ID: 906472532

View in Genome Browser
Species Human (GRCh38)
Location 1:46143141-46143163
Sequence GAGAAAAATACTACCAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906472532_906472535 21 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472535 1:46143185-46143207 ATTCATTTCCAGGACCTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 193
906472532_906472536 22 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472536 1:46143186-46143208 TTCATTTCCAGGACCTCACTGGG 0: 1
1: 0
2: 1
3: 18
4: 172
906472532_906472534 11 Left 906472532 1:46143141-46143163 CCTTCATTGGTAGTATTTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 294
Right 906472534 1:46143175-46143197 CGTGTGATTCATTCATTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906472532 Original CRISPR GAGAAAAATACTACCAATGA AGG (reversed) Intronic
904950291 1:34232582-34232604 GAAAAAAATGCTACAAATCAGGG - Intergenic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
910265711 1:85334893-85334915 AAGAAAAAAACTGCCAATTAAGG + Intronic
910307288 1:85779793-85779815 GGGAAAAAAAATACCAGTGAGGG - Intronic
910784980 1:90987158-90987180 GAGAAAAATAATACATATTAGGG + Intronic
911177882 1:94835062-94835084 GAGAGAAATTCTACAAATTAAGG + Intronic
911211956 1:95150386-95150408 GAAAAAAATACCTCCCATGATGG + Intronic
911488470 1:98531991-98532013 TAGAAAAATTCTACCTATTATGG - Intergenic
912014189 1:105012084-105012106 TATAAAAATAATAACAATGAGGG - Intergenic
912436991 1:109668759-109668781 GAGAAAAAGAATTCCAGTGAGGG - Intronic
912780153 1:112538900-112538922 GAGAATAATACTACCTCTCATGG - Intronic
913364679 1:118024214-118024236 GAAAAAAATAGTAAGAATGAAGG - Intronic
917710343 1:177678099-177678121 GAGGAAAATTCTTCCAAGGATGG - Intergenic
918821617 1:189263338-189263360 GAGAAAAATAAAACCCATAAGGG - Intergenic
918962306 1:191296936-191296958 CAGAAAAATGCTACCACTGCTGG - Intergenic
918971976 1:191431959-191431981 GAGGAAAATACTATATATGATGG - Intergenic
919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG + Intronic
919862235 1:201747778-201747800 GGGAAAAACAGTACCAATTATGG - Intronic
920602600 1:207344509-207344531 AAGAAAAAGACTACCAACCAAGG - Intronic
920907686 1:210187304-210187326 CAGAAAAATACTATCAAAGTAGG - Intergenic
921670351 1:217917818-217917840 GAGAAAAATAATAAAAATAAAGG + Intergenic
922649352 1:227323740-227323762 GCCAAAAATACTATCTATGATGG + Intergenic
923175780 1:231463509-231463531 TATAAAAATATTCCCAATGAAGG + Intergenic
923199763 1:231699979-231700001 GAGAAAAATATTCCCACAGAGGG - Intronic
924187920 1:241515836-241515858 AAGAAAAATGCTACCAATTAAGG - Intronic
1063357925 10:5419130-5419152 GAAAAAAATGTTACCAAAGAGGG - Intronic
1064593141 10:16915361-16915383 GAAAAAAATGCAACCAATTAGGG + Intronic
1065032426 10:21601365-21601387 GAGAAAAGAAATAACAATGAGGG - Intronic
1066360263 10:34723373-34723395 GAGAAAAAGGCCACCAATGATGG + Intronic
1066691756 10:38035618-38035640 GTAAAAAATAGTATCAATGAAGG - Intronic
1067000949 10:42613041-42613063 GCAAAAAATAGTATCAATGAAGG + Intronic
1067680532 10:48434787-48434809 GAGAAAAAAATTACCACTGGAGG + Intronic
1068289422 10:54983694-54983716 GGGAAAAGTACTATTAATGATGG + Intronic
1068559367 10:58496210-58496232 GAGAAAATTTCTACCAAGTAGGG + Intergenic
1068615694 10:59113430-59113452 CAGAAAAATACTACCTACAATGG - Intergenic
1068888906 10:62127856-62127878 AAGAAAAATGTTAGCAATGAAGG - Intergenic
1069207231 10:65706063-65706085 GATAAAGATACTAACAATGGGGG + Intergenic
1070023613 10:72610402-72610424 GAGACAAAAACTGCCAAGGATGG + Intronic
1071285176 10:84137966-84137988 GAAAAAAAGACTATCACTGAAGG + Intergenic
1071292799 10:84199815-84199837 GAGAAAAATCCTCCCATTGCAGG - Intronic
1072378649 10:94842590-94842612 GAGAAAATTATTATCAATAAAGG - Intronic
1072552583 10:96490377-96490399 GAGAAAAAGAGTACCAAAGGAGG + Intronic
1072853087 10:98917664-98917686 GAGAAAAATAATAATAATAAGGG - Intronic
1073951819 10:108818173-108818195 GAGTAAAATAATAGCAAAGAAGG - Intergenic
1076408939 10:130232261-130232283 GAGAAATGTATTACAAATGACGG - Intergenic
1079593911 11:22217579-22217601 GAGAAAAATAATAATAATAAAGG - Intronic
1079618139 11:22520304-22520326 AAGTAAAATAGTAACAATGAGGG - Intergenic
1080111338 11:28571363-28571385 TAGAAAAATAATAATAATGAAGG + Intergenic
1080133600 11:28826518-28826540 AAGAAAAAAACTACCAAATAAGG - Intergenic
1080323723 11:31045445-31045467 GAGAAACAGACTTCCAATGTAGG + Intronic
1081642407 11:44765176-44765198 GAGAAAATGAGGACCAATGAGGG - Intronic
1083238218 11:61366011-61366033 AAAAAAAGTACAACCAATGAAGG - Intronic
1083492312 11:63022077-63022099 GATAAAAGGACTACCGATGATGG - Intergenic
1083557435 11:63642021-63642043 GGGAAAAGTACAACCAATAATGG + Intronic
1083574810 11:63782586-63782608 GAAAAAAATTTGACCAATGATGG - Intergenic
1083857693 11:65401259-65401281 GAGTAAAACACGACGAATGAAGG - Intronic
1085113468 11:73909369-73909391 GAGAAAAAAACTCCCTAAGATGG - Intronic
1085899626 11:80683491-80683513 CAGAAAAAGACTACTAATAATGG - Intergenic
1086110741 11:83195162-83195184 AAGAAAAAGAGAACCAATGATGG - Intronic
1086281215 11:85191747-85191769 CAGAAATATACTACCATTGATGG + Intronic
1086811178 11:91312096-91312118 GAGAAAGATTCTTCCAATTAGGG + Intergenic
1087109725 11:94451345-94451367 AAGAAAAATACTCCCAAAAAAGG + Intronic
1087517832 11:99187213-99187235 GAGAAAATTACAATCAAAGATGG + Intronic
1088939862 11:114442344-114442366 AAAAAAAATACTAACAATGATGG - Intronic
1089081555 11:115780490-115780512 GACAAAAATACTACCTTTGAGGG - Intergenic
1089880245 11:121766468-121766490 GCAAAAAGCACTACCAATGAGGG + Intergenic
1089931077 11:122312909-122312931 GAGAAAAATACTACTAGTCTTGG + Intergenic
1090228629 11:125086222-125086244 GAGGAAAATACTATCACTGGTGG - Exonic
1090672831 11:128961656-128961678 GGGAATAATAGTACCTATGAAGG - Intergenic
1091467969 12:702130-702152 GAGAATAATACTTCCATTGTTGG + Intergenic
1093565904 12:20603303-20603325 GAAAAAAATACTTCCAACAATGG + Intronic
1093892553 12:24540412-24540434 GAGAAAAATACTGTGAATAATGG - Intergenic
1094793408 12:33941071-33941093 GGAAAAGATACTACCAATAAAGG - Intergenic
1095127179 12:38493597-38493619 GAAAAAAAGAATACCAAAGAAGG + Intergenic
1095207112 12:39450802-39450824 AATAAAAATCCTACCAATGCTGG - Intergenic
1095209741 12:39478508-39478530 GAGAAAATTACTACCAACAGAGG - Intergenic
1095414536 12:41962030-41962052 GATAAATATACCATCAATGAGGG - Intergenic
1096785851 12:54016948-54016970 AAAAAAAATACTGCTAATGAAGG - Intronic
1097698214 12:62795195-62795217 GAAAAAAATGCTTCCAATGAGGG - Intronic
1097873954 12:64626019-64626041 GAGAAACATACAACCAAAGGAGG - Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098536252 12:71596783-71596805 GAGAATAATAGTGCAAATGATGG + Intergenic
1099552486 12:84065354-84065376 GTGACAAGTACTGCCAATGACGG - Intergenic
1099575194 12:84370667-84370689 TAGAAAAATACCACAAATAAAGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1099945104 12:89234983-89235005 GAGAAAAATAAAGCAAATGAGGG - Intergenic
1100170051 12:91964581-91964603 CAGAAAAATCATACCAATGATGG - Intergenic
1100180872 12:92084886-92084908 GAGAAAAATTCTACCTCTCATGG + Intronic
1102091958 12:110198130-110198152 GAGTAAAATACAAGCAGTGATGG - Intronic
1105817935 13:24053579-24053601 GAGAAAAATACTCCCACCGTGGG - Intronic
1106809284 13:33343748-33343770 GAATAAATTACTACCAGTGATGG - Intronic
1107724324 13:43282718-43282740 AAGAAAAATAATACCAAGGGTGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108692815 13:52875065-52875087 GGGAACAATAATACAAATGATGG - Intergenic
1109048081 13:57438661-57438683 GTTAAAAATAATACCAAGGAAGG + Intergenic
1109592330 13:64502255-64502277 GAAAAAAACCCTACCAATGAAGG - Intergenic
1109961819 13:69640937-69640959 GTGAAAATTACTGCCAAAGAAGG + Intergenic
1112054684 13:95678640-95678662 GAGATAAATACTACAGATGAGGG - Intronic
1112902292 13:104372638-104372660 GAGAAAAGTACTGCAAATAAAGG + Intergenic
1113048926 13:106187004-106187026 CCGAGAAATACTAGCAATGAAGG + Intergenic
1114395528 14:22356078-22356100 AAGAAAAAAACTCACAATGATGG + Intergenic
1114849480 14:26366519-26366541 GAGAAAAATATTAACAAATAAGG + Intergenic
1115346626 14:32349599-32349621 CATAAAAATAATAACAATGATGG + Intronic
1116053141 14:39829172-39829194 GAGCAAAATAGTACCAAACAAGG - Intergenic
1116373088 14:44160866-44160888 GAAAAAAATACTATTTATGAAGG + Intergenic
1116595668 14:46841305-46841327 GAGAAAAATAATAATAATAAAGG + Exonic
1117975532 14:61292927-61292949 AAGAAAAATACCACCAAGAAGGG + Intronic
1120470132 14:84912633-84912655 GAGAAAAATAATCCAAATTATGG - Intergenic
1122338855 14:101011936-101011958 GAGAAAAATAATAGTCATGAAGG - Intergenic
1124986049 15:34615648-34615670 AGGGAAAATAATACCAATGAAGG + Intergenic
1125455899 15:39858412-39858434 GAAAAAAAAAATACCATTGAAGG + Intronic
1127276260 15:57447483-57447505 GAGAATAACACTAAGAATGATGG - Intronic
1128043476 15:64595911-64595933 GAGAAAAATAAGAGCTATGATGG - Intronic
1132108762 15:99086710-99086732 AAGTAAATTACTAACAATGATGG + Intergenic
1133794992 16:9038832-9038854 AAGAAAAATAATAGCAATAATGG - Intergenic
1133921503 16:10157457-10157479 TATAAAAATACTACCAGAGACGG + Intronic
1134415627 16:14041116-14041138 GAGCAAAACACTGCCAAGGAAGG + Intergenic
1136158490 16:28402057-28402079 TAGAAAAATACTAGCAGTGGAGG - Intronic
1136204597 16:28713226-28713248 TAGAAAAATACTAGCAGTGGAGG + Intronic
1138760605 16:59539271-59539293 GAGAAAAATATTAACTATTAAGG - Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1143231030 17:5355296-5355318 GAGGAAAGTACTCCAAATGAAGG - Intronic
1147059449 17:37863125-37863147 GAGAAAAGAAATAACAATGAGGG + Intergenic
1148408724 17:47445630-47445652 GAGAAAAGAAATAACAATGAGGG + Intergenic
1149332449 17:55599377-55599399 GAAAAAAATAAAACCAAAGAAGG - Intergenic
1151881998 17:76901510-76901532 GAGATAAATACTGCATATGACGG + Intronic
1154004722 18:10517235-10517257 GAGAACAACAGTACAAATGATGG + Intergenic
1154150671 18:11903974-11903996 GAAAAAAATAATTCCACTGAGGG - Intronic
1155102694 18:22628525-22628547 GGGAAAAAAACAACTAATGAAGG + Intergenic
1155422335 18:25668692-25668714 GCGATAAATACCAGCAATGAGGG + Intergenic
1156259818 18:35435681-35435703 GAGAACAATAGTACAAATCATGG - Intergenic
1156897658 18:42264923-42264945 GAGAAAAATATAAACAATGTAGG + Intergenic
1157972826 18:52289948-52289970 GAGAAAAATGATACTATTGAAGG - Intergenic
1158341765 18:56473653-56473675 GAGATCACCACTACCAATGATGG - Intergenic
1162260439 19:9529280-9529302 GAGAAAAACTCTACGAATGGAGG - Exonic
1164862575 19:31574125-31574147 GAGGAAAATACTAAAAATTAAGG + Intergenic
929001827 2:37354339-37354361 GTGAAGAATAATAGCAATGATGG + Intronic
929102494 2:38329626-38329648 GACAAAGATACTACAAATAAAGG + Intronic
929235733 2:39603807-39603829 CATAAAAATAGAACCAATGATGG - Intergenic
929271973 2:39982516-39982538 GAGAAAATTCCTAGCAAAGAGGG + Intergenic
930813928 2:55572313-55572335 GAAAACAATACTACAAATAAAGG + Intronic
931023838 2:58084828-58084850 GAAAAAAATAATCCCAAAGATGG - Intronic
931997795 2:67855796-67855818 GAGAAACATACAGTCAATGATGG - Intergenic
937530203 2:122819112-122819134 GAGAAAAATAATAAAAATGTTGG + Intergenic
937706380 2:124925555-124925577 GAGAAAAATATTGCCCCTGATGG - Intergenic
938551851 2:132390028-132390050 GAGAAAAATGGCACTAATGAGGG - Intergenic
939023392 2:136984659-136984681 GAGAAAATTAGTACCAAGAATGG + Intronic
941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG + Intronic
942038506 2:172034964-172034986 GAAAAAAATTCTAACAATCAGGG - Intronic
942424434 2:175844781-175844803 CAAAAAAATACAACCAATGTTGG - Intergenic
942651447 2:178173135-178173157 AAGAAAAAAACTGCCAATCAAGG - Intergenic
942804363 2:179912287-179912309 GAGAAAAACAACACAAATGAAGG + Intergenic
942841914 2:180372208-180372230 TAGAAAAATACTACCAAATCAGG - Intergenic
943051439 2:182918247-182918269 GACAAAAAAAATAACAATGAGGG - Intronic
943416054 2:187605457-187605479 GAGGGAAAAACTAACAATGAGGG + Intergenic
943454554 2:188088550-188088572 AAGAAAAATACTAGCCATTAAGG + Intergenic
943481297 2:188421505-188421527 GATAAAAGTACTAACAATAAAGG - Intronic
943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG + Intergenic
945690624 2:213030792-213030814 AAGAAAAATAGTACTAATGCTGG - Intronic
946933856 2:224699286-224699308 GTCAAAAACACTACCAATAATGG - Intergenic
947941242 2:234057441-234057463 CAGAAAAATCCTCCCAAGGAAGG - Intronic
1170206942 20:13808602-13808624 GAGAGAACTAGAACCAATGATGG + Intronic
1170218756 20:13919087-13919109 GAGAAAAATTTTACAGATGAAGG - Exonic
1170301397 20:14888109-14888131 GAGAAAAAACCAACCAATAAAGG - Intronic
1170302389 20:14898957-14898979 GAGAAAAATACTAGAAAAAAAGG - Intronic
1171042381 20:21777401-21777423 TAGAAAAAAACTAACAGTGATGG + Intergenic
1171144010 20:22766198-22766220 GAAAAAAATACTAGCATTGGAGG + Intergenic
1171960340 20:31488988-31489010 GTTAAAAATAATACGAATGATGG + Intergenic
1172416622 20:34774154-34774176 GTGAAAAACACTATCAATTAAGG + Intronic
1173693769 20:44988646-44988668 GAGAAAAATTCTGCCAAGGCAGG - Intronic
1173908922 20:46649780-46649802 GAGAAAAACACAATAAATGATGG - Intronic
1173954107 20:47017425-47017447 AAGAAAAATACTATCAAAGCTGG - Intronic
1175398551 20:58685336-58685358 GTAAAAAATGCTACCTATGAAGG + Intronic
1177024540 21:15905839-15905861 CAGAAAGATTCTACTAATGATGG - Intergenic
1177347617 21:19893661-19893683 CAGAAAAATTCTACCTCTGAAGG + Intergenic
1180672388 22:17563320-17563342 GTGAAAAATACTAGCCAAGAAGG + Intergenic
1181122171 22:20678272-20678294 GAGAAAAAGATCATCAATGAAGG + Intergenic
1184962124 22:47938145-47938167 AACAAAAATTCTACAAATGATGG + Intergenic
950145245 3:10645069-10645091 GAAAAAAATACTACGTATGTCGG + Intronic
951500852 3:23385097-23385119 ATGAAAAATACTTCTAATGATGG + Intronic
951980307 3:28558719-28558741 GAGCAACTTTCTACCAATGATGG - Intergenic
955714759 3:61817463-61817485 GAGAAGAAAACAACCAATAATGG + Intronic
955744988 3:62131594-62131616 GATATAAATACTATCAATGGGGG + Intronic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
956662102 3:71609139-71609161 GAAAAAAAGACAACTAATGAAGG - Intergenic
956947585 3:74240756-74240778 GAGAATAATACTAACAGTGAAGG - Intergenic
957203769 3:77168383-77168405 TAGGCAAATACTACCAATGGAGG - Intronic
957951031 3:87126693-87126715 TAGAGGAATAGTACCAATGATGG + Intergenic
957975067 3:87432964-87432986 GAGAAAACAACTTCCAATGATGG - Intergenic
959013122 3:101101614-101101636 GAGATAAATACTAATAATGTCGG - Intergenic
961179171 3:124862726-124862748 GGGAAAACTGCTACCAGTGAAGG - Intronic
962690535 3:137893030-137893052 GAGAAAAATAATACTAAAGTGGG + Intergenic
962760544 3:138509185-138509207 GAGAGAAATACAACAAAGGATGG + Intronic
965798919 3:172471160-172471182 GTGAAAAATTCTTACAATGAAGG + Intergenic
967328218 3:188263749-188263771 AAGAAAAATGCTATCAGTGATGG - Intronic
967640620 3:191858350-191858372 CACAAAAATACTATCCATGAGGG + Intergenic
968025158 3:195435928-195435950 GATATAAATACTTCCAATAATGG - Intronic
971424271 4:26501008-26501030 GAGAAAAAACCCAGCAATGAGGG - Intergenic
971678263 4:29664125-29664147 GATAAAAATAATACCAAAAAAGG + Intergenic
971813463 4:31458464-31458486 GAGAAAAATCCTTCTTATGAAGG - Intergenic
972908603 4:43784850-43784872 GTTAAAGGTACTACCAATGAGGG + Intergenic
973248550 4:48037208-48037230 GAGAAAAATACTTCAGATAAAGG + Exonic
973723122 4:53745139-53745161 GAGAAGAAAACTGCCAAGGAAGG + Intronic
974810186 4:66936023-66936045 AAGAAAAATATTACCTATTAAGG + Intergenic
975893684 4:79060131-79060153 GACAAAAAAACAACAAATGAAGG + Intergenic
979881616 4:125965994-125966016 GAAAAAAATAATACCATGGATGG - Intergenic
980708706 4:136535240-136535262 GAGAAAAATCCTCCCAAACAAGG - Intergenic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
983290367 4:165795902-165795924 GAGAAAAATAATAAATATGAAGG - Intergenic
985206930 4:187549151-187549173 GACAAAAATACCACAAAGGAAGG - Intergenic
987295663 5:16548591-16548613 AAGAAAAGTACAACAAATGAGGG + Intronic
987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG + Intronic
989836393 5:45999128-45999150 GAGATAAATACTTCCTTTGATGG + Intergenic
990925726 5:61020311-61020333 CAGAAAAATAATACCAGTGGGGG - Intronic
991438389 5:66619364-66619386 GAGAAAAATATTCCTAACGAAGG - Intronic
992213163 5:74500754-74500776 TAGGAAAATACCACCAATCACGG + Intergenic
993692618 5:91021346-91021368 GAGAAAAATAATACCACCAAGGG - Intronic
994514732 5:100756569-100756591 GAGCAAAATACTTCAAATGATGG - Intergenic
995161206 5:108985107-108985129 GAGAAACATACTACAAATTCAGG + Intronic
995787315 5:115842931-115842953 TAGAAAAAAACTATAAATGAGGG - Intronic
996041188 5:118813629-118813651 GAGAAACATACAACCAACCAAGG + Intergenic
996304556 5:122032253-122032275 AAAAAAAAAACTACCAAGGATGG - Intronic
996465500 5:123797448-123797470 GAGACTCATGCTACCAATGAAGG + Intergenic
998919076 5:147047925-147047947 GAGAAATATACTACAAGGGAAGG - Intronic
999010770 5:148036727-148036749 AAGAAAAACACTAGCAATGCTGG - Intronic
999794423 5:154975521-154975543 CAGAAAAATACTAGAAAAGAGGG - Intergenic
1000588796 5:163132849-163132871 GAGAAAAATCCTACTAATTTTGG + Intergenic
1002840489 6:901043-901065 GAGATAAATGCTAACAATTAGGG + Intergenic
1004868956 6:19884024-19884046 GAGAAAAAAAATAATAATGAAGG - Intergenic
1008177786 6:48289510-48289532 GAAAAATGTACTAGCAATGAGGG - Intergenic
1008237161 6:49064333-49064355 CAGAAAATTGGTACCAATGATGG - Intergenic
1008303840 6:49876196-49876218 GAAAAAAACACCACCAATAAAGG + Intronic
1008361825 6:50628669-50628691 GAGATAAAGACTACCTTTGATGG + Intergenic
1009562293 6:65262914-65262936 GAAAAATATAATATCAATGACGG - Intronic
1012547002 6:100431490-100431512 CAGAATAATACTACTAATAATGG - Intronic
1012669444 6:102023526-102023548 GAGAAAAATAAAACCATTTATGG - Intronic
1012761483 6:103308694-103308716 TAGAAAAATTATACCATTGAAGG + Intergenic
1014196660 6:118567845-118567867 GGGAAAAACATTACAAATGAAGG + Intronic
1014305752 6:119739538-119739560 GAGAAAAATACTACAGATGCTGG + Intergenic
1014586704 6:123206214-123206236 TAGAAAAATACTACACATCAAGG + Intergenic
1015066726 6:129038979-129039001 GAGAAAAATATGGCAAATGAAGG - Intronic
1015679744 6:135792593-135792615 AAGAAAAATACTGAGAATGATGG - Intergenic
1016046659 6:139487685-139487707 GAGGAAAGTAATACCATTGAGGG + Intergenic
1016490106 6:144591002-144591024 GAGAATAATCCTACCAATAGTGG - Intronic
1017139767 6:151180001-151180023 GAGAGAAATAATACAAAGGAAGG - Intergenic
1017963361 6:159241917-159241939 AAGAAGAATACTAACAATAAAGG - Intronic
1018517771 6:164605622-164605644 GAAAAAAATGCTAACAATGAGGG + Intergenic
1020604934 7:10325287-10325309 GAGAAAAATACCAACAAAGTTGG + Intergenic
1021641633 7:22743396-22743418 GATAAAAAGACTACCAACCATGG - Intergenic
1022923684 7:35039352-35039374 AATAAAAATAATACAAATGATGG + Intergenic
1023726146 7:43144181-43144203 GAGAAAAAAAGTCCCAATGAAGG - Intronic
1024125831 7:46294032-46294054 AATAAAAATGCTACCAATAATGG - Intergenic
1024413106 7:49070313-49070335 GAGACAATTACTACTACTGAGGG - Intergenic
1025726955 7:64073115-64073137 AAAAAAAATGCTACCAATCAAGG - Intronic
1026373897 7:69730749-69730771 GAGAAAAATCCAAGAAATGATGG - Intronic
1027630522 7:80599256-80599278 TAGAAAAATGCTCCTAATGAAGG + Intronic
1027858187 7:83539719-83539741 GATGAAAATAATCCCAATGAAGG - Intronic
1027879734 7:83819267-83819289 GAAAAACATACTAACAATGTTGG - Intergenic
1028006704 7:85580471-85580493 GAGTAAAATCCAACCAATTAAGG - Intergenic
1028918115 7:96282055-96282077 GTGAAAAATATTCCCAAAGAAGG - Intronic
1030798047 7:113814260-113814282 CACAAAAATACTACTAATAAAGG + Intergenic
1031645002 7:124214033-124214055 GAGTAAAATATTACCAAGAAAGG - Intergenic
1031696667 7:124864893-124864915 GACAAAAATACAAGAAATGATGG - Intronic
1032140069 7:129320769-129320791 GAGGAAAATACCACCACTAATGG - Intronic
1034024235 7:147681150-147681172 CAGACAAAAACAACCAATGATGG - Intronic
1034610867 7:152367152-152367174 GAGGAAAATTCTTCCAAGGATGG + Intronic
1035829768 8:2682800-2682822 GAGAAATATACTACTAAGGCCGG + Intergenic
1036018134 8:4809243-4809265 GGAAAAAATACTTCTAATGAAGG + Intronic
1037012792 8:13865374-13865396 GACAAAACTACTACTGATGAAGG - Intergenic
1037083394 8:14815734-14815756 GACTAAAATATTACAAATGAGGG + Intronic
1037320957 8:17642076-17642098 GAGAAAAGTTGTACCAAGGATGG - Intronic
1038096326 8:24315432-24315454 TAGAAAAATACAACCTATAAAGG + Intronic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1040552856 8:48451848-48451870 GATAAAAATACTACACAAGATGG - Intergenic
1042597700 8:70467119-70467141 GAAAAAAATACAGCAAATGAAGG - Intergenic
1042873038 8:73415224-73415246 TGGAAAATTACTACCCATGAAGG + Intergenic
1045169148 8:99644265-99644287 TAGAAAAGAACTGCCAATGATGG + Intronic
1045406871 8:101875376-101875398 GAGAAGAATACTTGCAAGGAGGG - Intronic
1045790675 8:105979713-105979735 GAGAAAAAAAATACATATGAGGG + Intergenic
1045966146 8:108026868-108026890 AAAAAAAATACTAACAATTAAGG + Intronic
1046842404 8:118874205-118874227 GATAAAATGACTACCAAGGAGGG - Intergenic
1047627773 8:126674234-126674256 GAGAAAATTACTAACCAGGAAGG - Intergenic
1048055061 8:130855396-130855418 GAGAAAAATCCTGACAAGGAAGG - Intronic
1050046135 9:1547448-1547470 GAGAAAAATACTTCCCTTCAAGG - Intergenic
1050620200 9:7444204-7444226 GAGAAAAATGTTTTCAATGAAGG + Intergenic
1051333204 9:16044148-16044170 GAGAAATATGCTTCCAATAAGGG + Intronic
1052077744 9:24165030-24165052 TAGAAAAATAGTACCAATAAAGG - Intergenic
1052125823 9:24773516-24773538 GAGAAAAATTGTACCAATTTTGG + Intergenic
1052199360 9:25759063-25759085 GAGAAAAATGCTACCTATATAGG + Intergenic
1052701586 9:31943819-31943841 GAGAAAAATGCTTAAAATGAAGG + Intergenic
1055124331 9:72701793-72701815 AACAAAAATACTATAAATGATGG - Intronic
1056341563 9:85638415-85638437 GAGAAAGATAATCCAAATGAAGG + Intronic
1058131799 9:101262086-101262108 GAGAAAAACTATACCAAGGAAGG + Intronic
1058289825 9:103225644-103225666 GAGATAATTACTACCAAGTAAGG + Intergenic
1058622283 9:106896199-106896221 GAGAAAAACAAAAACAATGAGGG - Intronic
1059908646 9:119018094-119018116 GAGGAATATTCTACCAAAGAAGG - Intergenic
1060382024 9:123184589-123184611 AAGAGTAATACTACCACTGATGG + Intronic
1061351423 9:130068038-130068060 AAGAATAAGACTACCAATCATGG - Intronic
1185995084 X:4937525-4937547 GGTAAAAATACTACACATGAAGG + Intergenic
1186010269 X:5123955-5123977 CAGAACAATAATACCAATAATGG - Intergenic
1186117698 X:6322227-6322249 AAGAAAAAGACGACAAATGAAGG + Intergenic
1186876487 X:13823251-13823273 AAGAGAAACACTAGCAATGACGG - Intronic
1187613620 X:20969626-20969648 GAGAGAAATGTTACCAATGCAGG + Intergenic
1189103159 X:38211721-38211743 GAGAAAAAAAATACCATTGCTGG + Intronic
1189783686 X:44540615-44540637 GAGCAAACTTCTGCCAATGATGG + Intronic
1191924369 X:66293797-66293819 GAGAGAAAAATTACCAATAAAGG - Intergenic
1192286830 X:69747175-69747197 GAGAAAAAAGCTAGTAATGATGG + Intronic
1192385988 X:70670472-70670494 GAGAATAATAGTACCATTGTAGG + Exonic
1193783120 X:85727766-85727788 GAGAAAAAAACTGCCAGTCAAGG - Intergenic
1193825905 X:86226615-86226637 GAGAAAAATACTAGCAAAAAAGG + Intronic
1194046590 X:89013636-89013658 TAGAGAAATACTAGCAAAGAGGG - Intergenic
1195636061 X:107117535-107117557 GAGAACAATGGTACCAATGAAGG + Intronic
1196675025 X:118410755-118410777 TAGAAAAATACTAACAATTGAGG - Intronic
1201360757 Y:13146127-13146149 GACAAAAATATTACCATGGAAGG + Intergenic
1201887973 Y:18907387-18907409 GAGACAAGTATTACCAAGGAAGG + Intergenic