ID: 906483331

View in Genome Browser
Species Human (GRCh38)
Location 1:46215755-46215777
Sequence TACAGGCATGTACCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 304}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906483331_906483338 8 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483338 1:46215786-46215808 ACTTAGGAGGCTGAGGCAGGAGG 0: 490
1: 11288
2: 25645
3: 77460
4: 142039
906483331_906483332 -8 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483332 1:46215770-46215792 TGCCTGTAGTCCAGCTACTTAGG 0: 75
1: 411
2: 1076
3: 2098
4: 12126
906483331_906483337 5 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483337 1:46215783-46215805 GCTACTTAGGAGGCTGAGGCAGG 0: 3422
1: 159496
2: 261565
3: 182801
4: 170342
906483331_906483339 9 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483339 1:46215787-46215809 CTTAGGAGGCTGAGGCAGGAGGG 0: 19
1: 451
2: 1485
3: 3742
4: 6453
906483331_906483341 25 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483341 1:46215803-46215825 AGGAGGGTTGCTTGAGCTCAGGG 0: 1
1: 32
2: 351
3: 1378
4: 3717
906483331_906483334 -5 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483334 1:46215773-46215795 CTGTAGTCCAGCTACTTAGGAGG 0: 15
1: 372
2: 1284
3: 1867
4: 2210
906483331_906483340 24 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483340 1:46215802-46215824 CAGGAGGGTTGCTTGAGCTCAGG 0: 11
1: 869
2: 7807
3: 28885
4: 101155
906483331_906483342 26 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483342 1:46215804-46215826 GGAGGGTTGCTTGAGCTCAGGGG 0: 2
1: 60
2: 582
3: 1712
4: 4336
906483331_906483335 1 Left 906483331 1:46215755-46215777 CCAGGTGTAGGTACATGCCTGTA 0: 1
1: 0
2: 4
3: 50
4: 304
Right 906483335 1:46215779-46215801 TCCAGCTACTTAGGAGGCTGAGG 0: 376
1: 15970
2: 211366
3: 301154
4: 188203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906483331 Original CRISPR TACAGGCATGTACCTACACC TGG (reversed) Intronic
900506962 1:3034425-3034447 CACAGGCATGTACACACACGTGG + Intergenic
901505437 1:9682377-9682399 TACAGGCATGCCACTACACTTGG + Intronic
901702308 1:11052203-11052225 TACAGGCATGAGCCACCACCCGG + Intergenic
901925314 1:12562243-12562265 TACAGGCATGTCACCACTCCTGG - Intergenic
902831626 1:19017569-19017591 TACAGGCATGAGCCACCACCCGG - Intergenic
902962765 1:19976571-19976593 TAGAGGCATGTATCTTCAGCAGG - Intronic
904371864 1:30052860-30052882 TACAGGCAAGTCACCACACCCGG + Intergenic
904588494 1:31593739-31593761 TACAGGCATATCACCACACCTGG + Intergenic
904628893 1:31826715-31826737 TACAGGCATGAGCCACCACCCGG + Intergenic
905077131 1:35282493-35282515 TACAGGTATGTACCTAGAAATGG + Intronic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
906916228 1:50013769-50013791 TCCAGTCATGTAACTACCCCAGG - Intronic
908370821 1:63475412-63475434 TACAGGTATGTTACTACCCCTGG - Intronic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
909869518 1:80722441-80722463 CAGAGGCATGTACCTGCCCCAGG + Intergenic
910403272 1:86857763-86857785 TACAGGCATGCAATTACATCAGG - Intergenic
910414958 1:86987768-86987790 TACAGGCATGTTCCTGCTACAGG - Intronic
911414606 1:97555893-97555915 TACATGTATGTACCTACATATGG - Intronic
911463698 1:98223890-98223912 TACAGACATGAGCCCACACCTGG - Intergenic
911498124 1:98655222-98655244 TCCAGGCATGGACACACACCAGG - Intergenic
914763062 1:150614626-150614648 TACAGGCATGAGCCACCACCTGG + Intronic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915435067 1:155898389-155898411 TACAGGCATGAGCCACCACCTGG - Intronic
916723244 1:167501193-167501215 TACAGGCATGCCACCACACCTGG + Intronic
917331978 1:173890137-173890159 TACAGGCGTGTGACCACACCTGG + Exonic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
919704095 1:200659826-200659848 TACAGGCATGCCACCACACCTGG + Intronic
921443308 1:215214683-215214705 TACAGGCATGCCACCACACCAGG - Intronic
921827594 1:219691242-219691264 TACAGGCATGAGCTTGCACCTGG - Intronic
923172860 1:231432974-231432996 TACAGGCATGCACCACCACCTGG - Intergenic
923753084 1:236764977-236764999 TACAGGCATGCAACCAAACCCGG - Intergenic
1063442489 10:6084250-6084272 TACAGGCATAAGCCTGCACCTGG - Intergenic
1064546257 10:16452891-16452913 TACAGGCATGCCCTCACACCCGG + Intronic
1064983315 10:21185637-21185659 TACAGGCATGCCACCACACCTGG + Intergenic
1065536746 10:26722230-26722252 TATAGGCATATACTTACATCAGG + Intronic
1066089423 10:32003097-32003119 TACAGGCATGCACCACCTCCTGG - Intergenic
1066170178 10:32834393-32834415 TACAAGCATATCCATACACCAGG - Intronic
1067111737 10:43406233-43406255 TGCAGGCATCTACCCCCACCGGG + Intronic
1069520959 10:69120839-69120861 TACAGGCATGCCCCACCACCTGG + Intergenic
1070293936 10:75142708-75142730 TACAGGCATGAGCCACCACCCGG + Intronic
1071375646 10:84999700-84999722 TACAGGCACGTACATGCAACTGG - Intergenic
1071555259 10:86596580-86596602 TACAGGCATGTGCCACCAACGGG - Intergenic
1074074648 10:110111770-110111792 TACAGGCATGCGCCACCACCCGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1075056953 10:119226120-119226142 TACAGGCATGAGCCAGCACCCGG + Intronic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1075471489 10:122693629-122693651 TACAGGCATGTCACCACACCCGG + Intergenic
1075812957 10:125240388-125240410 TACAGGCATGCCACCACACCTGG + Intergenic
1078198681 11:9159459-9159481 TACAGGCATGCACCACCACCTGG + Intronic
1079997991 11:27316584-27316606 TACAGGCATGTAGCCATGCCCGG - Intergenic
1082012612 11:47460428-47460450 TACAGGCATGCACCACCACGCGG + Intergenic
1082017116 11:47498262-47498284 CACAGGCATGCACCACCACCTGG - Intronic
1083485908 11:62982907-62982929 TACAGGCATGCAGCTGCTCCAGG - Intronic
1083743858 11:64724551-64724573 TGCACACAGGTACCTACACCAGG + Intergenic
1083848383 11:65350522-65350544 TACAGGCATGCCACCACACCCGG + Intronic
1084749598 11:71195842-71195864 GGCAGGCAGGTACCAACACCAGG - Intronic
1085239372 11:75039879-75039901 TACAGGCATGCACCACCACATGG + Intergenic
1086624163 11:88925766-88925788 TACAGGCATGTACCACACCCAGG - Intronic
1087264212 11:96043019-96043041 TACAGGCATGAGCCACCACCCGG + Intronic
1087466853 11:98518694-98518716 TACAGCCAAATACCTCCACCAGG - Intergenic
1087606331 11:100382919-100382941 TAAAGGCATTTATCTACAACAGG + Intergenic
1088251130 11:107861722-107861744 TACAGGCATGTGCCCATGCCCGG + Intronic
1088281871 11:108143161-108143183 TACAGGCATGCTACCACACCTGG - Intronic
1090399178 11:126437647-126437669 TACAGACATGTACATACACATGG + Intronic
1090715609 11:129427813-129427835 GCCAGGCATGTACCCACTCCAGG - Intronic
1091278530 11:134368900-134368922 TCCAGGCAAGTACCTTCTCCAGG - Intronic
1091927125 12:4361890-4361912 TACAGGCATGAGCCACCACCCGG + Intergenic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1094452849 12:30600863-30600885 TACAGGCATTTTCCCAGACCTGG + Intergenic
1095711985 12:45299709-45299731 TACAGGCGTGCCACTACACCTGG - Intronic
1096125779 12:49118531-49118553 CAAAGGCATGTACCACCACCAGG + Intergenic
1096287934 12:50316367-50316389 TACAGGCGTGCACCAACTCCTGG - Intergenic
1096334383 12:50742254-50742276 TACAGGCATGCCACCACACCTGG - Intronic
1097921055 12:65074540-65074562 TACAGGCATGAGCCAGCACCTGG - Intronic
1100498633 12:95151409-95151431 TACAGGCATGCCACCACACCTGG + Intronic
1100641045 12:96482617-96482639 TACAGGCATGCACCACCACGGGG - Intergenic
1101137030 12:101754284-101754306 TACAGGCATGCCACCACACCCGG - Intronic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1103818209 12:123676001-123676023 TACAGGCATGAGCCACCACCTGG - Intronic
1104009451 12:124919145-124919167 TACAGGCATGCACCACCGCCTGG - Intergenic
1105702776 13:22945541-22945563 ACCAGGCATGTTCCTCCACCTGG - Intergenic
1105855415 13:24367345-24367367 ACCAGGCATGTTCCTCCACCTGG - Intergenic
1106078605 13:26482196-26482218 TACAGGCGTGCAGCTGCACCCGG - Intergenic
1106332637 13:28753695-28753717 TACAGGCATGTGAGTACGCCAGG - Intergenic
1106498314 13:30303422-30303444 TTCAGGCATGTGGCCACACCCGG - Intronic
1107021314 13:35755368-35755390 CACAGGCATGTTCCTAAACTTGG - Intergenic
1107209392 13:37835008-37835030 TACAGGCATGAACCACCAGCAGG + Intronic
1107526628 13:41239123-41239145 TACAGGCATGCCACTATACCTGG - Intronic
1109955496 13:69559841-69559863 TACAAGCTTGTAACCACACCTGG + Intergenic
1111057027 13:82964669-82964691 TACAGGCATGAGCCACCACCAGG - Intergenic
1111670200 13:91320444-91320466 TACGTGCACATACCTACACCAGG - Intergenic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1115269495 14:31536164-31536186 TACAGGCATGTGCCGTCACTGGG + Intronic
1115591152 14:34866345-34866367 TACAGGCATGTGCCACCACGTGG - Intronic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116377088 14:44216619-44216641 TACAGGCATGCCACCACACCTGG - Intergenic
1117054000 14:51891720-51891742 TACAGCTATGTACATCCACCTGG - Intronic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117306482 14:54480996-54481018 GACAGGTATTTACCAACACCTGG + Intronic
1117349656 14:54869012-54869034 TACAGGCATGCACCACCACCTGG + Intronic
1118597865 14:67449919-67449941 TACAGGTATGTGCCTCCACAAGG - Intronic
1119197858 14:72731023-72731045 TACAGGCATGTGCCACCATCTGG - Intronic
1119663933 14:76470826-76470848 TACAGGCATGTGCCAACATGTGG + Intronic
1119683232 14:76608678-76608700 TACAGGCATGCCACCACACCTGG - Intergenic
1120931685 14:89855198-89855220 TACAGGCATGCCACCACACCTGG - Intronic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122844410 14:104483786-104483808 ACCAGGCATGTCCCTCCACCTGG - Intronic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125545818 15:40503949-40503971 TACAGGCATGACCCACCACCCGG - Intergenic
1125806752 15:42499866-42499888 TACAGGCATGAACCACCGCCCGG - Intronic
1126317216 15:47383039-47383061 TACAGGCATGAGCCACCACCTGG + Intronic
1127753022 15:62064736-62064758 TACAGGCATGCACCACTACCTGG - Intergenic
1127825248 15:62697246-62697268 TATAGGCATGTACCACCACTCGG + Intronic
1128842393 15:70860553-70860575 TACAGGCATGCCACCACACCTGG + Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129403960 15:75302150-75302172 TACAGGCAAGTGCCACCACCAGG + Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129512203 15:76132652-76132674 TACAGGCATGCGCCACCACCTGG - Intronic
1129775297 15:78232823-78232845 TACAGGCACGTACCACCACCTGG + Intronic
1131085481 15:89572482-89572504 TACAGGCATGAGCCACCACCCGG - Intergenic
1134026692 16:10959530-10959552 TACAGGCATGCACCACCACGTGG + Intronic
1134438257 16:14281524-14281546 TACAGGCATGTGCCACCACGTGG - Intergenic
1134584782 16:15400489-15400511 TACAGGCACGCTACTACACCTGG + Intronic
1135028502 16:19017542-19017564 TACAGGCATGAACCACCACCTGG - Intronic
1138380239 16:56595707-56595729 TACAGGCATGTACCACCACCTGG - Intergenic
1138566385 16:57836253-57836275 TACAGGCATTCCACTACACCCGG + Intronic
1138814432 16:60188019-60188041 TACAAGCATGCAACCACACCAGG + Intergenic
1139428368 16:66897107-66897129 TACAGGCGTGCACCATCACCTGG + Intergenic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139646358 16:68333911-68333933 TACAGGCATGCACCACCACCTGG + Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140795319 16:78432246-78432268 TACAGGCATGCCACCACACCTGG + Intronic
1141003863 16:80334092-80334114 TACAGGCGTGAACCACCACCTGG - Intergenic
1142587568 17:983233-983255 TACAGGCATGAGCCACCACCCGG + Intergenic
1146048023 17:29526554-29526576 TACAGGCATGCACCACCACCTGG + Intronic
1146652811 17:34616835-34616857 CACAGGCATGTCCCCACCCCAGG - Intronic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1149287783 17:55185144-55185166 TACAGGCATGAACCACCACCTGG + Intergenic
1149789395 17:59464017-59464039 TACAGGCATGCGCCACCACCTGG - Intergenic
1150712723 17:67545433-67545455 TACAGGCATGCCACCACACCTGG - Intronic
1150773280 17:68059735-68059757 TACAGGCATGCACCACCACACGG + Intergenic
1150777068 17:68089723-68089745 TACAGGCATGCGCCGCCACCTGG + Intergenic
1151458077 17:74238537-74238559 TACAGGCATACAACCACACCTGG + Intronic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1152175701 17:78785800-78785822 TACAGGCATGAGCCTGCTCCTGG + Intergenic
1152664889 17:81562089-81562111 TACAGGCGTGCACCCACGCCTGG - Intronic
1153280179 18:3407577-3407599 TACAGGCATGAGCCCACGCCTGG - Intergenic
1153753811 18:8260437-8260459 TACAGGCATGAACCACCTCCTGG + Intronic
1154131524 18:11740457-11740479 TACATGCATGTAGATACACAGGG + Intronic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1154307458 18:13241068-13241090 TACAGGCATGTGCCACTACCCGG + Intronic
1159863463 18:73676117-73676139 TAGATGCATGTACCACCACCTGG - Intergenic
1160203381 18:76813463-76813485 TACAGGCATGAGCCAACATCCGG + Intronic
1160932897 19:1578906-1578928 TACAGGCATGAGCCTCTACCTGG - Intronic
1161095116 19:2385708-2385730 TACAGGCATGCCACCACACCCGG - Intergenic
1161624960 19:5320984-5321006 TACAGGCATGAGCCAGCACCGGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1162047126 19:8007451-8007473 TACAGGCATGAGCCACCACCCGG + Intronic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1163771640 19:19194664-19194686 TATAGGCATGCAACCACACCTGG + Intronic
1163794042 19:19325752-19325774 TACAGGCATGCCACCACACCCGG + Intronic
1165188091 19:34039329-34039351 TACAGGCATGCACCACTACCTGG + Intergenic
1165251447 19:34539699-34539721 TGCAGGCATATGCCTACACCTGG + Intergenic
1165503410 19:36208340-36208362 CACAGGCATGCCACTACACCTGG + Intronic
1166040818 19:40201631-40201653 TACAGGCATGCCACCACACCAGG + Intronic
1166129348 19:40736778-40736800 TATAGGCATGATCCCACACCTGG + Intronic
1166890725 19:45991027-45991049 TACAGGCATGCCACTGCACCTGG + Intergenic
1166935957 19:46332839-46332861 TATAGGTGTGCACCTACACCCGG - Intronic
1167202438 19:48075322-48075344 TACAGGCACGCACCACCACCAGG + Intronic
1168397693 19:56063062-56063084 TACAGGCATGAACCACCACACGG - Intergenic
925091419 2:1159082-1159104 TACACGCATGCACATACACACGG - Intronic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
926175882 2:10591726-10591748 TGCAGGCATGAACCACCACCTGG - Intronic
926753453 2:16217941-16217963 TACAGGCATGAACCACCGCCTGG - Intergenic
927808179 2:26166605-26166627 TATAGGCAGGTACCACCACCTGG + Intergenic
927977298 2:27348526-27348548 TACAGGCATGAGCCTGTACCTGG - Intronic
928501974 2:31906110-31906132 TACAGGCACACACCCACACCTGG + Intronic
930087432 2:47507733-47507755 TACAGGCGTGAGCCTCCACCTGG + Intronic
930156028 2:48108399-48108421 TACAGGCATGCCACTGCACCCGG + Intergenic
931431327 2:62211211-62211233 TACAGGCATGTCACCACACCTGG - Intronic
932550394 2:72763936-72763958 TACAGGCATGCCACCACACCCGG - Intronic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
933406015 2:81860516-81860538 TACAGGCATAAGCCCACACCTGG - Intergenic
936975796 2:118221081-118221103 TAAAGGGATCTACCTACACAAGG - Intergenic
937270251 2:120645355-120645377 TACAGGCTTGAGCCCACACCCGG + Intergenic
939977890 2:148740353-148740375 TACAGGCAGGCACCTGTACCTGG + Intronic
941321667 2:164063257-164063279 TACAGGCATGTGCCACCACACGG + Intergenic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
944242038 2:197495732-197495754 TACAGGCATGTACCTATGCTTGG + Intronic
944260246 2:197668550-197668572 CAGAGGCATGTACCTGCACCTGG + Intronic
944302482 2:198139473-198139495 TACAGGCATCTGCCTACTTCAGG + Intronic
944852938 2:203738586-203738608 CACAGGCATGTTCCTACCTCAGG + Exonic
946210106 2:218140758-218140780 TACAGGCGTGAGCCCACACCTGG - Intergenic
948406070 2:237720523-237720545 TACAGGCATGACACCACACCTGG + Intronic
948907422 2:240986493-240986515 TCCAGGCCTGTCCCTACAGCTGG - Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1169485662 20:6029500-6029522 TACAGGCATGCCACCACACCTGG + Intronic
1170777165 20:19385910-19385932 TACAGGCATGAGCCACCACCTGG + Intronic
1171544998 20:25993330-25993352 TACAGGCATGATCCAGCACCTGG - Intergenic
1171967193 20:31539518-31539540 TACAGGCATGAGCCACCACCTGG - Intronic
1172723923 20:37021716-37021738 TACAGGCATGAGCCTGCGCCCGG + Intronic
1172796525 20:37543226-37543248 TACTGGCATGTGCTGACACCTGG - Intergenic
1172865479 20:38093593-38093615 TACAGGCATCTACCCACGCCTGG + Intronic
1175829460 20:61954090-61954112 TACAGGCATGCACCACCACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178879059 21:36434177-36434199 TACAGGCATGAGCCACCACCCGG + Intergenic
1181025878 22:20127418-20127440 GACAGGCCTGGACATACACCCGG - Intergenic
1181087110 22:20445902-20445924 TACAGGCATGCAACCACACCTGG + Intronic
1181160265 22:20956074-20956096 TACAGGCATGAGCCACCACCTGG + Intergenic
1181949838 22:26545934-26545956 TATAGGCAGGTACCATCACCTGG - Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1183755308 22:39756473-39756495 TACAGGCATGTCACCACACCTGG + Intronic
949950037 3:9221394-9221416 TACAGGCGTGCACCACCACCAGG - Intronic
950273296 3:11637033-11637055 TACAGGCATCTCCCTATACAGGG + Intronic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
953043960 3:39279015-39279037 TATAGGCATGTACCACCGCCCGG - Intronic
953729537 3:45435107-45435129 TACAGGCATGTATCCCCACAGGG + Intronic
953930757 3:47004653-47004675 CACTGGCAGGTACCTACACTTGG - Intronic
955184126 3:56698995-56699017 CACAGGCATGCACCACCACCCGG + Intergenic
955364689 3:58300858-58300880 TACAGGCATGCACCATCACACGG - Intergenic
957494697 3:80976972-80976994 TAGAGGAATGTAACTACATCAGG - Intergenic
958156564 3:89762447-89762469 TGCAGGCATTTTCCCACACCAGG - Intergenic
958734709 3:97995117-97995139 TACAGGCATGCACCACCACCTGG + Intronic
958852816 3:99349498-99349520 TACAGGCACATACCCACATCTGG - Intergenic
959383569 3:105673342-105673364 TACAGGCATGAGCCTGTACCTGG + Intronic
959527319 3:107391602-107391624 TACAGGCATGAGCCACCACCAGG + Intergenic
960315311 3:116168923-116168945 TACAGGCATGTGCCTAGCCCTGG - Intronic
961589109 3:127962178-127962200 TACAGGCATGTCCCTCCTTCCGG + Intronic
961811472 3:129524202-129524224 TACAGGCATGCCACCACACCTGG - Intergenic
963238111 3:142975122-142975144 TACAGGCAAGTGCCACCACCTGG - Intronic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965134092 3:164739834-164739856 TGCAGGCATTCAGCTACACCCGG - Intergenic
965588811 3:170343233-170343255 TACAGGCATGCCACCACACCCGG + Intergenic
966167044 3:177031472-177031494 TACAGACATGTCACCACACCTGG + Intronic
967033134 3:185626932-185626954 TACAGGCATGCACCACCACGTGG - Intronic
967246203 3:187489650-187489672 TACAGGTGTGTACCACCACCTGG + Intergenic
968250276 3:197203992-197204014 TAAAGACAAGCACCTACACCGGG - Intronic
968322260 3:197780144-197780166 TACAGGCACACACCCACACCTGG + Intronic
969273695 4:6120307-6120329 TACAGCCATATTCCTACCCCAGG + Intronic
969898359 4:10325693-10325715 TTCAGGAATGGACCTACAGCAGG + Intergenic
971688860 4:29806668-29806690 AATAGGCATGTAGCAACACCAGG - Intergenic
972299300 4:37770156-37770178 TACAGGCATTTACAAAGACCTGG - Intergenic
973666507 4:53164649-53164671 TACAGGCATGCCACCACACCCGG - Intronic
979020736 4:115493971-115493993 TACAGGCATGTCACCACGCCTGG + Intergenic
980041466 4:127945456-127945478 TACAGGCATGTGCCACCACGTGG + Intronic
981523366 4:145688058-145688080 CACAGGCATATACCACCACCTGG - Intronic
982010052 4:151097882-151097904 TACAGGCATGAGCCACCACCTGG + Intergenic
982528620 4:156509694-156509716 TACAGGCATGTGCCACCACACGG - Intergenic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
985038315 4:185863117-185863139 TAAAGGCACGTCCCTCCACCTGG + Intronic
987671471 5:21015457-21015479 CAAAAGCTTGTACCTACACCCGG - Intergenic
991661175 5:68952169-68952191 TACAGGCATGCCACCACACCAGG + Intergenic
991720117 5:69487485-69487507 TACAGGCACGCACCCACAACTGG - Intergenic
992707716 5:79414221-79414243 TACAGGCATGCAACCATACCTGG + Intronic
992902156 5:81307852-81307874 TACAGGTGTGTACCACCACCTGG - Intronic
994698671 5:103104834-103104856 GACAAGCATATACCTACAACAGG + Exonic
996549148 5:124712004-124712026 TATAGGCACACACCTACACCCGG - Intronic
997118958 5:131154812-131154834 TACAGGCGTGAGCCCACACCTGG + Intergenic
997634496 5:135394972-135394994 GACATTCATGTACATACACCTGG + Intronic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998448329 5:142215565-142215587 TACAGGCATGCTACAACACCTGG - Intergenic
998469010 5:142368786-142368808 TACAAGCATGTCACCACACCTGG + Intergenic
999199273 5:149804529-149804551 TACAGGCATGCTCCACCACCTGG - Intronic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
1000924785 5:167180248-167180270 TACAGGCATGTGCCACCACACGG + Intergenic
1001873330 5:175177454-175177476 TACAGGCATGCCACCACACCTGG - Intergenic
1004654994 6:17651161-17651183 TACAGGCATGCCACTGCACCTGG - Intronic
1005587550 6:27291493-27291515 TCCCGGCATGTACATACACTGGG + Intronic
1005620475 6:27615320-27615342 TACAGGCATGAGCCACCACCCGG + Intergenic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007007293 6:38377577-38377599 TACAGGCATGCACACACACACGG + Intronic
1007610899 6:43148110-43148132 TACAGGCATGCCCCCACGCCCGG - Intronic
1007930848 6:45689270-45689292 TACAGGCATGCCACCACACCTGG + Intergenic
1008330162 6:50235743-50235765 TACAGGCATGTGCCACCACACGG - Intergenic
1011590650 6:88967133-88967155 TACAGGCACGTCACCACACCTGG - Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013083800 6:106837611-106837633 TGCAGGCATGTACCACCACCTGG + Intergenic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1014515341 6:122371212-122371234 TACAGGCATGAACCAACATGTGG - Intergenic
1014578689 6:123107457-123107479 TACAGGCATTTTCCCACACCTGG - Intergenic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1018502682 6:164428354-164428376 TTCAGGGATGTACCTAGCCCTGG + Intergenic
1019760048 7:2804400-2804422 CACACGCGTGTACATACACCGGG + Intronic
1019842725 7:3464378-3464400 TACAGGCATGCCACTACACTGGG - Intronic
1020202930 7:6094312-6094334 TACAGGCATGCACCAGCACCTGG + Intergenic
1021092085 7:16495872-16495894 TACAGGCGTGCACCACCACCTGG + Intronic
1022578378 7:31521872-31521894 TACAGGCATGGACCTCCACATGG + Intronic
1023974842 7:45021113-45021135 TACAGGCATGTCGCCACACCTGG - Intronic
1024712233 7:52029102-52029124 AACTGGCATGAACCTAAACCAGG - Intergenic
1024946223 7:54809742-54809764 TACAGGCATGACCCCACACCTGG + Intergenic
1025931289 7:65996729-65996751 TACAGGCATGCACCACCACACGG + Intergenic
1026838370 7:73653287-73653309 TACAGGTGTGTACCACCACCCGG + Intergenic
1029422808 7:100479743-100479765 TACAGGCATGAGCCACCACCGGG - Intergenic
1030142169 7:106316272-106316294 TACAGGCATGAGCCACCACCTGG - Intergenic
1031611788 7:123836751-123836773 TACAGGCATGAGCCACCACCTGG - Intronic
1032145342 7:129374664-129374686 TACAGGCATGTGCCACCACGCGG - Intronic
1032284504 7:130530636-130530658 GACAGGCAGGTACCTTCCCCTGG + Intronic
1032748129 7:134808381-134808403 TACAGGCATGAGCCACCACCTGG + Intronic
1037740207 8:21602779-21602801 CACTGGCATGTACCAACACGGGG - Intergenic
1038314584 8:26472989-26473011 TACAGGCATGCACCTCCATGCGG - Intronic
1038634853 8:29277508-29277530 TACAGGCATGAGCCACCACCTGG + Intergenic
1038915213 8:32013628-32013650 TACAGGAGAGAACCTACACCAGG + Intronic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039252196 8:35679107-35679129 TACAGGTATGTCACCACACCAGG - Intronic
1039920077 8:41887389-41887411 TACAGGCATGCCACCACACCTGG + Intronic
1040578552 8:48675846-48675868 TACAGGGATGTAACAACAGCGGG - Intergenic
1041022638 8:53653704-53653726 TACAGGCACATACCACCACCTGG - Intergenic
1041670278 8:60484841-60484863 TACAGGCATGCCACTACACCTGG - Intergenic
1042631229 8:70819058-70819080 TACAGGCAAAGACATACACCAGG + Intergenic
1043097191 8:75990099-75990121 TACAGGCATGAGCCACCACCTGG - Intergenic
1043443777 8:80299845-80299867 TACAGGCATGAGCCTGCGCCCGG + Intergenic
1043540597 8:81258006-81258028 TCCAGGCATGTTCCTACCCTTGG - Intergenic
1044531412 8:93311687-93311709 TACAGCCATGTTCTAACACCCGG - Intergenic
1045530744 8:102982996-102983018 TACAGGCATGTACCACCATCTGG - Intergenic
1046179036 8:110618560-110618582 TACAAGCATGCCACTACACCTGG + Intergenic
1046732039 8:117736297-117736319 TACTGGCATGTACAAACATCTGG - Intergenic
1047323068 8:123807366-123807388 TACAGGCATGAGCCTGTACCTGG - Intronic
1047412950 8:124639059-124639081 TACAGGCATGAGCCACCACCTGG - Intronic
1049931220 9:458668-458690 TACAGGCACGCCACTACACCCGG - Intronic
1050767295 9:9150747-9150769 TACAGGCATGAGCCAACAACCGG + Intronic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1053292949 9:36894082-36894104 TATAGGCATGTACCAAAACCAGG - Intronic
1053648358 9:40138319-40138341 TGCAGGCATTTACCCAGACCTGG - Intergenic
1053757380 9:41325522-41325544 TGCAGGCATTTACCTAGACCTGG + Intergenic
1054536222 9:66237851-66237873 TGCAGGCATTTACCCAGACCTGG + Intergenic
1055092978 9:72381352-72381374 TACAGGCATGTACCACCACATGG - Intergenic
1055095941 9:72414250-72414272 TACAGGCATGCACCACCGCCAGG - Intergenic
1055573198 9:77637711-77637733 TACAGGCATGCTACCACACCCGG - Intronic
1056531930 9:87496054-87496076 TACAGGCATGTGACTATGCCCGG - Intergenic
1057374123 9:94503207-94503229 TACAGGCACGCACCACCACCAGG + Intergenic
1059181205 9:112214261-112214283 TACAGGCATGAGCCACCACCTGG - Intergenic
1059684267 9:116619662-116619684 TACAGGCATGTGCCACCACACGG + Intronic
1060048940 9:120363053-120363075 TACAGGCATGCCACTATACCTGG + Intergenic
1060274235 9:122170153-122170175 TACAGGCATGCCACCACACCCGG - Intronic
1060629922 9:125146896-125146918 TACAGGCATTTTCCAAAACCTGG + Exonic
1060730895 9:126036355-126036377 TACAGGCATGAGCCCGCACCTGG - Intergenic
1060912295 9:127360809-127360831 TTCAGGCTTGTACCCACCCCGGG + Intronic
1060928170 9:127470141-127470163 TACAGGCATGTACCTAGGAATGG - Intronic
1061236433 9:129345737-129345759 TACAGGCGTGAACCAACTCCCGG + Intergenic
1061510658 9:131059053-131059075 TACAGGCACCTAACCACACCTGG - Intronic
1062337157 9:136076731-136076753 TACAGGCATGAGCCACCACCAGG - Intronic
1186083872 X:5964792-5964814 TACAGGCATATGCCACCACCTGG + Intronic
1186240587 X:7561210-7561232 TACAGGCATGCAACCACACCAGG + Intergenic
1190059450 X:47201484-47201506 TCCAGGCAGGTAACCACACCGGG - Exonic
1190772112 X:53523895-53523917 TACAGGCTTGTTACCACACCTGG - Intergenic
1197742712 X:129907679-129907701 TACAGGCATGAGCCATCACCCGG - Intronic
1198041926 X:132861066-132861088 TACAGGCATGAGCCACCACCTGG + Intronic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1200769824 Y:7113307-7113329 TACAGGCATCTGCCGGCACCCGG - Intergenic
1201390869 Y:13496120-13496142 TACAGGCATGCGCCACCACCTGG + Intergenic
1201460436 Y:14216587-14216609 TACAGGCACACAACTACACCAGG + Intergenic
1201912236 Y:19144559-19144581 TACAGGCATGTCACTACACCTGG - Intergenic