ID: 906472123

View in Genome Browser
Species Human (GRCh38)
Location 1:46139924-46139946
Sequence GTTCTTGTTTGCAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906472123_906472130 30 Left 906472123 1:46139924-46139946 CCCAGGACCCTGCAAACAAGAAC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 906472130 1:46139977-46139999 CCCCATCTGAAATTTTTTTGAGG 0: 1
1: 0
2: 3
3: 15
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906472123 Original CRISPR GTTCTTGTTTGCAGGGTCCT GGG (reversed) Intronic