ID: 906480583

View in Genome Browser
Species Human (GRCh38)
Location 1:46196940-46196962
Sequence TAGGCTAAGGATGGGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906480583_906480596 6 Left 906480583 1:46196940-46196962 CCCCCTACCCCATCCTTAGCCTA 0: 1
1: 0
2: 5
3: 18
4: 279
Right 906480596 1:46196969-46196991 CCATAGTCTTGCTCTGGCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 335
906480583_906480597 7 Left 906480583 1:46196940-46196962 CCCCCTACCCCATCCTTAGCCTA 0: 1
1: 0
2: 5
3: 18
4: 279
Right 906480597 1:46196970-46196992 CATAGTCTTGCTCTGGCTCTGGG 0: 1
1: 0
2: 7
3: 236
4: 2469
906480583_906480592 0 Left 906480583 1:46196940-46196962 CCCCCTACCCCATCCTTAGCCTA 0: 1
1: 0
2: 5
3: 18
4: 279
Right 906480592 1:46196963-46196985 GCCCTACCATAGTCTTGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 54
906480583_906480599 29 Left 906480583 1:46196940-46196962 CCCCCTACCCCATCCTTAGCCTA 0: 1
1: 0
2: 5
3: 18
4: 279
Right 906480599 1:46196992-46197014 GTCTTCATTGGCTTCACTGATGG 0: 1
1: 0
2: 1
3: 16
4: 160
906480583_906480598 17 Left 906480583 1:46196940-46196962 CCCCCTACCCCATCCTTAGCCTA 0: 1
1: 0
2: 5
3: 18
4: 279
Right 906480598 1:46196980-46197002 CTCTGGCTCTGGGTCTTCATTGG 0: 1
1: 0
2: 1
3: 25
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906480583 Original CRISPR TAGGCTAAGGATGGGGTAGG GGG (reversed) Intronic
900366602 1:2314341-2314363 GGGGCGCAGGATGGGGTAGGGGG - Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
903403489 1:23076605-23076627 TAGGGTAGGGAGGTGGTAGGGGG - Intronic
903607353 1:24584660-24584682 TGGGCTAGGCATGGGGTGGGCGG + Intronic
903872041 1:26442907-26442929 TAGGATAAGGCTGGGGGTGGTGG - Intronic
903951835 1:27000173-27000195 TTGGCTGGGGATGGGGTAGGGGG - Exonic
904335288 1:29793365-29793387 TGGGCTCAGGATGGGCTATGAGG - Intergenic
904599600 1:31666122-31666144 GAGGTGAAGGATGAGGTAGGGGG + Intronic
904875354 1:33650550-33650572 TGGGCTTAGGATGGGGTGGGGGG + Intronic
905921653 1:41723334-41723356 TGGGATAAGGATGGGGATGGTGG - Intronic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
907126316 1:52054365-52054387 TAGGTAATGGATGGAGTAGGGGG + Intronic
908050448 1:60224090-60224112 CAAGGTAAGCATGGGGTAGGAGG + Intergenic
908282503 1:62555840-62555862 TAGGGTAAGTATTTGGTAGGCGG + Exonic
909662994 1:78104616-78104638 AAGGGTAAAAATGGGGTAGGAGG + Intronic
910883913 1:91946507-91946529 TAGGCTAAAGATGGGAAAGAAGG - Intergenic
912078518 1:105909051-105909073 TAGGCACAGGATGGGGGACGGGG - Intergenic
912723916 1:112042569-112042591 TAGTCCAAGGATGGGGCAGTGGG - Intergenic
912956550 1:114157615-114157637 TAAGCAGAGGATGGGGGAGGTGG - Intergenic
915601170 1:156924135-156924157 GAGGCTGAGGATGGACTAGGCGG - Intronic
915608589 1:156971813-156971835 TACGCTAGGGATGGGTGAGGAGG + Exonic
918383488 1:183982231-183982253 TAGGACCAAGATGGGGTAGGAGG + Intronic
919768519 1:201142411-201142433 TGGTCTAACTATGGGGTAGGTGG - Intronic
920905423 1:210160421-210160443 GAGGTCAAGGATGGGGTGGGAGG + Intronic
921051136 1:211512719-211512741 TGGGCTGAGTAAGGGGTAGGGGG + Intergenic
922932717 1:229403019-229403041 TAGGCTGGGGATGGGGAGGGTGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923695633 1:236247703-236247725 GATGCTAGGGATGGGGCAGGAGG - Intronic
924536823 1:244942292-244942314 TGGTCTAAGGATGGTGTTGGAGG + Intergenic
1062771810 10:107158-107180 TAGTCAAAGGATGAGATAGGAGG - Intergenic
1062902185 10:1154782-1154804 CAAGGGAAGGATGGGGTAGGTGG - Intergenic
1066374575 10:34846085-34846107 TAGTCTCAGGATGGGGGTGGGGG - Intergenic
1069820225 10:71222958-71222980 TGGGATAGGGATGGGGGAGGGGG - Intronic
1070656054 10:78272256-78272278 CAGGGTAAGGATGAGGTAAGTGG + Intergenic
1071531397 10:86392453-86392475 GAGGCTAGAGGTGGGGTAGGTGG + Intergenic
1072936466 10:99718138-99718160 TTGGCTGGGGTTGGGGTAGGGGG + Intronic
1073075693 10:100824823-100824845 TAGTCTGAGGCTGGGGTGGGGGG + Intronic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073387986 10:103143537-103143559 GAGGCTGAGGCTGAGGTAGGAGG - Intronic
1073492389 10:103861830-103861852 AAGACTTAGGATGGGGTGGGTGG + Intergenic
1074090499 10:110248948-110248970 TAGACTTAGGATAGGGGAGGTGG + Intronic
1074223897 10:111464409-111464431 GAGTCTGAGGTTGGGGTAGGGGG + Intergenic
1074458429 10:113615137-113615159 TAGGCAGGGGATGGGGTTGGGGG + Intronic
1074467391 10:113695615-113695637 TAGTCACAGGATGAGGTAGGAGG + Intronic
1075732577 10:124645138-124645160 TCGGCATAGGATGGGGTAGCCGG + Intronic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1076656563 10:132027828-132027850 TAGGCTGAGGATGGGGTAAGAGG + Intergenic
1079235038 11:18682127-18682149 TAGTCACAGGATGGGATAGGAGG + Intergenic
1080588245 11:33700203-33700225 CAGGCTAAGGCTGGGCTCGGTGG + Intronic
1081523109 11:43902096-43902118 GAGGCTAAGGAAGAGGAAGGAGG + Intronic
1081998220 11:47377990-47378012 TGGGCTGAGGATGGTGAAGGCGG - Intronic
1083768078 11:64851696-64851718 CAGTCTAAGGGTGGGGTTGGGGG + Exonic
1085768916 11:79307940-79307962 GAAGCCCAGGATGGGGTAGGAGG - Intronic
1087575695 11:99986265-99986287 TAGGCTGAGGTTGAGGTAAGAGG - Intronic
1088357153 11:108956269-108956291 AAGTCTAAGGTTGGGGTTGGGGG + Intergenic
1090206476 11:124887144-124887166 GGGGCTAAGGATGGGGATGGGGG + Exonic
1091849278 12:3682195-3682217 TAGTCTGAGGGTGGGGAAGGAGG - Intronic
1091885647 12:4015340-4015362 TAGGCGAAGGTGGGGGTCGGGGG + Intergenic
1092213932 12:6667369-6667391 GAGGGTAAGGATAGGGTAAGTGG + Exonic
1092284318 12:7120113-7120135 TTGGGAAAGGGTGGGGTAGGGGG + Intergenic
1095987124 12:48005879-48005901 TAGGCTAGGGATGGGGTCCCAGG - Intergenic
1096316421 12:50571110-50571132 TTGGGGAAGGATGGGGTAGTAGG + Intronic
1096466941 12:51851810-51851832 TGGGGGAAGGATGGGGTGGGGGG + Intergenic
1096476243 12:51910939-51910961 ATGGCTAGGGGTGGGGTAGGGGG - Intronic
1096481432 12:51943810-51943832 TGGGGAATGGATGGGGTAGGGGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097144873 12:56933261-56933283 TGGGATCAGGATGGGGGAGGGGG - Intronic
1098377823 12:69836306-69836328 TAGGCACAGGATGGGGGACGTGG + Intronic
1102642183 12:114376884-114376906 TATGCTGGGGATGGGTTAGGTGG + Intronic
1102982205 12:117250774-117250796 TGGGCTAAGGCTGAGGCAGGTGG - Intronic
1104373590 12:128245127-128245149 TTGACCAAGGATGGAGTAGGTGG + Intergenic
1104685999 12:130784530-130784552 AAGGCTAAGGTTGGGGGAGTGGG + Intergenic
1106176269 13:27334921-27334943 TAAGCTGAAGGTGGGGTAGGAGG + Intergenic
1106926253 13:34616118-34616140 TAGGCTGAGGGTGAGGTGGGTGG - Intergenic
1108054806 13:46474902-46474924 GAGGTTAAGGAGGGGGCAGGAGG + Intergenic
1111697500 13:91643081-91643103 TAGGCTGAGCATGGGGATGGAGG + Intronic
1111726276 13:92013463-92013485 TAGGCACAGGATGGGGTAGGTGG + Intronic
1111739376 13:92183325-92183347 AAGGCTGAGGTTGGGATAGGTGG + Intronic
1114430914 14:22659716-22659738 GAGGCTGAGGTGGGGGTAGGAGG + Intergenic
1115031636 14:28802960-28802982 TAGGATAAGGATGGGGAAAGAGG - Intronic
1115537234 14:34384669-34384691 CAGGCTGAGGGTGTGGTAGGAGG + Intronic
1117773833 14:59162045-59162067 TGGGCTGAGCATGGGGTGGGAGG + Intergenic
1118001684 14:61528744-61528766 TAGGCTGAGTATGAGGTAAGTGG + Intronic
1118262156 14:64257756-64257778 TAGGTGGGGGATGGGGTAGGTGG + Intronic
1118320505 14:64749605-64749627 CTGGCTAAGAAGGGGGTAGGTGG - Exonic
1118826965 14:69392508-69392530 GAGGTTGAGGGTGGGGTAGGAGG + Intronic
1118904549 14:70014165-70014187 TGGGCTAAGGATGAGGTATCTGG + Intronic
1120938487 14:89921645-89921667 GAGGAGAACGATGGGGTAGGAGG + Intronic
1122355143 14:101118436-101118458 TGGGCCAGGGATGGGGGAGGAGG - Intergenic
1122791445 14:104185669-104185691 TGGGGTACGGATGGGGTGGGAGG + Intergenic
1202900718 14_GL000194v1_random:35464-35486 TAGGCTGGGGCAGGGGTAGGGGG - Intergenic
1125984741 15:44039016-44039038 ATTGCTAAGGATGGAGTAGGTGG + Intronic
1127212041 15:56783438-56783460 TAGTCACAGGATGGGATAGGAGG + Intronic
1128253541 15:66180412-66180434 CTGGCTCAGGATGGGGTATGGGG - Intronic
1128254699 15:66188124-66188146 TGGGGTAAGGATGGGGCATGGGG - Intronic
1128496143 15:68199735-68199757 GAGACTAAGGATGGGGAGGGCGG - Intronic
1128549822 15:68590920-68590942 AAGGGTAGGGATGGGGAAGGCGG - Intronic
1129232374 15:74203893-74203915 CAGGCTCAGGATGGGGATGGGGG + Intronic
1131352093 15:91710228-91710250 TAGTCACAGGATGGGATAGGAGG + Intergenic
1131707603 15:95015041-95015063 TAGGCATAGCATGGGGAAGGAGG + Intergenic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132864904 16:2088459-2088481 TAGGCTGGGGTTGGAGTAGGCGG - Exonic
1133331867 16:4979870-4979892 TGGGCTGAGGATGGGGCCGGTGG - Intronic
1135156755 16:20059321-20059343 TAGGCACAGGCTGGGCTAGGTGG - Intronic
1135325100 16:21520825-21520847 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1135980419 16:27142802-27142824 TAGTCAAAGGATGAGGTGGGAGG - Intergenic
1136280611 16:29207382-29207404 TATGCTAAGGAGGCAGTAGGTGG + Intergenic
1136336583 16:29614093-29614115 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1137298462 16:47121533-47121555 TAGTCTCAGGGTGGGGTTGGAGG - Intronic
1137481925 16:48858995-48859017 TGGGCTAAGCATGGGGAGGGGGG + Intergenic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1138034532 16:53590969-53590991 TTGGATAAAGATGGGGAAGGGGG + Intergenic
1139431397 16:66912783-66912805 GAGCCTGAGGATGGGGTAGAGGG - Exonic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1140971120 16:80013710-80013732 TGGGTGAAGGATGGGGTAAGAGG + Intergenic
1141735514 16:85849775-85849797 AAGGCAAAGGATGGAGCAGGTGG - Intergenic
1141993356 16:87622549-87622571 GAGGCTGTGGCTGGGGTAGGAGG + Intronic
1142084971 16:88173323-88173345 TATGCTAAGGAGGCGGTTGGTGG + Intergenic
1144303243 17:13943475-13943497 TTGGCCAAGCTTGGGGTAGGTGG + Intergenic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1145005524 17:19335604-19335626 TAGGCTAAGACAGGGGTGGGGGG + Exonic
1146059164 17:29595554-29595576 TGGGGTAAGGTTGGGGTGGGGGG + Intronic
1147452726 17:40515936-40515958 TAAGGGAAGGATGGGGGAGGAGG - Intergenic
1147669325 17:42167691-42167713 TAGGCCAAGGGTGGGGATGGAGG - Intronic
1148626971 17:49076965-49076987 TAGTCACAGGATGAGGTAGGAGG - Intergenic
1150350054 17:64437360-64437382 TAGTCACAGGATGGGATAGGAGG + Intergenic
1151260679 17:72913550-72913572 AAGGATAAGGATGAAGTAGGGGG + Intronic
1151763595 17:76121399-76121421 GGGGCTAAGGCTGGGCTAGGGGG - Intronic
1152485569 17:80589868-80589890 AAGTATAAAGATGGGGTAGGAGG - Intronic
1152518257 17:80838691-80838713 GAGGCCAGGGATGGGGGAGGCGG + Intronic
1152918531 17:83053861-83053883 TAGGCTCATGATAAGGTAGGTGG + Intergenic
1157048808 18:44135686-44135708 TAGTCAAAGGATGAGATAGGAGG + Intergenic
1158290228 18:55932448-55932470 TAGGCACAGGATGGGGTAGGCGG - Intergenic
1161509621 19:4663243-4663265 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509650 19:4663375-4663397 TAGAATGAGGATGGGGTAGGTGG - Intronic
1161509660 19:4663422-4663444 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509681 19:4663508-4663530 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509707 19:4663598-4663620 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509738 19:4663727-4663749 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509751 19:4663772-4663794 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161709189 19:5838328-5838350 TAGGCTGCTGATGGGGTCGGGGG + Intronic
1162547412 19:11339134-11339156 TGAGCTAAGGCTGGGGGAGGTGG - Intronic
1163121917 19:15223421-15223443 TTGGCTCAGGCTGGGGGAGGCGG + Intergenic
1165232051 19:34393355-34393377 CAGTCTAAGGTCGGGGTAGGGGG + Intronic
1165888875 19:39098886-39098908 TCGGGGAAGGATGGGGTTGGAGG + Intronic
1167139220 19:47638145-47638167 TTGGCTGAGGCTGGGGGAGGGGG - Intronic
1167510903 19:49894940-49894962 TAGGCGAAGGATGGGGTTGGAGG + Intronic
1168061874 19:53897809-53897831 TAAGCCAAGGACAGGGTAGGAGG + Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
926167638 2:10531347-10531369 GAGGCTAAGGTCGGGGCAGGAGG + Intergenic
926435776 2:12836095-12836117 TAGGGGAAGCATGGGGGAGGAGG - Intergenic
928164193 2:28957762-28957784 TAGGATAGGGAAGGAGTAGGGGG + Intronic
929402499 2:41601538-41601560 GAGGCTAGGAGTGGGGTAGGTGG - Intergenic
929571375 2:43025169-43025191 TGTGCTAAGGAAGGGGCAGGAGG - Intergenic
929736484 2:44555437-44555459 TAGGGTGAGGATGGGGAGGGAGG + Intronic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
932272790 2:70425501-70425523 TATTCTGAGGGTGGGGTAGGGGG + Intergenic
932796507 2:74700429-74700451 AATGCCATGGATGGGGTAGGGGG - Intergenic
935840611 2:107105715-107105737 GAGGCTAAGGCTGAGGTGGGAGG - Intergenic
936396899 2:112138371-112138393 TGGGCTAAGGACGAGGGAGGAGG - Exonic
941625224 2:167824003-167824025 TAGGCTGAGGAAGGGGTGTGTGG + Intergenic
941942920 2:171062576-171062598 TATGCTAGGGGTGGGGTAAGAGG - Intronic
942081518 2:172403571-172403593 GAGGATATGGATGGAGTAGGCGG + Intergenic
942365303 2:175219946-175219968 TTGCCTAAGGCTGGGGTTGGGGG + Intergenic
945262245 2:207854360-207854382 TAATCTGATGATGGGGTAGGGGG - Intronic
947152286 2:227128198-227128220 TAGGCTCAGGCTCAGGTAGGGGG - Intronic
947296058 2:228631812-228631834 TAGGAAAAGGGTGGGGTGGGAGG + Intergenic
947669435 2:231926946-231926968 GAGGCAGAGGATGGGGTTGGAGG + Intergenic
947796601 2:232897111-232897133 GAGGGTAGGGATGGGGTAGGGGG + Intronic
947923702 2:233902356-233902378 TAGGCTGAGCATGGAGTAGGAGG + Intergenic
1169376925 20:5073622-5073644 TAGCCTAAGGCTTGGGTAGTGGG + Intronic
1171219758 20:23384511-23384533 GAGGCTAAGGCTGAGGTGGGAGG + Intronic
1172288463 20:33757928-33757950 GATGCTAAGTATGGGGTGGGAGG + Intronic
1172617490 20:36298825-36298847 TGGGCCAGGCATGGGGTAGGAGG - Intergenic
1173466332 20:43284964-43284986 TATGCTGAGGATGGGGTTTGGGG - Intergenic
1173818928 20:46008470-46008492 AAGGCCAAGGATGGGCCAGGGGG + Intergenic
1174105237 20:48157214-48157236 TAGTCACAGGATGAGGTAGGAGG + Intergenic
1174269065 20:49353759-49353781 TGGCCAAAGGATGGGGTAAGAGG + Intergenic
1174508695 20:51034696-51034718 TAGGAGAAGCATGGGGGAGGGGG - Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1175525028 20:59628013-59628035 TGGGCTAAGGAGGGGGCAGAAGG - Intronic
1175751494 20:61501171-61501193 TAGACTCAGGCTGGGGGAGGTGG + Intronic
1179095883 21:38314114-38314136 TAGGCATAGGATGGGGGAAGGGG - Intergenic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179709821 21:43206871-43206893 TAGCCAAGGGAGGGGGTAGGTGG + Intergenic
1180380002 22:12132071-12132093 TAGGCTGCGGCAGGGGTAGGGGG + Intergenic
1182965469 22:34517505-34517527 TAGGCACAGGATGAGATAGGAGG + Intergenic
1183718719 22:39549781-39549803 GGGAGTAAGGATGGGGTAGGGGG - Intergenic
1183909479 22:41067732-41067754 TATGCTAAGAGAGGGGTAGGTGG - Intergenic
1184466872 22:44673683-44673705 TAGTCTAGGGCTTGGGTAGGTGG + Intronic
1184581672 22:45422191-45422213 ATGGCTAAGGACGTGGTAGGAGG + Intronic
1184816912 22:46879289-46879311 TGGGGAAAGGTTGGGGTAGGCGG + Intronic
1185337355 22:50276565-50276587 CAGGCTCAGCATGGGGTAGTGGG + Intronic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
950275271 3:11655509-11655531 TAGGCTGAGAATGGGGGTGGTGG - Intronic
952668084 3:35932011-35932033 TTGGCTATGCATGGGGCAGGGGG - Intergenic
953794493 3:45974061-45974083 TGGGCAAGGGTTGGGGTAGGGGG - Intronic
954171086 3:48803046-48803068 TCTGCTAAGGATGAGGAAGGAGG + Intronic
954752016 3:52819137-52819159 GACGCTAAGGATGGGGCAGGGGG + Exonic
956551655 3:70467554-70467576 TAGGGTAGGGATGGGGAAAGAGG - Intergenic
956808746 3:72843749-72843771 TAGGCTAAGGGTAGGGTATGGGG - Intronic
958857542 3:99404033-99404055 AAGCCTAATGATGGGGAAGGAGG - Intergenic
958973440 3:100638484-100638506 TAGGCACAGGATGGGGGAGTAGG + Intronic
959417122 3:106088930-106088952 AAGGCCAAGGATGGGGAAAGTGG - Intergenic
959680980 3:109096316-109096338 TAGTCACAGGATGGGATAGGAGG + Intronic
960176494 3:114523783-114523805 GAGCGTAAGGATGGGGGAGGAGG + Intronic
961817493 3:129558810-129558832 GAGGCTCAGGAGGGGGTTGGGGG - Intronic
962262523 3:133922711-133922733 GGGGCTAGAGATGGGGTAGGAGG + Intergenic
962359268 3:134723685-134723707 TGGGGTAAGGATGGCTTAGGAGG + Intronic
966639554 3:182174485-182174507 TAGGCCAAAGATGGGGAAAGTGG + Intergenic
966806050 3:183808467-183808489 TAGGATCAGGCTGGGGAAGGAGG - Intronic
968848102 4:3058572-3058594 TAGTCACAGGATGAGGTAGGAGG - Intergenic
971168851 4:24212802-24212824 TTGGGTAAGAATGGGCTAGGAGG - Intergenic
972297364 4:37752890-37752912 TAGTCACAGGATGAGGTAGGAGG + Intergenic
973323595 4:48834666-48834688 GAGGCTGAGGCTGAGGTAGGAGG + Intronic
979213548 4:118135255-118135277 CAGGCTTAGGAAGGGGTAGTGGG + Intronic
981956038 4:150475607-150475629 TAGGCTCAGGCTGGGCTTGGTGG + Intronic
985752959 5:1692897-1692919 TAGGCACAGGATGGGGGACGGGG + Intergenic
990466864 5:56078930-56078952 TAGGTTAGGGAGGGGGTGGGAGG + Intergenic
990618899 5:57538777-57538799 TAGGTTAGGAATGAGGTAGGAGG + Intergenic
990782817 5:59385509-59385531 TAGGTAGAGGGTGGGGTAGGAGG + Intronic
990999321 5:61767109-61767131 TTGGCAATTGATGGGGTAGGGGG - Intergenic
995753219 5:115475108-115475130 TAGCTTCAGGATGGGGCAGGAGG - Intergenic
996219341 5:120910542-120910564 TAGGCTATGGCAGAGGTAGGTGG + Intergenic
996999844 5:129746496-129746518 TAGCCAAAGCATGAGGTAGGTGG - Intergenic
997294074 5:132759186-132759208 GAGGCCAGGAATGGGGTAGGTGG - Intronic
997462224 5:134060642-134060664 AAGACAAAGGATGGGGAAGGAGG + Intergenic
1000752481 5:165113951-165113973 TAGGCTGAGGATGGGGAAGAAGG - Intergenic
1001000464 5:168001234-168001256 TAGGCAAAGGAATGGTTAGGGGG + Intronic
1001029397 5:168250783-168250805 TATGCTAAGCATGGGGTAAGCGG - Intronic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1002080954 5:176737131-176737153 GAGGCCCAGGAAGGGGTAGGGGG + Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002791362 6:440423-440445 AAGGCAAAGGATGGGACAGGTGG - Intergenic
1003676077 6:8205737-8205759 TAGGCAAACGATGGTGGAGGGGG + Intergenic
1003776230 6:9368701-9368723 TAGTCACAGGATGGGATAGGAGG - Intergenic
1004673765 6:17822009-17822031 TGGGTAAAGGATGGGGTAGGGGG + Intronic
1006563564 6:34934821-34934843 TAGGCTGGGGGTGGGGTGGGAGG - Intronic
1006706285 6:36024168-36024190 GAGGAAATGGATGGGGTAGGCGG + Intronic
1007070486 6:39034129-39034151 TAGGCAAATGATGGCGAAGGAGG + Intergenic
1007148826 6:39667268-39667290 AAGCCTCAGGATGGGGTGGGAGG + Intronic
1007273426 6:40655872-40655894 TCAGCTTGGGATGGGGTAGGGGG - Intergenic
1007474018 6:42107244-42107266 AAGGCCAAGGGTGGGGCAGGGGG + Exonic
1007717156 6:43864061-43864083 TAGGATAGGGCTGGGGAAGGTGG - Intergenic
1007941044 6:45781981-45782003 TTGGCTAAGAAAGGGGAAGGGGG + Intergenic
1010796987 6:80128496-80128518 AAGGCAAAGAATGGTGTAGGTGG - Intronic
1011464510 6:87641496-87641518 TAGTGTCAGGATGGGGGAGGAGG - Intronic
1012641142 6:101616026-101616048 TAGGCTAAGCCTAGGGGAGGAGG - Intronic
1013375951 6:109514278-109514300 TAGGCTTAGGTTTGGGTTGGCGG + Exonic
1015262098 6:131249949-131249971 TAGGCTAAGTGTGGGGAAAGAGG - Intronic
1016012829 6:139156744-139156766 TAGTCTAAGGATAGAGTATGCGG - Intronic
1016084421 6:139895025-139895047 TAGGCACAGGATGGGGGCGGGGG + Intergenic
1016108778 6:140195058-140195080 TAGTCTCAGGATGAGATAGGAGG + Intergenic
1016417515 6:143848566-143848588 TGGGCTGAGGATAGGGCAGGTGG + Intronic
1016699188 6:147034568-147034590 TAGGCACAGGATGAGATAGGAGG + Intergenic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1020356250 7:7278888-7278910 TAGGCTCAGGATGGGGGTTGGGG - Intergenic
1020878629 7:13730077-13730099 GAGGCGAAGGATGGGGGCGGTGG + Intergenic
1022800244 7:33769949-33769971 ATGGCTAGGGATGGGGTTGGGGG + Intergenic
1023396864 7:39759559-39759581 GGGACTAGGGATGGGGTAGGGGG - Intergenic
1026493058 7:70879847-70879869 TAGTCAAAGGATGAGATAGGAGG + Intergenic
1027128020 7:75571067-75571089 TGGGCTGAGGAAGGGGTAGGAGG - Intronic
1027580022 7:79981144-79981166 TGGACCAAGTATGGGGTAGGTGG - Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028729584 7:94130617-94130639 TAGGATAGGCATGGGGTTGGGGG - Intergenic
1029207311 7:98877734-98877756 TAGGTGAAGGAAGGTGTAGGAGG + Intergenic
1031712830 7:125070481-125070503 TAGGCAAAGGAGGGGGATGGGGG + Intergenic
1032189749 7:129757838-129757860 GGGCCTAAGGATGGGGCAGGAGG - Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1038938047 8:32274368-32274390 TAGGGTAAGTACGGGATAGGTGG + Intronic
1039993100 8:42506800-42506822 TAGGGTAAGGAAGGAATAGGGGG - Intronic
1041346697 8:56906428-56906450 TAGGCTAGGGCTGGGCTTGGTGG - Intergenic
1044920197 8:97162081-97162103 TAGGCAAAGGAAGGGGTAAAGGG - Intergenic
1047210585 8:122836904-122836926 AAGGCACAGGATGAGGTAGGAGG + Intronic
1047757801 8:127932009-127932031 AAGCCTGAGGATGGGGTGGGAGG - Intergenic
1048641725 8:136370398-136370420 TAGGCACAGGATGGGGGATGGGG + Intergenic
1049113758 8:140667740-140667762 TAAGCTAAGGGTTGGGTATGTGG - Intronic
1049320235 8:141992327-141992349 TAGGCTAACGAGGGGGCAGTGGG - Intergenic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1051467833 9:17400732-17400754 TATGCTGAGGATGGGGTAAGGGG - Intronic
1052169713 9:25377844-25377866 TAGGCACAGGATGGGGGATGGGG + Intergenic
1052593685 9:30531423-30531445 TAGGCATAGGATGAGGCAGGAGG + Intergenic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1057184037 9:93046408-93046430 CAGGCTAGGGGTGGGGTGGGGGG + Intergenic
1057530693 9:95843073-95843095 GGGACTAAGGATGGGGTTGGGGG - Intergenic
1058144972 9:101400430-101400452 GAGACAAAGGATGGGGAAGGAGG - Intronic
1061757621 9:132826548-132826570 GAGGCAAGGGATGGGGTGGGAGG - Intronic
1062607942 9:137356508-137356530 AGTGCTAAGGATGGGGTGGGCGG - Intronic
1186295369 X:8142976-8142998 AAGGCTATGGCAGGGGTAGGGGG + Intergenic
1187947026 X:24436020-24436042 TAGGATAAGGATGAGGTAGGAGG - Intergenic
1188182659 X:27075136-27075158 TAGGCACAGGATGGGGGATGGGG - Intergenic
1188518605 X:31013468-31013490 TAGAGTAAGGATGGGGTGGGAGG - Intergenic
1188757047 X:33975058-33975080 TTGGGTAAGGCTGGAGTAGGGGG + Intergenic
1189299397 X:39941820-39941842 TAGGCTTTGGGTGGGCTAGGTGG - Intergenic
1190712164 X:53078965-53078987 TGGGGGAAGGATGGGGAAGGAGG - Exonic
1191205640 X:57831121-57831143 TGGGCACAGGATGGGGGAGGTGG + Intergenic
1197828516 X:130615968-130615990 TGCTCTAGGGATGGGGTAGGGGG - Intergenic
1198539669 X:137623920-137623942 TAGGCCAGGGATGGTGTGGGAGG - Intergenic
1200954508 Y:8930280-8930302 TAGGCAAGGGATTGGGTATGGGG + Intergenic