ID: 906472532

View in Genome Browser
Species Human (GRCh38)
Location 1:46143141-46143163
Sequence GAGAAAAATACTACCAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906472532_906472536 22 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472536 1:46143186-46143208 TTCATTTCCAGGACCTCACTGGG 0: 1
1: 0
2: 1
3: 18
4: 172
906472532_906472534 11 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472534 1:46143175-46143197 CGTGTGATTCATTCATTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 114
906472532_906472535 21 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472535 1:46143185-46143207 ATTCATTTCCAGGACCTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906472532 Original CRISPR GAGAAAAATACTACCAATGA AGG (reversed) Intronic