ID: 906472532 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:46143141-46143163 |
Sequence | GAGAAAAATACTACCAATGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 315 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 20, 4: 294} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906472532_906472536 | 22 | Left | 906472532 | 1:46143141-46143163 | CCTTCATTGGTAGTATTTTTCTC | 0: 1 1: 0 2: 0 3: 20 4: 294 |
||
Right | 906472536 | 1:46143186-46143208 | TTCATTTCCAGGACCTCACTGGG | 0: 1 1: 0 2: 1 3: 18 4: 172 |
||||
906472532_906472534 | 11 | Left | 906472532 | 1:46143141-46143163 | CCTTCATTGGTAGTATTTTTCTC | 0: 1 1: 0 2: 0 3: 20 4: 294 |
||
Right | 906472534 | 1:46143175-46143197 | CGTGTGATTCATTCATTTCCAGG | 0: 1 1: 0 2: 0 3: 9 4: 114 |
||||
906472532_906472535 | 21 | Left | 906472532 | 1:46143141-46143163 | CCTTCATTGGTAGTATTTTTCTC | 0: 1 1: 0 2: 0 3: 20 4: 294 |
||
Right | 906472535 | 1:46143185-46143207 | ATTCATTTCCAGGACCTCACTGG | 0: 1 1: 0 2: 0 3: 11 4: 193 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906472532 | Original CRISPR | GAGAAAAATACTACCAATGA AGG (reversed) | Intronic | ||