ID: 906475648

View in Genome Browser
Species Human (GRCh38)
Location 1:46167595-46167617
Sequence GAACCTGGTGAGACTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906475648_906475661 28 Left 906475648 1:46167595-46167617 CCAGCTGTAGTCTCACCAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 906475661 1:46167646-46167668 TATCCCTGAGGCCTGCACCTTGG 0: 1
1: 0
2: 0
3: 23
4: 184
906475648_906475651 -2 Left 906475648 1:46167595-46167617 CCAGCTGTAGTCTCACCAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 906475651 1:46167616-46167638 TCCCCCTACCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 26
4: 338
906475648_906475659 16 Left 906475648 1:46167595-46167617 CCAGCTGTAGTCTCACCAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 906475659 1:46167634-46167656 CTGGGGTCCTCATATCCCTGAGG 0: 1
1: 0
2: 3
3: 19
4: 227
906475648_906475650 -3 Left 906475648 1:46167595-46167617 CCAGCTGTAGTCTCACCAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 906475650 1:46167615-46167637 TTCCCCCTACCTGCTCCTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 298
906475648_906475653 -1 Left 906475648 1:46167595-46167617 CCAGCTGTAGTCTCACCAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 906475653 1:46167617-46167639 CCCCCTACCTGCTCCTTCTGGGG 0: 1
1: 0
2: 4
3: 40
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906475648 Original CRISPR GAACCTGGTGAGACTACAGC TGG (reversed) Intronic
903280835 1:22248998-22249020 GAAGCTGGTGAGACTGGACCTGG + Intergenic
903835766 1:26202401-26202423 GAAGCTGGTGAGACTGGAGGAGG + Intronic
904348463 1:29889520-29889542 AAACCAGGTGAGACTTCAGAAGG - Intergenic
905964959 1:42084774-42084796 GAACCTGGTAAGACTCCTGGAGG + Intergenic
906475648 1:46167595-46167617 GAACCTGGTGAGACTACAGCTGG - Intronic
907616419 1:55931272-55931294 GAACCTGATGGGAATTCAGCAGG + Intergenic
909734292 1:78936795-78936817 GAAAATGGTGATAATACAGCAGG - Intronic
910515469 1:88054932-88054954 CAACCTAGTGAGACACCAGCTGG - Intergenic
915000040 1:152580453-152580475 GCACCTGGTGAGTGTCCAGCAGG - Exonic
918111722 1:181460541-181460563 GAACATAGAGAGACTTCAGCTGG + Intronic
918270248 1:182891439-182891461 CAACCTAGTGAGACGCCAGCTGG + Intergenic
920379272 1:205526455-205526477 GTACCTGGTGAGAGTCCGGCTGG + Exonic
922040584 1:221892399-221892421 GAACCTTGTTAGACTTCAGCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922358189 1:224796172-224796194 AAACCTAGTGAGACACCAGCTGG - Intergenic
922377073 1:224979633-224979655 CAACCTAGTGAGACATCAGCTGG + Intronic
924941732 1:248816824-248816846 CAACCAGGTGGAACTACAGCTGG - Exonic
1064705344 10:18067086-18067108 GAACCTGGTGAAACTCCTGGAGG + Intergenic
1067204391 10:44200694-44200716 GACCCAGGTGAGACCTCAGCAGG + Intergenic
1073342004 10:102752266-102752288 GGACCTGGTAAGGCCACAGCAGG - Intronic
1073533946 10:104257585-104257607 GAACCTTGGGAGACTGCAGTGGG - Intronic
1073539683 10:104307988-104308010 GAGCCAAGTGAGACTAGAGCTGG - Intergenic
1077046783 11:550230-550252 CAACCTGGTGTGCCTACAGCCGG + Exonic
1077528597 11:3083984-3084006 GACCCTGGAGAGAAAACAGCAGG - Intergenic
1078929358 11:15901403-15901425 GAACCTGGACAGGCTGCAGCTGG + Intergenic
1079284950 11:19120224-19120246 GGACTTGGAGAGACTGCAGCAGG + Intronic
1080280325 11:30549720-30549742 GAACCTCCAGAGACTAGAGCTGG - Intronic
1081049106 11:38315506-38315528 CAACCTAGTGAGACACCAGCTGG + Intergenic
1082839180 11:57674890-57674912 GATCCTTGAGAGACTCCAGCAGG - Intronic
1083779367 11:64910047-64910069 GTACCTGCTGAGCCTCCAGCCGG - Exonic
1084399810 11:68936979-68937001 GCACCTGGAGAGACTGCAGAGGG + Exonic
1089780323 11:120869238-120869260 GAACCCGAGGAGACTGCAGCGGG + Intronic
1089921650 11:122214698-122214720 AAACCTTGGGAGACCACAGCCGG + Intergenic
1093420097 12:18965084-18965106 TAACCTAGTGAGACAGCAGCTGG - Intergenic
1095669990 12:44847783-44847805 GAACTTTGGGAGACTGCAGCAGG + Intronic
1100685420 12:96982313-96982335 AAACCTGGTGGGACCAGAGCTGG - Intergenic
1100918480 12:99455281-99455303 GAACCTGCTGAGAGTAAAGGGGG + Intronic
1102813403 12:115843224-115843246 GCACCTGGTGAGTCCACAGAGGG + Intergenic
1104804539 12:131576857-131576879 GCACCTGGTCTGACTACACCGGG - Intergenic
1104804565 12:131577024-131577046 GCACCTGGTCTGACTACACCGGG - Intergenic
1104804582 12:131577126-131577148 GCACCTGGTCTGACTACACCGGG - Intergenic
1104804605 12:131577262-131577284 GCACCTGGTCTGACTACACCGGG - Intergenic
1104804621 12:131577364-131577386 GCACCTGGTCTGACTACACCGGG - Intergenic
1105448603 13:20478721-20478743 GAACATGGGGAGGCCACAGCGGG - Intronic
1105449189 13:20483785-20483807 GAACATGGGGAGGCCACAGCGGG - Intronic
1109521175 13:63512173-63512195 GCTCCTTGTGAGGCTACAGCTGG - Intergenic
1112809064 13:103196722-103196744 GAAGCTGGAGAGCCTGCAGCAGG - Intergenic
1113558546 13:111258067-111258089 CAACCTAGTGAGACCTCAGCCGG + Intronic
1115641068 14:35335938-35335960 GAACCTGCTCAGCATACAGCAGG + Intergenic
1117208530 14:53470522-53470544 CAACCTAGTGAGACACCAGCTGG - Intergenic
1117504503 14:56388805-56388827 CAACCTAGTGAGACACCAGCTGG - Intergenic
1119096888 14:71840915-71840937 CCAGCTGGTGAGACAACAGCTGG - Intergenic
1125816998 15:42594177-42594199 GAACCTGGAGAGGCTTCAGAGGG + Intronic
1126045226 15:44633726-44633748 TAATGTGGTGAGACTACAGGAGG + Intronic
1126572248 15:50164601-50164623 TGACCTGGTGAGACACCAGCTGG - Intronic
1130371455 15:83288385-83288407 GAACATCATGATACTACAGCAGG + Intergenic
1131532014 15:93201833-93201855 GAACCTGGGGAGGCTAAGGCAGG - Intergenic
1135771702 16:25222788-25222810 GGACATGGAGAGACCACAGCAGG - Intronic
1136451654 16:30357271-30357293 GGTCCTGGTGAGACAAAAGCAGG + Exonic
1142332938 16:89467183-89467205 GAACCTGGGGAGGCCACAGCAGG + Intronic
1144733751 17:17543324-17543346 GAGCCTGTTGAGACTTCTGCAGG - Intronic
1146615077 17:34350135-34350157 CAACCTAGTGAGACATCAGCTGG + Intergenic
1146632906 17:34483623-34483645 GAAGTGGGTGAGACGACAGCAGG - Intergenic
1148622228 17:49043424-49043446 GGATCAGGTGAGACTGCAGCTGG - Exonic
1149467527 17:56891634-56891656 GACCCTAGTGAAAATACAGCAGG - Exonic
1152358342 17:79817402-79817424 GAGCCTGGAGAGACTGCAGGTGG + Intergenic
1152523302 17:80872954-80872976 GAGCCTGGTCAGCCTAGAGCGGG + Intronic
1161114863 19:2491067-2491089 GAACCAGAAGAGACTCCAGCAGG - Intergenic
1163845404 19:19635628-19635650 GACCCTGGTGAGGCTGAAGCAGG - Exonic
1166854817 19:45778261-45778283 GAGCCTGGTGGGACCACAGAAGG - Intronic
925462420 2:4074934-4074956 GGACCTGGTGCAACTACAACCGG + Intergenic
926518796 2:13883716-13883738 TGACCTGGTGAGACACCAGCTGG + Intergenic
928057410 2:28071875-28071897 TAACCTGAAGAGGCTACAGCTGG - Intronic
928864064 2:35896036-35896058 CAACCTAGTGAGACACCAGCTGG - Intergenic
931993887 2:67821619-67821641 GAAGCCAGTGTGACTACAGCAGG + Intergenic
936171879 2:110184104-110184126 GAATCTGGTGTGATTAAAGCTGG + Intronic
938108443 2:128548910-128548932 GAGCCTGGTCAGAGGACAGCAGG - Intergenic
941871324 2:170388948-170388970 TAACCTGGGGAGACAAAAGCAGG - Intronic
942001553 2:171652961-171652983 TGACCTGGTGAGACACCAGCTGG - Intergenic
944513105 2:200483948-200483970 AAACCTGCTGGGACTCCAGCTGG + Intergenic
947582568 2:231330657-231330679 CAGCCTGGTGAGGGTACAGCTGG + Intronic
1168748250 20:263456-263478 CAACCTAGTGAGACACCAGCTGG + Intergenic
1170062697 20:12276159-12276181 CAACCCAGTGAGACAACAGCTGG + Intergenic
1173511222 20:43630238-43630260 GAAGCTGGTCAGACTGCAACTGG - Intronic
1174147651 20:48463356-48463378 GAACCTGGAAAGACCACCGCTGG - Intergenic
1175328192 20:58144211-58144233 GAATCTGGGGGGACTTCAGCAGG - Intergenic
1176044842 20:63087191-63087213 GAACCTGGTGCAGCCACAGCTGG - Intergenic
1177771236 21:25518859-25518881 CAACCTTGTGAGACACCAGCCGG + Intergenic
1180948137 22:19708044-19708066 GAACCTGGGGAGACCCAAGCGGG - Intergenic
1183734326 22:39635593-39635615 GTACCTGGGTAGACCACAGCAGG + Intronic
1184878706 22:47291667-47291689 GAACCCGGGGTGACTTCAGCAGG + Intergenic
955078648 3:55637389-55637411 GAACCTGATGAGTCCTCAGCAGG - Intronic
956373526 3:68589594-68589616 GAGCCTGGTATGACCACAGCTGG - Intergenic
959913799 3:111794009-111794031 CAACCTAGTGAGACACCAGCTGG - Intronic
962637670 3:137347359-137347381 ACACCTGGTAAGAGTACAGCTGG - Intergenic
966451891 3:180072875-180072897 GAACCTGGTGAAGCTCCAGGAGG - Intergenic
967984083 3:195082513-195082535 GAACCTCGTGGGAGTACAGCAGG + Intronic
968557595 4:1254997-1255019 GAACAGTGTGAGACTTCAGCTGG + Intergenic
971362701 4:25952048-25952070 GAACCTGGAGAGCCATCAGCAGG + Intergenic
979078731 4:116307427-116307449 GAACCTGGTGAGATTTCCGAAGG - Intergenic
981836762 4:149064245-149064267 CAACCTAGTGGGACTCCAGCTGG + Intergenic
982918806 4:161249181-161249203 GCTCCTTGTGAGGCTACAGCTGG + Intergenic
985705292 5:1396972-1396994 GACCCTTGTGAGCCCACAGCAGG - Intronic
990729978 5:58797603-58797625 GGACCTTGTGAGCCTATAGCAGG + Intronic
991137092 5:63194419-63194441 GAACCTGCTGTGGCTAAAGCAGG - Intergenic
997831380 5:137153605-137153627 GCACCTTGTGAGACTAAAGAGGG + Intronic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
1001795742 5:174501152-174501174 GGCCCTGGTAAGACTTCAGCAGG - Intergenic
1002187864 5:177462975-177462997 GAACCAACTGAGATTACAGCAGG - Intronic
1005562644 6:27056413-27056435 GAAGGTGGTGAGACTGCAGAAGG - Intergenic
1006515341 6:34542306-34542328 GAAGCTGGAGAGGCGACAGCAGG + Intronic
1009847415 6:69151106-69151128 CAACCTGGTGAGACACCAGCTGG - Intronic
1013296745 6:108764516-108764538 GACCCTGGTCAGACCTCAGCAGG - Intergenic
1015392869 6:132702514-132702536 TAACCTAGTGAGACACCAGCTGG + Intronic
1016558965 6:145373031-145373053 AACCCTGGTGAGATCACAGCTGG + Intergenic
1016789779 6:148055996-148056018 GATCCTGGTGAGACTCCTGTGGG + Intergenic
1019742088 7:2680082-2680104 GAAGCTGGGGAGTCTATAGCCGG + Intronic
1020000292 7:4751775-4751797 GATCCTGGTGTCACTCCAGCCGG - Intronic
1021923021 7:25505992-25506014 CAACCTAGTGAGACACCAGCTGG + Intergenic
1024500922 7:50104832-50104854 GAAGCTAGTGAGAATGCAGCTGG - Intronic
1024771292 7:52726274-52726296 GATCCTGGGGAGGCTGCAGCGGG + Intergenic
1024972641 7:55084882-55084904 GAACCTGGACAGAAGACAGCAGG - Intronic
1027537912 7:79429549-79429571 GCATTTGGTGAGGCTACAGCAGG - Intronic
1029361261 7:100090002-100090024 GAAGCTGGTGAAAATACACCAGG + Intronic
1031546351 7:123054715-123054737 CAACCTAGTGAGACATCAGCTGG - Intergenic
1034847876 7:154463957-154463979 CAACCTAGTGAGACAGCAGCTGG - Intronic
1035056916 7:156041790-156041812 GAAGCTGGGGAAACAACAGCTGG + Intergenic
1039456235 8:37709083-37709105 GAAGCTGCCGAGACAACAGCTGG - Intergenic
1041755474 8:61308775-61308797 GATCCTTGTGGGACTACGGCAGG - Intronic
1044725946 8:95194401-95194423 GAACCTGGAGAGCCTGAAGCAGG + Intergenic
1045160120 8:99530937-99530959 TAACTTGGTTAAACTACAGCTGG - Intronic
1046335450 8:112780962-112780984 CAACCTAGTGAGACACCAGCTGG + Intronic
1047430278 8:124785133-124785155 GAACATGTTGAGATTAGAGCAGG - Intergenic
1050416248 9:5420460-5420482 GAACATGGGGAGACTACGGCAGG + Intronic
1050600929 9:7249706-7249728 GCACCTTGGGAGACCACAGCAGG - Intergenic
1051039186 9:12785360-12785382 GGACCTAGTGAGACATCAGCTGG - Intronic
1055692389 9:78846428-78846450 CAACCTGCTGAGACACCAGCTGG - Intergenic
1062469347 9:136695764-136695786 CTGCCTGGTGAGACCACAGCTGG + Intergenic
1062693394 9:137857418-137857440 GAATCTGGTGAGACTCCAGGAGG + Intronic
1188743037 X:33809548-33809570 TAACCTACTGAGACTCCAGCTGG - Intergenic
1190127750 X:47721774-47721796 GAACCTGGGGAGACTAGCGGAGG + Intergenic
1191209129 X:57866570-57866592 CAACCTGGTAAGACTAAAGTAGG + Intergenic
1192069564 X:67922845-67922867 CAACCTAGTGAGACACCAGCTGG + Intergenic
1193297193 X:79847020-79847042 TAACCTACTGAGACAACAGCTGG - Intergenic
1193658298 X:84224955-84224977 GGACCTAGTGAGACACCAGCTGG - Intergenic
1196493520 X:116296143-116296165 GAACATAGAGAGATTACAGCAGG - Intergenic
1196520195 X:116663209-116663231 CTACCTGGTGAAACTCCAGCTGG - Intergenic
1197655627 X:129113199-129113221 GGTCCTGATGAGACTACTGCGGG - Intergenic
1199164004 X:144648406-144648428 CAACATGCTGAGACTCCAGCTGG - Intergenic
1199297992 X:146180920-146180942 CAACCGGGTGTGACTAGAGCAGG - Intergenic
1199303869 X:146244679-146244701 CAACCTAGTGAGACATCAGCTGG + Intergenic
1199508503 X:148593106-148593128 AAACTTGGTGAGACTGTAGCTGG + Intronic
1202023277 Y:20491320-20491342 CAACCTGCTGAGACACCAGCTGG + Intergenic