ID: 906469285

View in Genome Browser
Species Human (GRCh38)
Location 1:46114232-46114254
Sequence AGCCACATCATTCCAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906469280_906469285 1 Left 906469280 1:46114208-46114230 CCAATGGGTTAGGCCAACCACCC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179
906469278_906469285 9 Left 906469278 1:46114200-46114222 CCCTTAAACCAATGGGTTAGGCC 0: 1
1: 0
2: 0
3: 7
4: 52
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179
906469279_906469285 8 Left 906469279 1:46114201-46114223 CCTTAAACCAATGGGTTAGGCCA 0: 1
1: 0
2: 0
3: 7
4: 59
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179
906469276_906469285 12 Left 906469276 1:46114197-46114219 CCACCCTTAAACCAATGGGTTAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179
906469272_906469285 26 Left 906469272 1:46114183-46114205 CCTAGATCACGTGCCCACCCTTA 0: 1
1: 0
2: 2
3: 11
4: 75
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179
906469275_906469285 13 Left 906469275 1:46114196-46114218 CCCACCCTTAAACCAATGGGTTA 0: 1
1: 0
2: 2
3: 4
4: 80
Right 906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906469285 Original CRISPR AGCCACATCATTCCAAATGA AGG Intronic
904956669 1:34290213-34290235 AACCACCAAATTCCAAATGAAGG + Intergenic
906116685 1:43361620-43361642 AGCCTCATCCTTCCAAGTGGAGG + Intronic
906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG + Intronic
908685609 1:66715640-66715662 AGACACATCACTAGAAATGATGG - Intronic
912637585 1:111312337-111312359 AGTCACATCATTCCATTCGATGG - Exonic
913261326 1:117000482-117000504 AGCCACAACATTAGAAATTATGG - Intergenic
913992777 1:143630234-143630256 TGTCCCATCATTTCAAATGAGGG + Intergenic
914198983 1:145467617-145467639 AGCCACAAGATTAGAAATGATGG - Intergenic
914478093 1:148040753-148040775 AGCCACAAGATTAGAAATGATGG - Intergenic
915029981 1:152870943-152870965 AGCCACATGGTTCCCAATGTCGG - Intergenic
916076291 1:161201725-161201747 AGCCACCTCATCCCAGATGGGGG - Intronic
917780296 1:178387977-178387999 AGCCAGAACATTGCAAATTAAGG + Intronic
918031595 1:180818808-180818830 AGGGAGATCATGCCAAATGAAGG + Intronic
920516268 1:206586626-206586648 AGCAACAAAATTCCAAATGCTGG - Intronic
921290464 1:213651898-213651920 ACCCTCATGAATCCAAATGAAGG - Intergenic
922182081 1:223243332-223243354 AGCCCCATCTCTCCAAAGGATGG - Intronic
922821930 1:228490552-228490574 AGCCACCTAAATCCAAAGGAAGG + Intronic
923125261 1:231028864-231028886 AGCCACAGCATTCCCAACAATGG + Intronic
924646870 1:245886116-245886138 AGCAAGATAATTCCAAATTAAGG + Intronic
1062903196 10:1161218-1161240 AGCCACATCTTTAAAGATGAGGG + Intergenic
1063455441 10:6179349-6179371 AGCCACACAAATCCAAATAAGGG + Intronic
1065130894 10:22619210-22619232 AGCCACAGCATTCCAAGTGTGGG - Intronic
1070035464 10:72718426-72718448 ATCCACATCATTCCCAAAGGAGG - Intronic
1071735912 10:88300506-88300528 AGCTAAATCCTTCAAAATGAGGG - Intronic
1073998451 10:109342512-109342534 AGCCGCATCATACAAAATGTTGG + Intergenic
1078385629 11:10889638-10889660 AGCCACAAGATTCGAAATTATGG - Intergenic
1078834272 11:15012066-15012088 AGCCACAACATTAGAAATTATGG - Intronic
1081307766 11:41534514-41534536 TTTCACATTATTCCAAATGATGG - Intergenic
1086812616 11:91329422-91329444 ATCCACACCATTACACATGAGGG + Intergenic
1087245596 11:95832682-95832704 AGCCACTACAATTCAAATGATGG - Exonic
1087613405 11:100461152-100461174 AGCCACTTCTTTACAAAGGAGGG - Intergenic
1087895812 11:103584652-103584674 AGGCCCATCAGTCCAAATGAAGG - Intergenic
1088053780 11:105551389-105551411 AGCCACAAGATTCGAAATTACGG - Intergenic
1093610142 12:21145699-21145721 AGTCACATAATTCCAAATATTGG - Intronic
1096109940 12:49022620-49022642 GGCCACCTCGTTCCGAATGATGG + Exonic
1096705826 12:53421378-53421400 AGCCAGATCATTCCAAGAAAGGG + Intergenic
1100122654 12:91386647-91386669 AGCTACATTAAGCCAAATGAGGG - Intergenic
1100173450 12:92003513-92003535 ATCCAAACCAATCCAAATGAAGG - Intronic
1100476731 12:94942035-94942057 AGCCAGCTCATTCCAAAAGCTGG + Intronic
1102863555 12:116356866-116356888 GGCCACACAATCCCAAATGAAGG + Intergenic
1105294612 13:19076758-19076780 AGCACCATCATTCCACGTGAAGG + Intergenic
1105348741 13:19597661-19597683 AGCCACAAGATTACAAATCATGG + Intergenic
1106620843 13:31368909-31368931 AGAGACATCAATCTAAATGAGGG + Intergenic
1107219261 13:37961608-37961630 ATCCACATTGTCCCAAATGACGG + Intergenic
1107962361 13:45569919-45569941 AGTCACTTCATCCCAAAGGAGGG - Intronic
1111349366 13:87006020-87006042 AGCCAGATAATGTCAAATGAAGG - Intergenic
1115099397 14:29680014-29680036 ATCAACATCATTGCAAAGGAAGG + Intronic
1116060624 14:39920315-39920337 AACCTCATGATTCCAATTGATGG - Intergenic
1123842952 15:24268025-24268047 AGCCACATGATTAGAAATTATGG + Intergenic
1123857989 15:24434097-24434119 AGCCACATGATTAGAAATTATGG + Intergenic
1123862620 15:24484559-24484581 AGCCACATGATTAGAAATTATGG + Intergenic
1125178464 15:36853316-36853338 CACAACATCATTCCAAATCAGGG + Intergenic
1125353266 15:38789877-38789899 AGCCACATCAGTCTTAATGAGGG - Intergenic
1129985257 15:79913517-79913539 AGGCATATCACTCCCAATGATGG + Intronic
1130888860 15:88116170-88116192 TGCCACCTCTTTCCACATGACGG - Intronic
1131504173 15:93001203-93001225 AGCCTCATTCTTGCAAATGACGG + Intronic
1133864601 16:9630792-9630814 AGCCACATAATTCAACATGACGG - Intergenic
1134026128 16:10955397-10955419 AGGCAGATCTTTGCAAATGAGGG + Intronic
1134337111 16:13310558-13310580 AGACACATGATTCAACATGATGG - Intergenic
1135156913 16:20060502-20060524 AGCCTCATCATTTCAACTGGGGG - Intronic
1137243810 16:46685720-46685742 AGCCAAAAAATTCCAAATGATGG - Intronic
1139736117 16:68990335-68990357 AGCCACATCTTGCCACATGGTGG + Intronic
1147028009 17:37605979-37606001 AGAGACATCTTTCTAAATGATGG + Intronic
1147586684 17:41657117-41657139 AACCTCCACATTCCAAATGATGG - Intergenic
1151452373 17:74206035-74206057 AGCCACATCATCTAAAATGAAGG - Intronic
1152230539 17:79112134-79112156 AGCTACATCATTCCCCAGGAAGG - Intronic
1152956817 18:47606-47628 GGCCGCATTATTCCCAATGAAGG + Exonic
1156547990 18:37984910-37984932 AGCCTCATAATTCTAAATTAAGG + Intergenic
1158511530 18:58094819-58094841 AGACAGATGATTCCAAATTACGG + Intronic
1159495953 18:69204954-69204976 GGCCACATCTTTCTCAATGAAGG - Intergenic
1159789664 18:72762911-72762933 AGCCACAACACTCAAAATAAAGG + Intronic
1162601134 19:11670190-11670212 AACAATATCTTTCCAAATGAAGG - Intergenic
1166665670 19:44678770-44678792 AGCAACATCCTTCCCTATGAAGG - Intronic
925308980 2:2868434-2868456 AGCCACATCAGTCCCAATCCAGG + Intergenic
926103843 2:10137898-10137920 ACCCACATCAGTCCAGAGGAAGG - Intergenic
927560266 2:24066344-24066366 AGATATATCAATCCAAATGATGG + Intergenic
930839356 2:55827803-55827825 AGCCACATGATTAGAAATTATGG - Intergenic
932908876 2:75784593-75784615 AGCCACAAAATTAGAAATGATGG - Intergenic
934701067 2:96440571-96440593 AGCCACAACATTAGAAATTATGG + Intergenic
934959507 2:98657549-98657571 AGCCACATTATTTTAAATGTAGG + Intronic
936800452 2:116259123-116259145 AGCCATATCATTCCACCTGAGGG + Intergenic
939239690 2:139541874-139541896 AGCCAAATCCTTCCAACTGCTGG - Intergenic
942160772 2:173184491-173184513 TGCCACATCATCCCGACTGAGGG + Intronic
945041426 2:205746440-205746462 CCTCTCATCATTCCAAATGAGGG + Intronic
947144269 2:227050478-227050500 ATCCATTTCATTCCAAAAGATGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948545811 2:238727959-238727981 AGCCTCATGCTTCCAAAGGAGGG - Intergenic
1170361838 20:15554820-15554842 AGTCATTTCCTTCCAAATGAAGG - Intronic
1170952347 20:20948356-20948378 CTCCACATCAATTCAAATGAGGG + Intergenic
1176882309 21:14211933-14211955 AGCCACATCATTTCAGAATATGG + Intergenic
1177767820 21:25478461-25478483 AACCACATCATCACAAGTGACGG + Intergenic
1179513406 21:41890033-41890055 AGCTACACCCTTCCTAATGAGGG - Intronic
1182482797 22:30620481-30620503 AGCCACTTCATTCACTATGAGGG + Intronic
1182768012 22:32772722-32772744 AGCCACATCATTCCAACCTCTGG - Intronic
1184954054 22:47870384-47870406 AGAAACATTATTCCAAGTGAAGG + Intergenic
1185405238 22:50644345-50644367 AGCCACAAGATTACAAATTATGG - Intergenic
952000737 3:28782949-28782971 ACCATCATCCTTCCAAATGATGG - Intergenic
952154537 3:30628461-30628483 AGTCACAGCATGCCAAATAAAGG - Intronic
952594755 3:35002745-35002767 AACAACATCATCCCAAAGGAAGG + Intergenic
953572786 3:44084960-44084982 ACCTCCATCATTCCAAAAGAAGG - Intergenic
954578960 3:51692761-51692783 AGCCACAGCCTTCCAGATGATGG - Intronic
954756762 3:52844687-52844709 TGCCACATCAGACCAAATGCAGG + Intronic
956158615 3:66324517-66324539 AGCCACATGATTAGAAATTATGG - Intronic
958677505 3:97285516-97285538 AGCAATATCAATACAAATGATGG - Intronic
960043762 3:113176383-113176405 AGACACAGAATTCCAAATCATGG - Intergenic
960239079 3:115318998-115319020 AGCGAGATCATTCCAAAGCATGG + Intergenic
960454137 3:117849534-117849556 AGACACATCCTTAGAAATGAAGG - Intergenic
961572368 3:127808898-127808920 AGCCAGATGGATCCAAATGATGG - Intronic
963922566 3:150919828-150919850 AGTCACCTCCTTCAAAATGAAGG + Intronic
964068551 3:152604666-152604688 AGCCACAAGATTAGAAATGATGG - Intergenic
964979153 3:162657761-162657783 TTCCACAACATTCCAAATTATGG + Intergenic
966757395 3:183384366-183384388 AGCCACAAGATTAGAAATGATGG + Intronic
971092483 4:23361323-23361345 ACCCACAACATGGCAAATGAGGG - Intergenic
971221699 4:24713852-24713874 ATCCACATTGTTGCAAATGATGG + Intergenic
973047565 4:45553533-45553555 AGCCACATAAGTCCCACTGAGGG + Intergenic
973058407 4:45688974-45688996 AGAGACATCATGCCTAATGATGG - Intergenic
973265214 4:48203694-48203716 GGCCTCAGCATTTCAAATGAAGG + Intronic
980626613 4:135381470-135381492 AGCCACAACATTAGAAATTATGG + Intergenic
983886472 4:172985909-172985931 AGCCACAAGATTAGAAATGATGG - Intronic
986097108 5:4569746-4569768 AACCACATCATTAAAAATTATGG - Intergenic
987067007 5:14299638-14299660 AGGCAAATCATTTAAAATGAGGG - Intronic
987188298 5:15447161-15447183 TGCCACATCATTTCAAATCTTGG + Intergenic
987381016 5:17286080-17286102 ATCCATATCATCACAAATGATGG - Intergenic
987857341 5:23438054-23438076 AGCCACAAGATTAAAAATGATGG + Intergenic
988311771 5:29568232-29568254 AGCCACAAAACTCCAAGTGAAGG + Intergenic
995415857 5:111912240-111912262 AGCCACACCATTCTGGATGAGGG - Intronic
995929163 5:117415214-117415236 AGCCATACCATTTCAAATCATGG + Intergenic
996254580 5:121383567-121383589 AGCAAGATAATTCTAAATGAAGG + Intergenic
996355251 5:122588657-122588679 AGTAAAATTATTCCAAATGAGGG + Intergenic
996671141 5:126119097-126119119 AGCAAAATCAGTCCAAATCAAGG + Intergenic
997566586 5:134892052-134892074 AGCCACCTTATTCCAATAGAAGG + Intronic
998414339 5:141935079-141935101 AAACACATCATTACAAGTGATGG + Intronic
998865040 5:146490463-146490485 AGCCAAACAATTCCAAATAAGGG - Intronic
1000878870 5:166673281-166673303 TGCAACAACATTCCAAATGCAGG + Intergenic
1001217937 5:169873421-169873443 AGCCACACTATTTCAAATGCTGG - Intronic
1004558839 6:16728020-16728042 AGCCTCCTCATGCAAAATGAGGG - Intronic
1008168037 6:48165127-48165149 AGCAACATATTTCCAAATAAGGG - Intergenic
1008233195 6:49010755-49010777 AGCCTCATTATTCCTTATGAAGG + Intergenic
1008722059 6:54366713-54366735 AGGCACATAATTCCAAATCTGGG + Intronic
1008777169 6:55054150-55054172 TGCAACATCATTTCATATGAGGG - Intergenic
1009583738 6:65569486-65569508 AGCTACATGATTACAAATTATGG + Intronic
1010195385 6:73234627-73234649 AGCAAGATAATTCCAACTGAAGG - Intronic
1011827644 6:91329216-91329238 AGAGACATCATTCCAAAGGCTGG + Intergenic
1012013210 6:93819404-93819426 AGCCACATACTTCAAAAAGAAGG + Intergenic
1012373150 6:98530835-98530857 AGCCACATCATTCCAATCTCAGG - Intergenic
1012619662 6:101326778-101326800 AGAAACATCATTCCATAAGAAGG - Intergenic
1013844743 6:114435826-114435848 AGTCACATCATCCTAAGTGAAGG - Intergenic
1016641645 6:146356235-146356257 TGCTACAGCATCCCAAATGAAGG - Intronic
1018565631 6:165148455-165148477 TGCCACTTCATTCTAAAGGAAGG + Intergenic
1021088612 7:16453607-16453629 AGCCATTTCATTGCTAATGATGG - Intergenic
1021385240 7:20021465-20021487 AGACACAGCAGTTCAAATGAAGG + Intergenic
1021931785 7:25588176-25588198 AGCCACTTGCTTCCAAATGCAGG + Intergenic
1023461863 7:40406350-40406372 AGCCACAACATTAGAAATTATGG - Intronic
1026287980 7:68980428-68980450 AGCCACAACATTAGAAATTATGG + Intergenic
1026496380 7:70907249-70907271 AGCCACAACATTAGAAATTATGG + Intergenic
1027542629 7:79487342-79487364 AACCACTTCATTTCAATTGAAGG + Intergenic
1029509561 7:100985442-100985464 AGCCACAAGATTAGAAATGATGG - Intronic
1030101681 7:105952441-105952463 ACCCACATCTATGCAAATGAGGG + Intronic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031391114 7:121216343-121216365 GGTCACATCCTTCAAAATGAGGG - Intronic
1033261437 7:139847429-139847451 ACCCACATCATTTTCAATGATGG + Intronic
1033449709 7:141451451-141451473 GGCCACATCATTCCCAAAGCTGG + Intronic
1034668919 7:152841850-152841872 AGCAACATAATACCAAGTGATGG - Intronic
1038240735 8:25806083-25806105 ATCCATATCATTCCAAAGTATGG - Intergenic
1039306504 8:36268795-36268817 AGCCACAAGATTCGAAATTATGG - Intergenic
1042795300 8:72655775-72655797 AGTCACATTATTCTAAAAGATGG + Intronic
1046504220 8:115116307-115116329 ACCATCTTCATTCCAAATGATGG + Intergenic
1046591144 8:116208849-116208871 AGCCACAAGATTCAAAATTATGG + Intergenic
1046803190 8:118451381-118451403 AGCCACATGACTCCAACTCAAGG + Intronic
1051855916 9:21565242-21565264 AGCAACACCATTACAAAGGAAGG - Intergenic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1059508174 9:114818951-114818973 AGCCACATCTGACCCAATGAAGG - Intergenic
1059881368 9:118693570-118693592 AGAAACATCTTTCTAAATGATGG + Intergenic
1060270549 9:122137537-122137559 AGCCACATGATTTCTAATGAGGG + Intergenic
1060499985 9:124145923-124145945 AGCCACAACATTAGAAATTATGG + Intergenic
1060713403 9:125893697-125893719 TGCCAAATCATGACAAATGAAGG - Intronic
1062033005 9:134370543-134370565 AGCTACAGAATCCCAAATGAGGG - Intronic
1187382948 X:18821922-18821944 AGCCACATCCTCACCAATGAGGG - Intronic
1187521351 X:20017382-20017404 TGGCACATGCTTCCAAATGAAGG - Intronic
1187606245 X:20886267-20886289 AGACACATCCATCCAAAGGAGGG + Intergenic
1188138654 X:26521299-26521321 AGCCACAAGATTCGAAATTATGG - Intergenic
1193638761 X:83985341-83985363 AGCCACAACACTCCAAAGGGTGG - Intergenic
1194561146 X:95422355-95422377 AAACATATCATTCAAAATGAAGG + Intergenic
1194960032 X:100224435-100224457 AGCCACAAGATTAGAAATGATGG + Intergenic
1195709405 X:107761998-107762020 AGCAACATCATTACAATTGATGG - Intronic
1196248972 X:113435614-113435636 ATCCACATTGTTGCAAATGAAGG - Intergenic
1200381418 X:155841424-155841446 AGTCACAACATGGCAAATGAGGG - Intergenic
1201642322 Y:16192780-16192802 AGCCACAAGATTACAAATTATGG + Intergenic
1201660492 Y:16392540-16392562 AGCCACAAGATTACAAATTATGG - Intergenic
1201694290 Y:16807756-16807778 AGCCACAAGATTCAAAATTAAGG + Intergenic