGGTGGGTAGGTAAGTAGG - Intergenic
993837655 5:92835123-92835145 TGGATGGTGTGGAGTCAGGAAGG - Intergenic
995309234 5:110692311-110692333 AGGTGAGGGTGGAGCCAAGATGG + Intronic
995316671 5:110782435-110782457 TGGTGAGAGAGGAAGCAAGAGGG + Intergenic
995862948 5:116661096-116661118 TGGAGGGTGCTGAGGCAACAGGG - Intergenic
996369506 5:122738360-122738382 TGGAGGGCATGGAGCCAAGAAGG - Intergenic
996674236 5:126155928-126155950 GGGGGGGGGTGGAGCCAAGATGG - Intergenic
997137111 5:131338085-131338107 TGAAGGGGGTGGAGCCAAGATGG - Intronic
997808918 5:136947560-136947582 TGTGGGGGGTGGAGCCAAGATGG - Intergenic
997905122 5:137808766-137808788 TGGTGGGTGTAGAGGTCAGTGGG - Intergenic
998009723 5:138684809-138684831 TCCTGGGGGTGGAGCCAAGATGG - Intronic
998131938 5:139655742-139655764 TGGTGGGGGAGGGGGCAGGAAGG - Intronic
998171990 5:139877907-139877929 TGGAGGGTCAAGAGGCAAGAAGG + Intronic
998570193 5:143250217-143250239 TGGTTGGGGTGGAGGCCAGCAGG - Intergenic
999382584 5:151131865-151131887 TGCAGGGTGTGGGGGCAGGAAGG - Intronic
999450209 5:151672207-151672229 AGGTGGGCGTGGAGGCGGGAAGG + Intronic
999924347 5:156358890-156358912 TGGTGGGTGGGGAGACAGGTGGG + Intronic
1000346884 5:160321792-160321814 AGTTGGGTGTGGAGCCGAGACGG + Intronic
1000593555 5:163187147-163187169 AGGTGGTTGTGGAGGCAAAGAGG + Intergenic
1001566961 5:172706082-172706104 TGGTGGCTGTGGTGGGGAGAAGG + Intergenic
1001692130 5:173641153-173641175 TGGTGGGCGTGGGGGCTAGATGG + Intergenic
1001970916 5:175954296-175954318 TGGGAGGGGAGGAGGCAAGAAGG - Intronic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1003813380 6:9810747-9810769 TGGGGGGGGAGGAGCCAAGATGG + Intronic
1003873453 6:10418731-10418753 TGGTGGGTGAGGAGGCAGGGGGG - Intronic
1004194167 6:13488576-13488598 TGGTGGAGGTGGGGGCAAGCTGG - Intergenic
1006176947 6:32128204-32128226 TGGGGGGTGGGGGGGAAAGATGG - Exonic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006382037 6:33704607-33704629 TGGTGGGGATGGTGGCAGGACGG - Intronic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007323020 6:41040787-41040809 AGGTGGGTGGGGAGTCAAGGAGG - Intronic
1007350106 6:41266278-41266300 TGGTGAGAGTGGAGGAAAGGGGG + Intergenic
1007431949 6:41781519-41781541 AGGTGGGTGTGAAGCCAGGAAGG + Exonic
1007475052 6:42114050-42114072 TGGTGTGTGTGGGAGGAAGACGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1009410669 6:63361786-63361808 TTGTAGGGGTGGAGCCAAGATGG - Intergenic
1010259777 6:73802345-73802367 TGGTGGGTAGGCAGGCAAGTTGG + Intronic
1010352403 6:74889407-74889429 TGTGGGGAGTGGAGCCAAGACGG - Intergenic
1010533290 6:76992505-76992527 AGGTGGATGGGGAGGCAAGAAGG - Intergenic
1010562106 6:77363124-77363146 GGGTGGGGGTGGGGGCAGGATGG + Intergenic
1010599396 6:77804584-77804606 TGGGGAGGGTGGAGGCAAGATGG - Intronic
1012995206 6:105965828-105965850 CGGTGAGGGTTGAGGCAAGAGGG + Intergenic
1013639574 6:112060068-112060090 TGGCTGGTGTGGAGGCAGCAAGG + Intronic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1014046168 6:116890142-116890164 TCTTGAGTGTGGAGGCAATATGG + Intronic
1014120611 6:117721291-117721313 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1014802839 6:125796318-125796340 TGGGGGGTGGGGAGAGAAGAAGG - Intronic
1015009089 6:128321914-128321936 TGGGGGTGGGGGAGGCAAGAGGG + Intronic
1015735659 6:136397496-136397518 TGGTGGGGGTGGGGGCAAGGTGG - Intronic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016591876 6:145754941-145754963 TGGTGTTTTTAGAGGCAAGATGG + Intergenic
1016845456 6:148564333-148564355 TGGTAGGTTTGGAGGAAAGGTGG + Intergenic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017168341 6:151431419-151431441 TGGTGGGTGAGCAGGCAGGCAGG + Intronic
1017523141 6:155219728-155219750 TGCTGGGTGTGGCAGGAAGACGG + Intronic
1017594677 6:156015652-156015674 TGGTAAGAGAGGAGGCAAGAGGG - Intergenic
1019002118 6:168763146-168763168 TGGCGAGAATGGAGGCAAGAGGG + Intergenic
1019019781 6:168908674-168908696 TGGAGGTTGTGGAGGCAAGCAGG + Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1020111590 7:5450964-5450986 TGGGGGGTGTGGAGGCACTGGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020330433 7:7011931-7011953 TTGTCGGGGTGGAGCCAAGATGG - Intergenic
1020454039 7:8351720-8351742 GGGTGGGGGAGGAGCCAAGATGG + Intergenic
1020538901 7:9436389-9436411 TCATGGGGGTGGAGCCAAGATGG + Intergenic
1020618944 7:10495842-10495864 TGGTGTGGGAGGAGCCAAGATGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1022933839 7:35151813-35151835 GGTTGGGGGTGGAGCCAAGATGG + Intergenic
1023116170 7:36864721-36864743 TGTGGTGTGTGGAGGCAAGTAGG - Intronic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1024004685 7:45216780-45216802 TGGTGGGTGTGTGGGCACGATGG - Intergenic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1026017691 7:66683588-66683610 TGTTGGGTGTGGAGCCTGGAAGG + Intronic
1026025795 7:66742466-66742488 TGTTGGGTGTGGAGCCTGGAAGG + Intronic
1026324964 7:69301070-69301092 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
1026612380 7:71871622-71871644 TGGTGGGAGTGGGGGCAGGCAGG - Intronic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026940707 7:74286400-74286422 TGATGGGTGGGGAGGCAGGCGGG - Intergenic
1027270662 7:76516766-76516788 TGGTGGGGGTGCAGGCAGCATGG - Intergenic
1027965050 7:84993573-84993595 AGTTGGGGGTGGAGCCAAGATGG - Intergenic
1029215545 7:98946401-98946423 TGGTGTGTGTGCACGCAAGAGGG - Intronic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1030449776 7:109693255-109693277 TGAGGGGGGTGGAGCCAAGATGG - Intergenic
1032082690 7:128867923-128867945 TGATGGGAGTGGGGGCAGGAGGG + Intronic
1032851448 7:135799005-135799027 TGGTTGGTATGGAGGCAGGGTGG - Intergenic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1035533347 8:372702-372724 TGGAGGGGGTGGAGCCAAGATGG - Intergenic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1036745779 8:11408090-11408112 AGCTGGGGGTGGAGCCAAGATGG - Intronic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038364377 8:26916088-26916110 TGGTGGGAGTGGGGGCAGGTAGG - Intergenic
1038849192 8:31257721-31257743 TGGTGGGTGTTCAGGCAGGTTGG + Intergenic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1039870350 8:41540490-41540512 TGGAGGGTGTGGAGAGAGGAGGG + Intronic
1040470345 8:47731280-47731302 TGGTGGGTGTTGTGCCAGGAGGG - Intronic
1040638038 8:49298676-49298698 TGGTGGGTGTGGGGGCGGTAAGG + Intergenic
1040976828 8:53202761-53202783 TGGTTGTTGGGAAGGCAAGAGGG + Intergenic
1041286408 8:56266438-56266460 TTTTGGGGGTGGAGCCAAGATGG - Intergenic
1041320985 8:56612266-56612288 TGGTGAGTGTGGAGGACACAGGG + Intergenic
1041338347 8:56812707-56812729 TGGGGGTGGTGGAGCCAAGATGG - Intergenic
1041455462 8:58054247-58054269 TGAGGGGAGTGGAGGCATGAAGG + Intronic
1042028837 8:64452059-64452081 TGGTGGGTGGGGAGGAGTGATGG - Intergenic
1042361979 8:67893940-67893962 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042921680 8:73926195-73926217 TGGTGGGTAGGGTGGCAAGCTGG - Intergenic
1043070880 8:75634589-75634611 TGGTGTGGGGGGAGGCAGGAGGG - Intergenic
1043475231 8:80599567-80599589 GGGTGGGGGTGGAGGCAGCATGG - Intergenic
1043546432 8:81320819-81320841 TGGTGAGAGTGGGAGCAAGAGGG - Intergenic
1043765188 8:84121927-84121949 TGGTCGGTGTGAAGAGAAGAAGG + Intergenic
1046058078 8:109102356-109102378 TGGTTCCTGAGGAGGCAAGAAGG + Intronic
1046140932 8:110090617-110090639 TGGTGGGAGTTTAGGAAAGATGG - Intergenic
1046562429 8:115854890-115854912 ATGTGGATGTGGAGGCAAAAGGG - Intergenic
1046778001 8:118184368-118184390 TGATGGAGGTGGAGGCAGGAAGG - Intergenic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047073157 8:121370630-121370652 TGGTGTCAGTGGAGGCCAGATGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1048125818 8:131634912-131634934 TGGGAGGTAGGGAGGCAAGAGGG - Intergenic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1049706627 8:144046117-144046139 TAGGGGGTGTGCAGGCTAGAGGG + Intronic
1049793698 8:144485819-144485841 AGGTGGCTGTGGCTGCAAGAGGG - Intronic
1049988150 9:970972-970994 CGGTGGTTGTGGCAGCAAGAAGG - Intergenic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050442950 9:5684261-5684283 GGGGGGGGGTGGAGCCAAGATGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051082162 9:13306669-13306691 GGATGGGGGTGGAGCCAAGATGG - Intergenic
1051296480 9:15601265-15601287 AAGTGGCTGTGGAGCCAAGATGG - Intronic
1051693573 9:19743866-19743888 TGGTGGGGGTGCAGGTAAGGAGG + Intronic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052776944 9:32741830-32741852 GAGTGCTTGTGGAGGCAAGAGGG - Intergenic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054157209 9:61649324-61649346 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054476984 9:65580329-65580351 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1056098383 9:83277078-83277100 TGGGATGTGTGGAGGAAAGATGG + Intronic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057026037 9:91734335-91734357 TGCTGGGTGTGCAGGCAAAGGGG - Intronic
1057222274 9:93263762-93263784 TGGTGGGGGTGGGGGCATGGTGG + Intronic
1057323240 9:94033417-94033439 TGGTTTCTGTGGAGGCAACATGG + Intronic
1057731882 9:97616527-97616549 TGGTGAGTGTGGAAGAGAGAAGG + Intronic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1058914389 9:109551659-109551681 TGATGGGAGAGGAGGCTAGAGGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1060003626 9:119980686-119980708 TGGTGGGGGATGAGGCATGATGG + Intergenic
1060143906 9:121234643-121234665 TGGTGCTGGTGGAGGCACGAAGG + Intronic
1061070515 9:128307334-128307356 TGGAGGGTGAGGTGGGAAGATGG + Intergenic
1061404967 9:130388665-130388687 TGGTGGGGGGGGGGGCAACACGG - Intronic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1061907751 9:133707580-133707602 GGATGGGCGGGGAGGCAAGAGGG - Intronic
1061908711 9:133711808-133711830 GGGTGGCTGTCGAGGCAGGACGG - Intronic
1061937486 9:133866159-133866181 GGGTGGGTGGGGAGCCAAGCTGG + Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1186071654 X:5827500-5827522 TGGGGTGGGAGGAGGCAAGAGGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186400315 X:9252528-9252550 TGGGGGGTGGGGGGGCAAGGAGG - Intergenic
1187602248 X:20845440-20845462 GGATGGGGGTGGAGCCAAGATGG + Intergenic
1187968925 X:24640198-24640220 TGGTGGGAGCGGAGGCTGGATGG - Intronic
1188289317 X:28368203-28368225 TTCTGGGGGTGGAGCCAAGATGG - Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189185253 X:39049270-39049292 TGGTGAGTGTTGAGGAAATATGG - Intergenic
1189194901 X:39144760-39144782 TGGTGGATGTTGAGGCAGGAAGG - Intergenic
1189644850 X:43116913-43116935 TGGAGGGGGTGGTGGCAAGTGGG + Intergenic
1189701601 X:43719301-43719323 TAGTGGGGGTGGAGACAGGATGG + Intronic
1189701813 X:43720295-43720317 CGGTGGCTGGGGAGACAAGAAGG + Intronic
1190128659 X:47726688-47726710 GGGTGCGTGTGGGGGCATGATGG - Intergenic
1190358278 X:49626187-49626209 TGAGGGGGGTGGAGCCAAGATGG - Intergenic
1190481715 X:50883973-50883995 TGGTGGGAGTTGGGGCAGGAGGG + Intergenic
1190590714 X:51997405-51997427 TGGGGGGGGTGGAGCCAAGACGG - Intergenic
1190975481 X:55396510-55396532 AGGTTGGGGTGGAGCCAAGATGG + Intergenic
1191048322 X:56162899-56162921 TCGTGGGGGTGGAGCCAAGGTGG - Intergenic
1191157880 X:57295467-57295489 TAGAGGGGGTGGAGCCAAGATGG + Intronic
1191203577 X:57810626-57810648 TGCTGGAGGTGGAGCCAAGATGG - Intergenic
1191828343 X:65389763-65389785 TATTGGGCGTGGAGCCAAGATGG - Intronic
1192233506 X:69281745-69281767 TAAAGGGTGAGGAGGCAAGAGGG - Intergenic
1192511591 X:71723332-71723354 TGGTGGGAGAGGAGGCTTGAGGG - Intergenic
1192515106 X:71758173-71758195 TGGTGGGAGAGGAGGCTTGAGGG + Intergenic
1192974339 X:76267402-76267424 TGGCGGGGGAGGAGCCAAGATGG + Intergenic
1193003044 X:76583966-76583988 TGGGGTGGGTGGAGCCAAGATGG - Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1193780896 X:85699620-85699642 TCCTGGGGGTGGAGTCAAGATGG - Intergenic
1193836335 X:86349174-86349196 AGGTGGATGGGGAGGCCAGAAGG + Intronic
1194526531 X:94983889-94983911 TGGTGGTTGTGGTGGCCATATGG + Intergenic
1195252568 X:103063494-103063516 TGGTGGGTTTGGGGGCAGGTAGG - Intronic
1195696100 X:107668754-107668776 TGGTGAGAGTGGAGGCAGGAGGG - Intergenic
1196006650 X:110843908-110843930 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1196077610 X:111594709-111594731 TGGAGGGGGAGGAGACAAGATGG - Intergenic
1196112536 X:111962835-111962857 TGCCGGGGGTGGAGCCAAGATGG + Intronic
1196171149 X:112590120-112590142 TAGTGGGGGAGGAGCCAAGATGG + Intergenic
1196380772 X:115086593-115086615 TATTGGGGGTGGAGCCAAGAAGG - Intergenic
1196823544 X:119722942-119722964 TGGTGGGTGTGTAGGCCAATTGG + Intergenic
1198712742 X:139523551-139523573 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1199530273 X:148838951-148838973 GGGTGGGTGTGAATGCAAAAAGG - Intronic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic
1201438475 Y:13985100-13985122 TGGTGGGTCGGGAGGCAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201446098 Y:14057608-14057630 TGGTGGGTCGGGAGGCAGGGAGG + Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202277885 Y:23144664-23144686 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202287318 Y:23264103-23264125 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202331300 Y:23756278-23756300 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1202430711 Y:24776003-24776025 GGGTGGGGGAGGAGCCAAGATGG + Intronic
1202439258 Y:24882160-24882182 GGGTGGGGGAGGAGCCAAGATGG - Intronic
1202539470 Y:25913782-25913804 TGGAGGGGGTGGAGCCAAGATGG - Intergenic