ID: 906481761

View in Genome Browser
Species Human (GRCh38)
Location 1:46203813-46203835
Sequence AAGAGTGAGTGGGGTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906481753_906481761 -7 Left 906481753 1:46203797-46203819 CCATTACTTGTCCCCCAAGAGTG 0: 1
1: 0
2: 1
3: 6
4: 115
Right 906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG 0: 1
1: 0
2: 4
3: 47
4: 400
906481751_906481761 25 Left 906481751 1:46203765-46203787 CCGTAAACGCTGGGGTGGAGATG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG 0: 1
1: 0
2: 4
3: 47
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906481761 Original CRISPR AAGAGTGAGTGGGGTGTTGA TGG Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900563047 1:3317534-3317556 GAGAGGGAGTGGGGTCTGGATGG - Intronic
900663015 1:3795477-3795499 GAGAGTGAGTCTGGTGGTGAAGG - Intronic
900846397 1:5105741-5105763 CTGAGTGACTGGGGTGGTGAAGG - Intergenic
900862861 1:5245492-5245514 AGGAGGGAGTGGGATGTGGAGGG + Intergenic
901447173 1:9315700-9315722 AACACTGAGTGGGGAGTTGGTGG + Intronic
902461043 1:16576983-16577005 AAGGGTAAGTGGGGTGGTGATGG + Intronic
902461824 1:16583260-16583282 AAGGGTAAGTGGGGTGGTGATGG + Intronic
902462604 1:16589565-16589587 AAGGGTAAGTGGGGTGGCGATGG + Intronic
903061249 1:20670385-20670407 GAGAGGGAGTGGGGTGTCGGGGG - Intronic
903158959 1:21471046-21471068 AAGGGTGAGTGGGGTGGTGATGG - Intronic
903363207 1:22790121-22790143 AAGAGTGAGTAGGATTTGGATGG + Intronic
903559083 1:24214460-24214482 AATAGTGAAAGGTGTGTTGAAGG - Intergenic
905197403 1:36290904-36290926 AAGCGGGAGTGGGGTGTGGCTGG - Intronic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906488879 1:46252193-46252215 AAGAGAGTGTGGGGAGTTGGGGG + Intronic
906658274 1:47564513-47564535 ATGAGTGAGTGGGGGGATGAGGG + Intergenic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
907328929 1:53658888-53658910 AAGAATGAGTGGGGAGGTGGGGG + Intronic
907533177 1:55122627-55122649 AACAGTGAAAGGGGTGTTAAGGG + Intronic
907772680 1:57481346-57481368 AAGAATGAGAGAGGTGTTGGGGG - Intronic
907836314 1:58112186-58112208 AAGGGTGAGTGGGGATTGGAGGG - Intronic
908162354 1:61422795-61422817 ATGAGGGAGTGGGGTGGAGAGGG - Intronic
909300777 1:74010508-74010530 AAGAATGTGTGAGGAGTTGAAGG - Intergenic
911245820 1:95515997-95516019 GAGAGTCAGTGGGGTGGGGATGG + Intergenic
911366521 1:96945585-96945607 TTGAGTCAGTGGGGTGTGGAAGG - Intergenic
912652260 1:111449707-111449729 AAGGGAGCGTGGGGTCTTGAGGG + Intronic
913543270 1:119842101-119842123 AAGGGTAAGTGGGGTGGTTATGG + Intergenic
913604381 1:120451593-120451615 AAGGGTAAGTGGGGTGGTGATGG - Intergenic
913640485 1:120808021-120808043 AAGGGTAAGTGGGGTGGTGATGG - Intronic
913641254 1:120814305-120814327 AAGGGTAAGTGGGGTGGTGATGG - Intronic
914084162 1:144437611-144437633 AAGGGTAAGTGGGGTGGTGATGG + Intronic
914190183 1:145402882-145402904 AAGGGTAAGTGGGGTGGTGATGG + Intronic
914212038 1:145588603-145588625 AAGGGTAAGTGGGGTGGTGATGG + Intergenic
914227959 1:145737372-145737394 CAGAATGAATGGGGTGGTGAAGG - Intronic
914277231 1:146136023-146136045 AAGGGTAAGTGGGGTGGTGATGG + Intronic
914364809 1:146968862-146968884 AAGGGTAAGTGGGGTCGTGATGG - Intronic
914365571 1:146975153-146975175 AAGGGTAAGTGGGATGGTGATGG - Intronic
914486871 1:148118286-148118308 TAGGGTAAGTGGGGTGGTGATGG + Intronic
914538278 1:148586971-148586993 AAGGGTAAGTGGGGTGGTGATGG + Intronic
914587203 1:149073434-149073456 AAGGGTAAGTGGGGTGGTGATGG + Intronic
914940714 1:152020651-152020673 AAGGGTAAGTGGGGTGATGATGG - Intergenic
915690183 1:157681023-157681045 TAGAGTGAGTGGGCTCTTGAGGG + Exonic
917970226 1:180201456-180201478 AGGGGTGAAAGGGGTGTTGAAGG - Exonic
918284787 1:183041768-183041790 AAAAGTCAGTGGGGTGGTGGAGG - Intronic
919738113 1:200966152-200966174 AGGAGTGAGTGGGTTGGTAATGG + Intergenic
921222312 1:212981753-212981775 AAGAGAGACTGGGTGGTTGAGGG + Intronic
921899489 1:220435319-220435341 GAGACTGGGTGGGGTTTTGAGGG + Intergenic
922831491 1:228556627-228556649 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922831969 1:228608581-228608603 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922832530 1:228610822-228610844 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922833090 1:228613063-228613085 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922833651 1:228615304-228615326 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922834210 1:228617545-228617567 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922834768 1:228619786-228619808 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922835319 1:228622001-228622023 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922835878 1:228624221-228624243 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922836437 1:228626463-228626485 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922836995 1:228628702-228628724 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922837554 1:228630944-228630966 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922838113 1:228633185-228633207 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922838672 1:228635424-228635446 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922839231 1:228637650-228637672 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922839789 1:228639891-228639913 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922840352 1:228642122-228642144 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922840912 1:228644363-228644385 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922841475 1:228646594-228646616 AAGAGGGCGTGGGGTGTAGCGGG + Intergenic
922914025 1:229240929-229240951 AAGAGTGACTGGGGGCTGGAGGG - Intergenic
922938151 1:229436710-229436732 ACGGGTGTGTGGAGTGTTGAGGG - Intergenic
923118753 1:230970295-230970317 AAGAGAGAGTGGAGTGGTGGAGG + Intronic
923489257 1:234468875-234468897 AAGGGTGAGTGGGGTAGTCAGGG - Intronic
923879760 1:238090799-238090821 AAGATGGTGTGGGCTGTTGAGGG + Intergenic
1062956031 10:1541147-1541169 GAGTGTGAGTGGGGTCTGGACGG - Intronic
1062956207 10:1542051-1542073 GAGTGTGAGTGGGGTCTGGACGG - Intronic
1063444756 10:6104526-6104548 AAGAATGATTGTGGTGTTCATGG + Intronic
1063721091 10:8582323-8582345 AAGAGAGAGTGGGTTGGTGGGGG - Intergenic
1064254850 10:13734602-13734624 GAGAGTGAGTGGGGTCTTCAAGG - Intronic
1064739323 10:18416145-18416167 AAGGGTGAGTGGGGGGTGCAGGG - Intronic
1065712795 10:28533378-28533400 GAGAGTGAGCGTGGTGTCGACGG + Intronic
1065716445 10:28573856-28573878 GAGGGTGAGGGGGGTGTTGGGGG - Intronic
1066368770 10:34801553-34801575 AATAGGGAGTGGCGTCTTGAAGG - Intronic
1068484810 10:57644229-57644251 GAGATTGAGAGGGGTGTTGGGGG + Intergenic
1068785620 10:60969441-60969463 GAAAGTGAGTAGGGTGTTGAAGG + Intronic
1068826664 10:61447840-61447862 CAGAGTGAGGGGGGTGTGCAGGG - Intronic
1070396210 10:76013175-76013197 AGGAGTGAGGGGGGTGGTAATGG + Intronic
1070942663 10:80360183-80360205 AAAATTGAGTGGGGTAGTGATGG - Intronic
1071080349 10:81803025-81803047 AAGAGTAAGTTGGGCTTTGATGG + Intergenic
1072511257 10:96128352-96128374 AAGTGGAAGTGGGGTGGTGAGGG - Intergenic
1073102339 10:101012930-101012952 CAGAGTCAGTGGGGTGTGGCTGG - Intronic
1074307070 10:112288815-112288837 AAGAGTGAGTGGGAGGGGGATGG - Intronic
1075651250 10:124129355-124129377 AAGAGTGTGTGGAGTGGGGAAGG - Intergenic
1076478745 10:130770095-130770117 AGGAGAGAGTGGAGTGTTGAAGG - Intergenic
1077390942 11:2300389-2300411 AAGAGGAAGTGGCTTGTTGAGGG - Intronic
1077494298 11:2878924-2878946 AACAGTGAGTTGGGTCTTCAAGG + Intergenic
1078251065 11:9616983-9617005 AAGTGTGCTTGGTGTGTTGAAGG + Intergenic
1078665420 11:13320898-13320920 AAAAGTAGGTGGGGTATTGAAGG + Intronic
1080686321 11:34518244-34518266 AAGAGTGAGTTGGATGTAGGAGG - Intergenic
1081324959 11:41733112-41733134 GAGAGTGAGTGGGACCTTGAAGG + Intergenic
1081974079 11:47220174-47220196 AAGTGTGAGATGGGTGTTCAAGG + Intronic
1082991731 11:59212503-59212525 AAGAGAGAGTTCTGTGTTGATGG + Exonic
1084461850 11:69300601-69300623 AGGAGGGAGTAGGGTGTGGAAGG + Intronic
1085011296 11:73142976-73142998 TAGGGAGAGTAGGGTGTTGAGGG - Intergenic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1087691673 11:101327449-101327471 AAGGGTCGGTGGGGTGTGGAAGG + Intergenic
1088372121 11:109102476-109102498 AAGAATGAGTGGTATTTTGATGG + Intergenic
1088586215 11:111362109-111362131 AAGAGTGAGTTGAGTGTGGCAGG - Intronic
1090045479 11:123328480-123328502 AAGAGGAAGTGAGGAGTTGATGG - Intergenic
1090191906 11:124777163-124777185 AAGAGTGGTTGGGGTGTTCTTGG - Intronic
1090984711 11:131756104-131756126 ATGAGAGTGTGGGGTATTGATGG - Intronic
1092156615 12:6286449-6286471 AAGAGTGAGGGCAGTTTTGAAGG - Intergenic
1092956990 12:13560319-13560341 TGGAGGGAGTGGGGTGGTGATGG - Exonic
1094320744 12:29180121-29180143 AAGAGTGAGTGAGCCTTTGAGGG - Intronic
1094446069 12:30531910-30531932 GAGAGTGAGTGTGGAGTAGAGGG + Intergenic
1096976948 12:55704814-55704836 AGGAGAGAGTGGGGAGATGAGGG + Intronic
1097221887 12:57455909-57455931 CAGAGGGAGTGGGGTGTGGCAGG + Intronic
1097361631 12:58665001-58665023 AAGAGAGAGTGGGGTTCTGCGGG - Intronic
1097702370 12:62833183-62833205 CAGAGTGAGTGTGGAGTTTATGG + Intronic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1098306045 12:69103598-69103620 AAGAATGAGTGGGGTGGGGTGGG + Intergenic
1101327949 12:103733037-103733059 GAGAGTGACTGGGGTGTGGATGG - Exonic
1101859102 12:108468285-108468307 AACAGAGAGTGGGGAGTTAAAGG - Intergenic
1102638634 12:114346669-114346691 TAGAGTGGGTGGGGAGTTGGTGG - Intergenic
1103889642 12:124228737-124228759 AAAAGTGAGTGAGGCGTTGGAGG + Intronic
1103909499 12:124344578-124344600 GAGGGTGAGTGGGGTGTGCATGG - Exonic
1104081708 12:125435359-125435381 AAGAGAGACTGGGGTGCGGAAGG + Intronic
1106235943 13:27860514-27860536 AGCACTGAGTGGGGTGTAGAAGG - Intergenic
1106544990 13:30722827-30722849 AAGAGTGAGAGAGGGGTGGAAGG - Intronic
1106812023 13:33368156-33368178 AAGAGTTAGTGGGGGCTTTAAGG - Intergenic
1107394668 13:40003108-40003130 GAGAGTGACTGGGGTCTTGGAGG - Intergenic
1109067757 13:57721683-57721705 AAGAGAGAGTGTAGTGTGGAGGG - Intronic
1110831582 13:80037827-80037849 AAGGGTCAGTGGGGTGTTCTGGG + Intergenic
1110935936 13:81289113-81289135 AGGTGTGAGTGAGGAGTTGAAGG + Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1112057404 13:95702910-95702932 AATATTGAGTGGGATGGTGATGG - Intronic
1114512647 14:23275560-23275582 AAGACTGAGTGGGGAGCTGGGGG - Exonic
1114814537 14:25941892-25941914 CAGCGTAAATGGGGTGTTGAAGG - Intergenic
1115888242 14:37998106-37998128 AAGAGTGTGTGGGATATGGAAGG - Intronic
1116142198 14:41011773-41011795 TAGAGTGGGAGGGGTGATGAAGG - Intergenic
1116983159 14:51192324-51192346 AAGAGTGAGGGAGGACTTGAGGG + Intergenic
1118062838 14:62159774-62159796 AAGAATGACTGGGTTGTTCAGGG + Intergenic
1118472988 14:66092875-66092897 AAGGGTGAGTGGGGCGGCGAGGG + Intergenic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1119870290 14:78011344-78011366 CAGAGAGAGTGGGGTGCAGAAGG - Intergenic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1122539982 14:102492702-102492724 CAGCGTGAGTGGGGTTGTGAAGG + Intronic
1122867600 14:104614518-104614540 ATGAGTGAGTGGGTGGATGAAGG + Intergenic
1122873064 14:104650401-104650423 AGGAGAGAGTGGGGAGTGGAGGG - Intergenic
1124720616 15:32108263-32108285 AAGAGTGTGTGGAGTTGTGAGGG - Intronic
1125055970 15:35359235-35359257 AACAGTCTGGGGGGTGTTGAGGG - Intronic
1125692443 15:41607267-41607289 ATGTGAGAGTGGGGTGTTGCAGG - Intergenic
1125828996 15:42699297-42699319 AAGAGGGAATGGGGAGTGGATGG - Intronic
1127310279 15:57746036-57746058 AAGATTGAGAGAGGTGTGGAGGG + Intronic
1127656109 15:61057763-61057785 AAGTATGAGTGGGGTGCTCAGGG - Intronic
1127967890 15:63937419-63937441 TAGTGTGAGTGGGTTATTGATGG - Intronic
1128036757 15:64533984-64534006 AACAGTGATTGCTGTGTTGATGG - Intronic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1129934487 15:79437911-79437933 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934505 15:79437968-79437990 GGTAGTGAGTGGGGTGTGGATGG + Intronic
1129934532 15:79438058-79438080 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934577 15:79438221-79438243 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934586 15:79438252-79438274 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934671 15:79438553-79438575 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934690 15:79438611-79438633 GGTAGTGAGTGGGGTGTGGATGG + Intronic
1129934705 15:79438663-79438685 CATAGTGTGTGGGGTGTGGATGG + Intronic
1129934723 15:79438721-79438743 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934749 15:79438814-79438836 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934758 15:79438845-79438867 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934776 15:79438907-79438929 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934785 15:79438938-79438960 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934818 15:79439059-79439081 GTGAGTGTGTGGGGTGTTGATGG + Intronic
1129934836 15:79439117-79439139 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1130033421 15:80336052-80336074 AAGAGTAAGTCTGGTGGTGATGG + Intergenic
1130162083 15:81411641-81411663 AAGAGTGTGTGGCATGTAGAAGG + Intergenic
1131090693 15:89622801-89622823 AAAAGTGGGTGGGGTGGTGGCGG - Intronic
1132015902 15:98316455-98316477 AGGAGTGATTGGGGTGATGTTGG + Intergenic
1132456444 16:26311-26333 GAGAGTGGGAGGGGTGTGGACGG - Intergenic
1132666562 16:1083595-1083617 GAGAGTGGGTGGGGTGGGGACGG + Intergenic
1134315444 16:13114654-13114676 GGGAGAGGGTGGGGTGTTGAAGG - Intronic
1134771275 16:16811807-16811829 AAGAGAGGGAGGGGTGTTGGCGG + Intergenic
1135235384 16:20750460-20750482 GAGAGAGAGGGGGGTGTTTAGGG - Intronic
1136047250 16:27624340-27624362 AGGAGTGAGTGGGGAGTACAGGG - Intronic
1137507565 16:49067793-49067815 AGGAGTGGATGGGGAGTTGAAGG - Intergenic
1137734454 16:50713650-50713672 AAGAGTGAGAGGGTTGGTGCAGG + Intronic
1137944011 16:52716703-52716725 TAGGGTGAGGTGGGTGTTGATGG - Intergenic
1138247413 16:55478155-55478177 AAGAGTGAGTGGGGAATTCGTGG + Intronic
1139136675 16:64212945-64212967 AGGAGTTAGGGGGGAGTTGATGG - Intergenic
1139183234 16:64771456-64771478 AAGAGCGAGTGGAGCGGTGAGGG - Intergenic
1141082017 16:81061062-81061084 AAGAGAGAGTGGGGGGTGGGTGG + Exonic
1141868656 16:86769146-86769168 CAGAGTGGGTGCGGTGCTGATGG - Intergenic
1142157673 16:88540019-88540041 AGGAGGGGGTTGGGTGTTGAGGG - Intergenic
1142407300 16:89897640-89897662 AAGAGACAGTGGGCTGTTGATGG + Intronic
1142476780 17:193593-193615 ACACCTGAGTGGGGTGTTGAGGG - Intergenic
1143156512 17:4840742-4840764 AAGGATGAGTGGGGTGTGGAGGG + Intronic
1143715308 17:8763528-8763550 AAGAATGTGTGGAGTGTTCAGGG + Intergenic
1144246391 17:13370024-13370046 AAGAGGGAGTCTGGTGTTTAAGG - Intergenic
1145875741 17:28317428-28317450 AAGAGTGATTGAGGTGCAGAAGG - Intergenic
1145952984 17:28834559-28834581 AAGAGTCAGTTGGGTCTTGAAGG - Intronic
1147240426 17:39087103-39087125 ATGGGTGAGTGGGGTGCAGAGGG + Intronic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147515910 17:41117572-41117594 CAGAGTCAGTGGGATGGTGATGG + Exonic
1148197387 17:45724027-45724049 GAGAGTGAGGGGTGTGTTGAGGG - Intergenic
1148334499 17:46832395-46832417 AAGAGAGAGGGGGGTGGTGGAGG + Intronic
1148360721 17:47010166-47010188 AAGAGGGAGTGGAGTCTGGATGG - Intronic
1148517571 17:48235102-48235124 AAGACTGAGCTGGGTTTTGAAGG + Intronic
1148883049 17:50746746-50746768 AAAAGTGAGTGGGGCGATTAGGG - Intronic
1148963210 17:51410800-51410822 GAGCTTGAGTGAGGTGTTGATGG + Intergenic
1151120979 17:71792658-71792680 AAGAGAGAGTGGAGTGCTCATGG - Intergenic
1151691903 17:75691686-75691708 AAGGGTGAGTGGGGGCTGGAGGG + Intronic
1151854618 17:76711777-76711799 AAGAGTGGGTGGGGAGTGGTAGG - Intergenic
1152571970 17:81124911-81124933 CAGAGTGAGTGGGGTGGGGTGGG - Exonic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1154172889 18:12063662-12063684 GAGAGTGAGTGGTGAGTAGAGGG - Intergenic
1156081737 18:33343672-33343694 AAGTGGGATTGGGGAGTTGAGGG + Intronic
1156265322 18:35482756-35482778 AAGGGAGAGTGGGGTGCGGAAGG - Intronic
1157408151 18:47440997-47441019 AGGAGTGTGTGGGGTGGGGAGGG + Intergenic
1157484696 18:48078529-48078551 AAGAGTGAGTTGGGTGTACTGGG + Intronic
1157822665 18:50785067-50785089 AGGGGTGAGTGGGGAGTGGAGGG - Intergenic
1157976465 18:52333239-52333261 AGGAGGGAGTGAGGTGTTCAGGG - Intergenic
1158123116 18:54072198-54072220 AAGAGTGTGTGGGTGGGTGAGGG - Intergenic
1158411913 18:57213511-57213533 ATGGGTGAGTGTGGAGTTGAGGG + Intergenic
1158866893 18:61646555-61646577 AGAAGTGAGTGGGGTATTAAAGG + Intergenic
1159548861 18:69874331-69874353 AAGGGTGAGAGGTGTGTTGTGGG - Intronic
1160478803 18:79219244-79219266 AGGAGAGAGTGCTGTGTTGAGGG + Intronic
1161285267 19:3465128-3465150 AAGAGGAAGTGGGGGGTGGAGGG - Intronic
1165577510 19:36833950-36833972 AAGAGTGAATGGGCTGGTCATGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1167880454 19:52453442-52453464 AAGAGAGGGTGGGGCGGTGAGGG - Intergenic
1202677476 1_KI270711v1_random:20723-20745 AAGGGTAAGTGGGGTGGTGATGG + Intergenic
1202678261 1_KI270711v1_random:27007-27029 AAGGGTAAGTGGGGTGGTGATGG + Intergenic
925023417 2:589026-589048 AAGCTTGAGTGGGGCCTTGAAGG + Intergenic
927717217 2:25360501-25360523 AAAAGTGGGAGGGGGGTTGATGG - Intergenic
929052543 2:37850206-37850228 AAGGGTGAATGGGAGGTTGAGGG + Intergenic
929755226 2:44758650-44758672 AAAAGTGAGTGGGGGGTTGAGGG - Intronic
929890498 2:45914865-45914887 AAGAGAAAGTGGGGTTTTGTGGG - Intronic
930341187 2:50116949-50116971 AAGAGGTAGTGGGGTGTTACAGG + Intronic
931060336 2:58521792-58521814 ATGAATGGGTGGGATGTTGATGG + Intergenic
931086362 2:58835121-58835143 AAGAATGAGTGTGGAGTGGAAGG - Intergenic
931501864 2:62877405-62877427 TATTGTCAGTGGGGTGTTGAAGG - Intronic
931636777 2:64347904-64347926 AAGAGTGAAAGGGGTGCTGAAGG + Intergenic
932302472 2:70676906-70676928 AAGAGTGAGCTGGCTGTTCAGGG + Intronic
933754844 2:85630106-85630128 AAGAGTGTGGGGGGTGGTGAGGG - Intronic
933773697 2:85759180-85759202 CAGAGTGAGGGAGGTGCTGAGGG - Intronic
934133597 2:88972530-88972552 AAGAGAGAGTGAGGTTGTGAGGG + Intergenic
934545276 2:95209190-95209212 AAGAGAGAGTGGGTAGTTGGAGG + Intronic
935111966 2:100103502-100103524 AAGAGATAGTGGGGGGTTGGGGG + Intronic
935810122 2:106789511-106789533 AAGAGTGAGTGGGAAGTTACTGG - Intergenic
936221681 2:110609816-110609838 AAGAGATAGTGGGGGGTTGGGGG + Intergenic
936779861 2:116019108-116019130 AAGAGTTAGGGGTGTCTTGATGG - Intergenic
937493871 2:122397965-122397987 AAGAATGAGTGTGATGTTGGAGG + Intergenic
938200582 2:129369347-129369369 AAGTGTGACAGGGATGTTGAGGG - Intergenic
939558424 2:143704761-143704783 ATGAGTGATTGAGGTGTTTAAGG - Intronic
940009076 2:149036649-149036671 GAGAGAGAGTGGGGTGGGGAGGG + Intergenic
940168325 2:150799755-150799777 AAAAGTGAGTGGGGTGATGAAGG - Intergenic
940282217 2:152000151-152000173 AAGAGTGAGGTGGGTGGTGGAGG - Intronic
940556750 2:155238365-155238387 ATAAGTGAGTGAGATGTTGATGG + Intergenic
940887441 2:159001873-159001895 AAGGGAGAGGGGGTTGTTGATGG + Intronic
941889116 2:170559786-170559808 AGGAGTGAGTGTGGGGGTGATGG - Intronic
942484868 2:176428436-176428458 AAGTGTGAGTGGGGTAATCAGGG - Intergenic
943420600 2:187663318-187663340 ATAAGTGAGTGGGGTCTTAAGGG + Intergenic
944866933 2:203871484-203871506 AATGGTGAGTGTGGTGCTGATGG + Exonic
947831412 2:233144328-233144350 AAGAGTGGGAGGGGTGGAGATGG + Intronic
948244239 2:236464832-236464854 AAGAGAGAGTGCGGGGTTGGCGG - Intronic
1168982854 20:2022710-2022732 AAGTGTTAGTGGGGTGGTGAAGG + Intergenic
1169479279 20:5962938-5962960 CAGAATGAGAGGGTTGTTGAAGG + Intronic
1170806006 20:19632462-19632484 ATGAGTGAGAGAGGTGATGATGG - Intronic
1173359265 20:42325883-42325905 GAGCGTGTGTGGGGTGTTCAGGG - Intronic
1174407892 20:50313882-50313904 AAGAGTTAGTCGGGTGGTCAAGG + Intergenic
1174484573 20:50853022-50853044 AAGAATGTGGGGGGTGTAGAGGG - Intronic
1175125728 20:56750320-56750342 AAGTGTAATTGGGGTGGTGATGG + Intergenic
1175289801 20:57868160-57868182 AGGAGTGAGGGGGGTGAGGAAGG - Intergenic
1175328826 20:58148672-58148694 ATGAGTGAGTTGGGTTTTCAAGG - Intergenic
1175980844 20:62737876-62737898 AAGAGTGTGTGAGGTGGTGCAGG - Intronic
1176958546 21:15133697-15133719 AACAGTGAATGGCGTGATGATGG - Intergenic
1178867354 21:36340414-36340436 AGGAGGGAGTGGGGTTATGAGGG - Intronic
1179452093 21:41474267-41474289 AAGGGTGAGTGAGGGGGTGAGGG + Intronic
1179936612 21:44610059-44610081 CAGAGAGAGGGGGGTGTTAAAGG + Intronic
1180608097 22:17076529-17076551 AAGAGTGAATGATGTGGTGAAGG - Intergenic
1180842474 22:18965781-18965803 AGGAGTGGGTGGGGAGTGGAAGG - Intergenic
1180982643 22:19886133-19886155 AAGAGTGAGTGGCCTGTGGCAGG + Intronic
1181059012 22:20273075-20273097 AGGAGTGGGTGGGGAGTGGAAGG + Intronic
1181992580 22:26848610-26848632 AAGAGGGAATTTGGTGTTGAGGG + Intergenic
1182120484 22:27783281-27783303 AAAAATGAGTGGGGTGTGGTGGG - Intronic
1182715593 22:32354280-32354302 AGCAGGGAGGGGGGTGTTGAGGG - Intergenic
1184081969 22:42228218-42228240 ATGGGTGAATGTGGTGTTGATGG + Intronic
1184536998 22:45094231-45094253 GAGAGTGAGAGGGGAGTCGAGGG - Intergenic
1184560785 22:45261834-45261856 GAGACTGCGTGGGGTGGTGACGG + Intergenic
1184649723 22:45914032-45914054 AGGAGGGAGTGGGGTGTGGAGGG - Intergenic
1185233581 22:49698607-49698629 CAGAGTGAGGGGAGTGCTGAGGG + Intergenic
950430351 3:12947445-12947467 AAGAGTGTGTGGGGTGAGGGTGG - Intronic
952241466 3:31533917-31533939 GAGAGTGAATGGCGTGTTGGAGG + Intronic
952968985 3:38638747-38638769 ATGAGTCTGTGAGGTGTTGATGG - Intronic
954924194 3:54217939-54217961 TAGAGAGAGAGGTGTGTTGAGGG + Intronic
957040198 3:75330412-75330434 ATCAATGAGTGGGGGGTTGAGGG - Intergenic
958004237 3:87792568-87792590 AAGGGAGAGAGGGGTGTTGAAGG + Intergenic
959416484 3:106081509-106081531 AAGAGTGAGTGAGGAGGTGCTGG + Intergenic
960395855 3:117136381-117136403 AAGTGTGAGGGTGGGGTTGAGGG - Intronic
962126824 3:132628489-132628511 AAGATTGATTGGATTGTTGAAGG - Intronic
962598539 3:136971483-136971505 AAGAGTGAGTGGGGTGGGAGTGG - Intronic
963255173 3:143137839-143137861 AGAAGTGAGGGAGGTGTTGATGG + Intergenic
963540879 3:146586665-146586687 AAGAGTGAGTGGTGAGTCGGAGG + Intronic
964729436 3:159849627-159849649 CAGAGTGAGTGGGGTCTGCAGGG + Intronic
964841458 3:160997726-160997748 AAGAGTGGGTGTGGTGGGGAAGG + Intronic
965992661 3:174838952-174838974 AAGAATGGTGGGGGTGTTGATGG - Intronic
966657619 3:182377227-182377249 AAGATTGAGTGGGGAGGTGAAGG + Intergenic
966727594 3:183121121-183121143 AAGAGGCAGTGGGGTCATGATGG + Intergenic
969611343 4:8229253-8229275 AAGGGTGAGTGGTGTGATGGCGG + Intronic
969763571 4:9210500-9210522 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969764171 4:9215249-9215271 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969764777 4:9219996-9220018 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969765384 4:9224739-9224761 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969765997 4:9229484-9229506 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969766608 4:9234228-9234250 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
969767824 4:9243722-9243744 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969769035 4:9253222-9253244 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969769647 4:9257967-9257989 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969770254 4:9262716-9262738 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969770869 4:9267462-9267484 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969771479 4:9272207-9272229 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969771849 4:9325008-9325030 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969772465 4:9329754-9329776 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969773082 4:9334501-9334523 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969773697 4:9339246-9339268 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969774312 4:9343991-9344013 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969774927 4:9348736-9348758 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969775543 4:9353481-9353503 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969776157 4:9358226-9358248 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969776771 4:9362972-9362994 ATGAGTGGGTGGGGTGTTCGCGG + Intronic
969777386 4:9367717-9367739 ATGAGTGGGTGGGGTGTTCGCGG + Intergenic
974989468 4:69066973-69066995 AGCAGGGAGTGGGGTGGTGATGG - Intronic
975532334 4:75413194-75413216 AAGATTGAGTGGTGTGTTGAAGG - Intergenic
976124478 4:81818941-81818963 AAGAGTGAGAAGGGAGTTGTTGG + Intronic
977342748 4:95780052-95780074 AAAAGTGAATGGGGTGTTAGCGG + Intergenic
978094851 4:104763498-104763520 AAAAGAGAGGGGGGTGGTGAGGG + Intergenic
978851987 4:113349587-113349609 AAGAGTGACTGTGCAGTTGAGGG - Intronic
979561357 4:122105524-122105546 GAAAGTGGGTGGGGTGTGGATGG + Intergenic
979845192 4:125500243-125500265 AATAGTGAATGGGGTGTCCATGG + Intergenic
980697343 4:136376927-136376949 AAGAGTAAGTGTGGTTTTGATGG - Intergenic
981831466 4:149006841-149006863 AAGGGGGAGGGGGGTGTTTAGGG + Intergenic
982333731 4:154210859-154210881 AAGGTTGAGTGGGTTGCTGAAGG + Intergenic
983334608 4:166375817-166375839 AAGAGAGGTTGGGGTGCTGAAGG + Intergenic
983591151 4:169412867-169412889 AAGACTGAGAGGGGTGGTGGGGG + Intronic
984342084 4:178470117-178470139 TAGAGTGAGTAGGGACTTGAGGG + Intergenic
984728918 4:183047310-183047332 GAGAGAGAATGGGGTGTTGCTGG + Intergenic
986341220 5:6791029-6791051 AAGAGTGAGTGGACTGACGAGGG - Intergenic
986812648 5:11376598-11376620 CAGAATGAGTGGGGGGTTGGGGG + Intronic
987839437 5:23203891-23203913 CAGAGTGTGTGGGATTTTGATGG + Intergenic
988646720 5:33102883-33102905 CATTGTCAGTGGGGTGTTGAAGG + Intergenic
989645615 5:43629145-43629167 AAGAGTGGGAGGGGGGGTGAGGG - Intronic
990112836 5:52349255-52349277 AAGGGTGTGGGGGGTGGTGAGGG - Intergenic
991272809 5:64805660-64805682 AAGACTGAGTTGGGAGTTTAAGG - Intronic
993098774 5:83511114-83511136 CCGAGTGAGTGGGGTGTTGGGGG + Intronic
993877150 5:93321099-93321121 ATCTGTGAGTGAGGTGTTGATGG - Intergenic
995557214 5:113341979-113342001 AAGTGTGAGTGGGGGGGTGAGGG - Intronic
995753656 5:115478942-115478964 AAGAGTGGGAGGGGAGGTGAGGG - Intergenic
995887784 5:116915703-116915725 AAGTGGGTGTGGGGTGCTGAAGG + Intergenic
996183662 5:120451086-120451108 AAGGGTGAGTGGAGTGCTGAGGG + Intergenic
997065955 5:130558902-130558924 AATTGTCAGTGGGATGTTGAGGG - Intergenic
999716573 5:154365745-154365767 AAGGCTGAGTGTGGTGTGGAAGG - Intronic
1001536753 5:172503551-172503573 AAGAGTGCGGGGGGTGGTGGGGG - Intergenic
1001742193 5:174062648-174062670 AAGAGAGGGTGGGGTGCTGATGG + Intronic
1002679043 5:180946615-180946637 AAGAGAGAATGGGGAGTTGTTGG + Intronic
1003640873 6:7874117-7874139 AAGAGTGAGTGGAAGGCTGATGG + Intronic
1003676381 6:8208429-8208451 AAGGGTAAGTGGGGTGTGAACGG + Intergenic
1003962981 6:11226217-11226239 AAGATGGAGGGGGGTGTTGTTGG + Intronic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005692625 6:28322100-28322122 CAGGGTGAGTGGGGTGATGCAGG - Intergenic
1005816856 6:29560116-29560138 CAGAGAGATTGGGGTGTTCAAGG - Intronic
1005876377 6:30013209-30013231 GGGGGTGAGTGGGGTGTTGCTGG + Intergenic
1006118814 6:31791823-31791845 CAGAGTGGGTGGGGTGGGGAAGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006406819 6:33850254-33850276 ATGAGTGGGTGCTGTGTTGAAGG + Intergenic
1007349825 6:41262582-41262604 TACCGTGAGTGGGGTGTTGAAGG - Intergenic
1007782991 6:44264867-44264889 AAGAGCGAATGGGGACTTGAAGG + Intronic
1008862753 6:56169751-56169773 AAGTGTTAGTGGAGTGTGGATGG - Intronic
1011003746 6:82620848-82620870 AATAGTGAGGGGGGTGTCAAGGG + Intergenic
1011083465 6:83513191-83513213 AAAAGTGTGTGGGGTGGTGATGG + Intronic
1011801995 6:91027501-91027523 AAGAGTGAGTGGAGAATTTATGG - Intergenic
1012460612 6:99456206-99456228 AAGAGTGAGTGGGGTTGTAGTGG + Intronic
1014677423 6:124384421-124384443 AAGAATAAGTGGGGTGATGTAGG + Intronic
1015754409 6:136593051-136593073 ATGAGTGAGTGGGATGCTGTAGG + Intronic
1016224990 6:141723913-141723935 AACTTTGTGTGGGGTGTTGAAGG + Intergenic
1017411925 6:154176766-154176788 AAGAGTCAGTGGGAGCTTGATGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1019174532 6:170153550-170153572 CAGAGCTAGTGGGGTGTTGTGGG - Intergenic
1020004837 7:4776997-4777019 TATAGTGAGTGAGGTCTTGAAGG + Intronic
1022044805 7:26614127-26614149 CAGAGTGGCTGGGGGGTTGAAGG + Intergenic
1022457181 7:30567701-30567723 TAGAGAGAGTGGGATGTTGAAGG - Intergenic
1022528791 7:31054188-31054210 AAGTGTGTGTGGGGTGACGATGG + Intronic
1023081790 7:36533264-36533286 AAGAGTGTGAGGAGTGTTAATGG - Intronic
1023874897 7:44281631-44281653 AAGGGTGATTGGGGTGCTGGGGG - Intronic
1023931441 7:44708790-44708812 AAGAGTGGTTGGGGTGGGGAGGG - Exonic
1024703379 7:51928814-51928836 AAGAGTTAGTGAGGTCATGATGG + Intergenic
1025230565 7:57201200-57201222 GGGAGTGAGTGTGTTGTTGATGG + Intergenic
1026184628 7:68072926-68072948 GGGAGTGGGTGGGGTGTTTAGGG + Intergenic
1028225605 7:88249073-88249095 TAGTGAGAGTGGGCTGTTGAAGG + Intergenic
1028744999 7:94317977-94317999 AAGAGTGAGGGGAGTGCTGCAGG - Intergenic
1028996376 7:97104963-97104985 CAGAGGGAGTGGGGTCCTGAAGG + Intergenic
1029414256 7:100433134-100433156 TACAGTGAGTTGGGTGTTGGGGG + Exonic
1032693776 7:134316284-134316306 AAGAGAGAGTGGTTTGGTGAAGG + Intronic
1033469594 7:141632941-141632963 AGGAGTGAATGTGGTGTTGGGGG + Intronic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1034055713 7:148032832-148032854 AAGAGTGTGTTTTGTGTTGAGGG - Intronic
1034235073 7:149560368-149560390 GAGCGTCAGTGGGGTCTTGAAGG + Intergenic
1035404046 7:158587179-158587201 ATGAATGAGTGGGGGGTTTAGGG - Intronic
1035469389 7:159100010-159100032 AAGACTGAGTTGAGTGTTGGGGG - Intronic
1035562483 8:616605-616627 AAGAGTGAGTGGGGAGAGGGAGG + Intronic
1036255887 8:7206397-7206419 ATGAGTGGGTGAGGGGTTGAAGG + Intergenic
1036347059 8:7973388-7973410 ATGGGTGGGTGGGGTGTTCACGG - Intergenic
1036361600 8:8081102-8081124 ATGAGTGGGTGAGGGGTTGAAGG - Intergenic
1037480892 8:19304085-19304107 GAGAGAGAGTGGGGTGATGGGGG + Intergenic
1037625894 8:20606770-20606792 AAGGGTGTGTGGGGGGGTGAGGG - Intergenic
1037808359 8:22070812-22070834 AAGGGTGTGGGGGGTGGTGATGG - Intronic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1038914874 8:32009910-32009932 AAAAGTGAGTGGGGTGGGGAGGG - Intronic
1039444817 8:37622551-37622573 AAGAGTGTGTTGTGTGTTCAGGG - Intergenic
1040389103 8:46934230-46934252 GACAGTGAGTGGAGTGTTTATGG - Intergenic
1043813077 8:84766896-84766918 AACAGTGCGTGGGGTGCTGAAGG + Intronic
1045253946 8:100503482-100503504 AAGAGTGAGTGTGTTGGGGAGGG + Intergenic
1045425230 8:102059755-102059777 GACAGGGAGTGGGGTGTTCAGGG - Intronic
1045660239 8:104429560-104429582 ATGAGGAAGTCGGGTGTTGAGGG + Exonic
1048353377 8:133633959-133633981 AAGAGAGAGTTGGGGGGTGAGGG + Intergenic
1049542182 8:143213663-143213685 TAGGGTGAGTAGGGTGTTCAGGG + Intergenic
1051629107 9:19126622-19126644 AAGAGGGAGTGGGGTTGTGTGGG - Intronic
1051872086 9:21749627-21749649 AAGAGGTACAGGGGTGTTGAAGG - Intergenic
1052023819 9:23553623-23553645 AAGAGTGAGTAGTGATTTGAAGG + Intergenic
1052385328 9:27816377-27816399 AAGAGTGTGTTGGGTAATGAGGG + Intergenic
1056311248 9:85343136-85343158 AAGTGTGTGTGGAGTGGTGATGG - Intergenic
1057468690 9:95338566-95338588 AAGGGTGAGTCAGGTGTGGAAGG - Intergenic
1058099142 9:100899351-100899373 AAAATAGAGTGGGGTGTTGGGGG - Intergenic
1059879119 9:118670137-118670159 GAGAGTGAGTGGGTGATTGAGGG + Intergenic
1060667380 9:125439933-125439955 AAGAGTGAGCGGGCTTTTGAGGG + Intronic
1061502715 9:131013017-131013039 GGGAGTCAGTGGGGTGTTGGGGG + Intronic
1061731618 9:132619022-132619044 AGGAGTGAGTGGGCTGTTCCAGG + Intronic
1062510709 9:136904119-136904141 AAATGTGTGTGGGGGGTTGAAGG - Intronic
1062555941 9:137113528-137113550 AAGAGGAAATGGGGTGTTGGGGG - Intronic
1186964547 X:14772974-14772996 AAAAGTAAGTGGGGTGGTGGTGG - Intergenic
1187473310 X:19588431-19588453 AGGAGTGAGTGTGAGGTTGAGGG - Intronic
1188793372 X:34433108-34433130 AAGAGAGAGTGGGGTGGGGAAGG + Intergenic
1189330331 X:40140990-40141012 AAGAGTGAGTGGGTTGCCAATGG - Intronic
1190109296 X:47579566-47579588 GAGAGTGGGAGGGGTGTTCATGG - Intronic
1190157727 X:48007253-48007275 GAGAGTGAGTGGGGTGAAGAAGG + Intronic
1190173499 X:48130138-48130160 GAGAGTGAGTGGGGTGAAGAAGG + Intergenic
1192151505 X:68715540-68715562 TAGAGTGACTGGGTGGTTGAGGG - Intronic
1195026356 X:100881532-100881554 AATAGTGAGTGGGGAGCTGGAGG - Intergenic
1195352359 X:104007278-104007300 AAGAGAGAGTGGGCTCCTGAAGG + Intergenic
1195523372 X:105856743-105856765 ATCAGTGAGTGGGTTTTTGAGGG + Intronic
1196804500 X:119572605-119572627 AAGAGTGAGAGGGATGTGGTGGG + Intergenic
1197243941 X:124149005-124149027 AAGAGTGTGTGGGGTTGGGAAGG + Intronic
1197640025 X:128957508-128957530 ATGAGTTAGTGGGGTGGTGATGG - Intergenic
1200399918 X:156013412-156013434 GAGAGTGGGAGGGGTGTGGACGG + Intergenic