ID: 906471211

View in Genome Browser
Species Human (GRCh38)
Location 1:46132711-46132733
Sequence CACCCAACCGCGCCGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906471201_906471211 -6 Left 906471201 1:46132694-46132716 CCCACCCGCTGAGGCGCCACCCA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471198_906471211 3 Left 906471198 1:46132685-46132707 CCCATGCTGCCCACCCGCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 143
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471196_906471211 7 Left 906471196 1:46132681-46132703 CCGCCCCATGCTGCCCACCCGCT 0: 1
1: 2
2: 5
3: 80
4: 670
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471197_906471211 4 Left 906471197 1:46132684-46132706 CCCCATGCTGCCCACCCGCTGAG 0: 1
1: 0
2: 2
3: 16
4: 241
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471200_906471211 2 Left 906471200 1:46132686-46132708 CCATGCTGCCCACCCGCTGAGGC 0: 1
1: 0
2: 2
3: 21
4: 242
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471192_906471211 13 Left 906471192 1:46132675-46132697 CCCTCCCCGCCCCATGCTGCCCA 0: 1
1: 0
2: 7
3: 99
4: 840
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471193_906471211 12 Left 906471193 1:46132676-46132698 CCTCCCCGCCCCATGCTGCCCAC 0: 1
1: 0
2: 8
3: 99
4: 875
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471194_906471211 9 Left 906471194 1:46132679-46132701 CCCCGCCCCATGCTGCCCACCCG 0: 1
1: 1
2: 1
3: 20
4: 359
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471203_906471211 -10 Left 906471203 1:46132698-46132720 CCCGCTGAGGCGCCACCCAACCG 0: 1
1: 0
2: 0
3: 5
4: 156
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471195_906471211 8 Left 906471195 1:46132680-46132702 CCCGCCCCATGCTGCCCACCCGC 0: 1
1: 3
2: 4
3: 67
4: 605
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
906471202_906471211 -7 Left 906471202 1:46132695-46132717 CCACCCGCTGAGGCGCCACCCAA 0: 1
1: 0
2: 0
3: 2
4: 76
Right 906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906471211 Original CRISPR CACCCAACCGCGCCGGGAGG GGG Intronic
906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG + Intronic
915367822 1:155325306-155325328 CACCCAACTGGGCCTGGAGGTGG - Exonic
916783010 1:168056458-168056480 CGGCCACCCGCGCCGGGAGGCGG + Intronic
923475365 1:234326637-234326659 CTCCCCACCGCGCCAGAAGGTGG + Intergenic
1066464748 10:35641810-35641832 CTCCCCGCCGCGCCGGGCGGCGG + Exonic
1067769816 10:49115314-49115336 CCCCCGCCCGCGCCCGGAGGTGG + Intronic
1068538427 10:58267148-58267170 CACCCAACCTCCCTGGGGGGTGG + Intronic
1075664714 10:124222156-124222178 CATCCGACCGCGCAGGCAGGGGG + Intergenic
1076096089 10:127736240-127736262 CACCCCACAGCGCGGGGAGCAGG + Intergenic
1076761164 10:132606371-132606393 CACGCAACCGCCCCAGCAGGAGG - Intronic
1077365622 11:2160368-2160390 CACCCCATCACGCCCGGAGGAGG - Intronic
1083227707 11:61295115-61295137 CTCCCCACGGCGCCAGGAGGAGG - Exonic
1083471716 11:62888594-62888616 CACCCAGCCAGGCCGTGAGGAGG + Exonic
1090347027 11:126079820-126079842 CACCCAGCCCCACCTGGAGGTGG + Intergenic
1090788346 11:130069556-130069578 CAGATAACCGCGCCGGGGGGCGG + Intergenic
1094818611 12:34208599-34208621 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1113105957 13:106771814-106771836 CACGCAACAGTGACGGGAGGAGG - Intergenic
1113990647 14:16024856-16024878 CTCCCAACCGCTCCAGGAGCTGG - Intergenic
1113991388 14:16030315-16030337 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1114649032 14:24271480-24271502 GACCCACCTGCGCTGGGAGGAGG + Exonic
1121644339 14:95507550-95507572 CACCCAAATGCCCAGGGAGGGGG - Intergenic
1132640106 16:974351-974373 CACCAACCCGAGGCGGGAGGAGG + Intronic
1133033720 16:3023478-3023500 CACCAAGCGGCGCCTGGAGGAGG - Exonic
1135649289 16:24191779-24191801 CACCCAAACCCTCCCGGAGGGGG - Intronic
1136296755 16:29308394-29308416 CACCCACCCACACCGGGATGTGG - Intergenic
1136909804 16:34135921-34135943 CTCCCAACCGCTCCAGGAGTTGG - Intergenic
1136910568 16:34141439-34141461 CTCCCAACCGCTCCAGGAGTCGG - Intergenic
1141086052 16:81096314-81096336 CGGCCACCCGCGCCGGGAGGCGG + Exonic
1142058377 16:88014707-88014729 CACCCACCCACACCGGGATGTGG - Intronic
1142134226 16:88444281-88444303 CACCCCACCGCACAGAGAGGAGG + Intergenic
1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG + Intronic
1145969998 17:28950999-28951021 CCCCCAACCCCGGGGGGAGGGGG + Exonic
1147293461 17:39461959-39461981 CACCAAAGCGCCCCGGGAAGGGG - Intronic
1150388903 17:64779933-64779955 CACCCAGCCGGGGCGGGAGCGGG - Intergenic
1151700533 17:75740431-75740453 CGCCCAGCTGCGCCAGGAGGTGG + Exonic
1153267637 18:3286569-3286591 CATCCAACTTCGCCAGGAGGAGG + Intergenic
1160325924 18:77948330-77948352 AACCCAGCCGCGCAGGGAGGAGG - Intergenic
1160902115 19:1433859-1433881 CACCCGCCTGCACCGGGAGGTGG + Intronic
1162205716 19:9054749-9054771 CACCCAACCAGGGCGGGAGAGGG + Intergenic
1163566122 19:18052270-18052292 CCCCAAACCGGGGCGGGAGGTGG + Intergenic
1163721197 19:18899015-18899037 CACCCAGCCGCGATGAGAGGCGG - Intergenic
1164722644 19:30443817-30443839 CAACCAGCTGGGCCGGGAGGTGG + Exonic
1167509778 19:49889904-49889926 CACCCAGCCGTGCGGGTAGGCGG + Exonic
927508530 2:23629926-23629948 CAGCGAACAGCACCGGGAGGAGG + Intronic
927553676 2:24018367-24018389 CACCTGACCGCACAGGGAGGTGG - Intronic
929548719 2:42875385-42875407 CACAAAGCGGCGCCGGGAGGAGG - Intergenic
929961546 2:46500225-46500247 GACCCAGCGGCGGCGGGAGGAGG - Intronic
945084372 2:206116536-206116558 CAGCCACTCGCGCGGGGAGGCGG + Intronic
947716051 2:232339351-232339373 CACCCAGCAGCGCCGCCAGGAGG + Intronic
1171770490 20:29319372-29319394 CGCCCAACCGCTCCAGGAGCCGG + Intergenic
1171824103 20:29878818-29878840 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1180315880 22:11277209-11277231 CTCCCAACCGCTCCAGGAGCCGG + Intergenic
1180316623 22:11282670-11282692 CTCCCAACCGCTCCAGGAGCTGG + Intergenic
1180338710 22:11600825-11600847 CTCCCAACCGCTCCAGGAGCTGG - Intergenic
1184681342 22:46073819-46073841 CAGCCAGCCGCGGCCGGAGGTGG + Intronic
957084380 3:75666624-75666646 AACCCCACCACGTCGGGAGGTGG - Exonic
957084970 3:75669978-75670000 CTCCCAACCGCTCCAGGAGCCGG + Intergenic
958718866 3:97821503-97821525 CAGCAGAACGCGCCGGGAGGTGG + Intergenic
965404105 3:168249462-168249484 CACCCAGCCGCGGCGGGGGCTGG - Intergenic
968462167 4:731554-731576 CGCCCACCCACGACGGGAGGGGG - Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983577156 4:169271447-169271469 CTCCCAGCCCCGCCGGGGGGAGG - Intergenic
985445968 4:190021588-190021610 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
985573314 5:662258-662280 CACCCGACCTCGCAGGGAGCAGG - Exonic
985574309 5:666446-666468 CGCCCAGCTGCGCCGGGAGCTGG + Intronic
997304027 5:132825552-132825574 CAGCCACCCGGGCGGGGAGGGGG - Exonic
1002429597 5:179195294-179195316 CTCCCAACAGCCCCGGGAGTTGG + Intronic
1002638451 5:180619420-180619442 CTCCCAAAAGCGCCGGGTGGCGG - Intronic
1017672510 6:156779616-156779638 GCCCCGACCGCGGCGGGAGGCGG - Intronic
1022020873 7:26398540-26398562 CGCCGAGCCGGGCCGGGAGGGGG - Intergenic
1025778971 7:64582623-64582645 CAGCCAACGGCGCGGGGAGGCGG - Intergenic
1027177631 7:75914951-75914973 GACCCAGCCGAGCCGCGAGGGGG + Intronic
1028622240 7:92836788-92836810 CCCCCAGCCCCGCCGGGGGGTGG - Intergenic
1033615733 7:143012508-143012530 CAGCCAACTGGGCCTGGAGGGGG - Intergenic
1037811366 8:22089110-22089132 CACGCAGCCGGGCCGGGAAGGGG + Intergenic
1039868858 8:41528972-41528994 TACCCAAGAGCGTCGGGAGGGGG - Intergenic
1050377190 9:4985328-4985350 CACCCAAGCGAGCCGGGCGCCGG - Exonic
1053489452 9:38488059-38488081 CACCCAGGCGCGCCGTCAGGCGG + Intergenic
1054337267 9:63817927-63817949 CTCCCAACCGCTCCAGGAGCCGG - Intergenic
1057631085 9:96719744-96719766 CACCCCACCGCGCAGGAAGAAGG - Intergenic
1058439203 9:104991735-104991757 CTCCCAGCCGCGGCGGGCGGCGG + Intergenic
1059395945 9:114034236-114034258 CACCCAACCTCTCCAAGAGGTGG + Intronic
1060671960 9:125477776-125477798 CACCCAAACGGGCTGGTAGGGGG - Intronic
1061809776 9:133155465-133155487 CTCCCAACCCTGCTGGGAGGTGG - Intronic
1062122780 9:134842564-134842586 CACCCACGCGCCCCGGGAGCGGG + Exonic
1203364930 Un_KI270442v1:248622-248644 CTCCCAACCGCTCCAGGAGCTGG + Intergenic
1190064615 X:47231398-47231420 CACCCAACTGCTCTGGGAAGTGG + Intergenic
1198100293 X:133416245-133416267 CCCCCAACCGCGAGGTGAGGGGG + Intergenic