ID: 906483835

View in Genome Browser
Species Human (GRCh38)
Location 1:46219734-46219756
Sequence GCAGCTGGTGACCTTGAATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906483829_906483835 17 Left 906483829 1:46219694-46219716 CCCAGGCTTACCTGCGAGCCATC 0: 1
1: 0
2: 1
3: 2
4: 66
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483830_906483835 16 Left 906483830 1:46219695-46219717 CCAGGCTTACCTGCGAGCCATCG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483827_906483835 19 Left 906483827 1:46219692-46219714 CCCCCAGGCTTACCTGCGAGCCA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483828_906483835 18 Left 906483828 1:46219693-46219715 CCCCAGGCTTACCTGCGAGCCAT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483825_906483835 25 Left 906483825 1:46219686-46219708 CCCACTCCCCCAGGCTTACCTGC 0: 1
1: 0
2: 0
3: 22
4: 280
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483831_906483835 7 Left 906483831 1:46219704-46219726 CCTGCGAGCCATCGATGTGAAGA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483832_906483835 -1 Left 906483832 1:46219712-46219734 CCATCGATGTGAAGATCCTGCAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
906483826_906483835 24 Left 906483826 1:46219687-46219709 CCACTCCCCCAGGCTTACCTGCG 0: 1
1: 0
2: 2
3: 16
4: 245
Right 906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG 0: 1
1: 0
2: 3
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906483835 Original CRISPR GCAGCTGGTGACCTTGAATG AGG Exonic
900380085 1:2379566-2379588 GCAGCTGGTGGCCAGGACTGGGG + Intronic
902774238 1:18664412-18664434 GGAGCTGGTGACCTGGAAGAGGG + Intronic
902925237 1:19691621-19691643 GCAGCTGCTGATCCTGAATGGGG + Intronic
905470165 1:38185817-38185839 GCAGCTGGAGACCCTCAAGGAGG - Intergenic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
908632721 1:66127906-66127928 TCAGCTTGTGACTTTGATTGGGG + Intronic
909416389 1:75410673-75410695 GAAGCTTGTGACTTTGTATGTGG - Intronic
910099688 1:83562933-83562955 CCATCAGGTGACCTTTAATGGGG + Intergenic
912957818 1:114168036-114168058 TCAGTTGGTGACCCTTAATGGGG - Intergenic
913040675 1:115019691-115019713 GCAGCTGGGGACCTCGAACTGGG - Intergenic
914782384 1:150797478-150797500 GAAGCTGGTGATCTTGATTTGGG + Intronic
918312014 1:183291678-183291700 GATGCTGGGGACCTTGAATAAGG - Intronic
918353660 1:183684324-183684346 GATGCTGGTGACTTTGGATGGGG + Intronic
918515636 1:185359419-185359441 GAAGTTGCTGTCCTTGAATGTGG - Intergenic
920781104 1:208991916-208991938 GCAGCTGGGAACCTTGAACTGGG + Intergenic
922075685 1:222241672-222241694 GCAGCTGGTGCCCCTGTGTGAGG + Intergenic
922796446 1:228341953-228341975 CCAGGTGGGGACCTTGGATGAGG + Intronic
1064717805 10:18194968-18194990 GCATTTGGAGACCTTCAATGAGG + Intronic
1068438182 10:57017701-57017723 ACAGCTGGTTGCCTTGAAGGTGG + Intergenic
1069238892 10:66113515-66113537 GCAGCGTTTGACCTTGAATCTGG - Intronic
1069608620 10:69757399-69757421 GGAGCTGGTGACCCTGGCTGAGG - Intergenic
1069833232 10:71293699-71293721 GGAGGTGGTGACCCTGGATGAGG + Exonic
1074507853 10:114087209-114087231 GGGGCTGGTGACCTTGCACGGGG - Intergenic
1075654729 10:124153340-124153362 GCAGCTGGTGGCCCTGAGTGTGG + Intergenic
1076930563 10:133529078-133529100 GCAGCTGGTGACCTCCAGAGAGG + Intronic
1077439619 11:2561897-2561919 GCAGCCCGTGACCTTGAGTGGGG - Intronic
1077473675 11:2776512-2776534 GGAGCTGGAGACCCTGACTGTGG + Intronic
1077564643 11:3289813-3289835 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077564671 11:3289997-3290019 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077570532 11:3335630-3335652 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077570561 11:3335814-3335836 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1078535455 11:12169992-12170014 GGACTAGGTGACCTTGAATGGGG + Intronic
1078783660 11:14464826-14464848 GTAGCTGGGGACATTGTATGAGG - Intronic
1079722349 11:23833751-23833773 GCAGCTGGTGACATTAATTGAGG - Intergenic
1080173147 11:29330365-29330387 GCATCTGGTGACCATGTAAGAGG - Intergenic
1082789576 11:57338144-57338166 GCAGCTGGTGAGCTGGGATGAGG + Intergenic
1084236678 11:67792139-67792161 CCAGGTGGTGACCTGGGATGGGG + Intergenic
1084805366 11:71575216-71575238 GCTGCTGGTGAAATTGAATATGG - Intergenic
1084835741 11:71800833-71800855 CCAGGTGGTGACCTGGGATGGGG - Exonic
1084860519 11:72014982-72015004 ACAGCTGATGACTTTGAAGGAGG - Exonic
1089580658 11:119480222-119480244 GTCACTGGTGACCTTGATTGTGG - Intergenic
1091594694 12:1869368-1869390 GCAGCGGGTGGCTTTGAATCTGG - Intronic
1091786166 12:3244507-3244529 GCAGCTGGTGACGTGGGCTGGGG + Intronic
1094175960 12:27541626-27541648 GCAGCTGGTGAGCTGCAATAGGG - Intronic
1098209715 12:68150557-68150579 ACAACTGGTGAACTTGAATGAGG - Intergenic
1099526694 12:83725772-83725794 GCAGCTGGTGCCCCTGTGTGAGG + Intergenic
1101213082 12:102553965-102553987 ACAGTTGGTGACCTTTATTGAGG - Intergenic
1102076100 12:110061419-110061441 GCTGATGGTGACCTGGACTGAGG - Intronic
1103521479 12:121538945-121538967 GACTCTGGTGACCTTGAGTGTGG - Intronic
1105417120 13:20223195-20223217 GCTGCTGGTGGCCATGCATGTGG - Exonic
1106398709 13:29406694-29406716 GCAGCAGGTGGCCTTGAAGATGG - Intronic
1107354539 13:39552840-39552862 GGAGGTGGTGACCAAGAATGAGG + Intronic
1107354548 13:39552912-39552934 GGAGGTGGTGACCAAGAATGAGG + Intronic
1108398608 13:50015505-50015527 GGAACTGGTCACTTTGAATGTGG + Exonic
1111641732 13:90978047-90978069 GTGGTTGCTGACCTTGAATGGGG - Intergenic
1112158890 13:96848262-96848284 GCAGCTGGTGCCCCTGTGTGAGG - Intergenic
1113743995 13:112730160-112730182 GGGGCTGGTGACCTGGAAGGGGG + Intronic
1114127361 14:19744742-19744764 GAAGCTGGTGTTTTTGAATGTGG + Intronic
1115377441 14:32693382-32693404 TCAGCTGGTGAACTTGACAGAGG - Intronic
1116536853 14:46042006-46042028 GAAGCTGGGAACCCTGAATGGGG - Intergenic
1118413437 14:65506844-65506866 GCAGCTGGTGCCCCTGTGTGAGG - Intronic
1121519659 14:94577321-94577343 GAAGGTGGTGACCTTGGATCTGG - Intronic
1121713102 14:96053626-96053648 GCAGCTGGTGGTCTTGTAGGAGG + Intronic
1123931488 15:25173754-25173776 CCAGATGGTGACCCTGAAGGAGG + Intergenic
1126977269 15:54197928-54197950 GCAGCTGGTGACCAGGGCTGAGG - Intronic
1127919772 15:63484646-63484668 GCAGCTGCTAACCTTGTGTGAGG + Intergenic
1129145319 15:73641843-73641865 CCAGCTGGGGACCTTGAACAAGG - Intergenic
1132293809 15:100720505-100720527 GGAGATGGAGACCTTGGATGTGG + Intergenic
1132602733 16:781274-781296 GCAGCCGGGGCCCTTGAAGGTGG - Intronic
1133348288 16:5084682-5084704 CCAGGTGGTGACCTGGGATGGGG + Exonic
1135477554 16:22790172-22790194 GCAGTTTGTTACCCTGAATGTGG + Intergenic
1136118645 16:28113271-28113293 GCTGCTGGTGACTGTGAAGGAGG - Intronic
1136512011 16:30743883-30743905 GCAGCAGGGGACCCAGAATGAGG - Intronic
1138332039 16:56223106-56223128 TAGGCTGGTGAACTTGAATGGGG - Intronic
1138410911 16:56839535-56839557 GAAGCTGGTGCCCCTGAATCAGG + Exonic
1138818387 16:60229021-60229043 GGAGCTGCTGTCCCTGAATGAGG - Intergenic
1140191946 16:72825139-72825161 CCAGCAGATGACCTTGATTGAGG - Intronic
1141264923 16:82488105-82488127 GAAGCAGGTGACCTCGAGTGAGG + Intergenic
1143230600 17:5350958-5350980 GCAGCTCTTGGCTTTGAATGCGG + Intronic
1143531056 17:7503605-7503627 GAAGCTGGTGATTGTGAATGGGG + Exonic
1144778492 17:17796502-17796524 GCTGCTGGAGACCTTGAATGTGG - Exonic
1144947190 17:18975736-18975758 GCAGCTGGTGACTTAAACTGTGG + Intronic
1146604530 17:34246832-34246854 GGTGCAGGTGACCTTGAAAGGGG + Intergenic
1148892442 17:50817767-50817789 GCAGATCGTGAACTTGAAGGAGG - Intergenic
1150706417 17:67491230-67491252 GCAGCTGGTGCACTTGACTCTGG + Intronic
1150727232 17:67661277-67661299 GGGGCTCGTGACCTTGACTGTGG - Intronic
1152935254 17:83132905-83132927 GCAGTTGGTGAGCGTGGATGTGG - Intergenic
1153582847 18:6592676-6592698 TAAGCTGGTGACCTTGGAGGTGG - Intergenic
1153878128 18:9394973-9394995 ACAGCTGGTGACACTGAATGGGG - Intronic
1156967577 18:43113844-43113866 GCTGCTGGTGGCATTTAATGTGG + Intronic
1159099169 18:63939253-63939275 GCACATGGTGACATTGAATGAGG - Intergenic
1164388087 19:27793963-27793985 GGAGGTGGTGACCTTGAGAGAGG + Intergenic
1164755049 19:30682862-30682884 GAAGCTGGTGACCTTCACTCTGG + Intronic
1165282821 19:34812928-34812950 GCAGCTTGTGTTCTTGAATCTGG + Intergenic
1166963572 19:46514493-46514515 GAAGCTGGTGACCCTGTATTTGG + Intronic
1167886687 19:52505812-52505834 GGAGCTTGTGAGGTTGAATGAGG + Intronic
1167892064 19:52548337-52548359 GGAGCTTGTGAGGTTGAATGAGG + Intronic
925585115 2:5457470-5457492 GCAGCAGGTGACCCTCAGTGTGG + Intergenic
925612020 2:5709483-5709505 GAAGTTGGAGACCTTGAACGTGG + Intergenic
927850391 2:26495025-26495047 GCAGCTGGTGGGCTTGAACATGG - Exonic
928161194 2:28926757-28926779 GCAGTTGAAGACCTTGGATGTGG + Intronic
928181708 2:29072712-29072734 GAAGATTGTGGCCTTGAATGTGG + Exonic
932079161 2:68695733-68695755 GTAGCAGGTCACCTTGATTGAGG + Intronic
935580727 2:104754020-104754042 GCAGTTGGTGTCCTGGATTGAGG - Intergenic
935847900 2:107187100-107187122 GAAGCTGGAAACCTTGCATGGGG + Intergenic
935853045 2:107243834-107243856 GCAGCTGCTGTCTTTGGATGAGG + Intergenic
937885936 2:126899945-126899967 ACAGCTGGTGACCTTCAGTGTGG - Exonic
941600914 2:167543747-167543769 GCAGCCTCTGACCTTGAATGTGG + Intergenic
941903002 2:170695471-170695493 GCAGCTGGGGACCCTGCTTGGGG + Intergenic
946645382 2:221827733-221827755 GCAGCTGGTGACTTTAAGTTGGG - Intergenic
947899107 2:233705541-233705563 GCAGCTGGTGATATTGCTTGTGG + Intronic
948172497 2:235916220-235916242 GAAGCCAGTGACCTTGAATGAGG - Intronic
1169111426 20:3036675-3036697 TCAGCTGATGACATTGAATAGGG + Intronic
1170075539 20:12415009-12415031 ACAGCTGGTGGGCTTGAGTGTGG - Intergenic
1172212402 20:33210079-33210101 GCAGGTGGTGTCCTGGAGTGTGG - Intergenic
1174368113 20:50068544-50068566 GCAGATGGTGGCCTTGCCTGAGG + Intergenic
1175946114 20:62559531-62559553 GGAGCTGATGCCCTTGAGTGTGG + Intronic
1176040425 20:63062597-63062619 GGAGCTGGTGGGCTTGAATGTGG + Intergenic
1178282447 21:31295076-31295098 GCATATGGTGACAGTGAATGGGG - Intronic
1178291695 21:31373974-31373996 GCTTCTGGTGACCTTGGTTGGGG - Intronic
1179140284 21:38719291-38719313 GAAGCAGGTGACCCTGAAGGAGG + Intergenic
1179240039 21:39581802-39581824 GCAGGTGGTAACCTTTGATGTGG + Intronic
1180865320 22:19115325-19115347 GCAGCTGGTGAGCTTCAGTGAGG + Intronic
1183498037 22:38161605-38161627 GGAGATGATGGCCTTGAATGGGG + Intronic
1183919102 22:41149826-41149848 GAAGCTGGGGACAGTGAATGTGG - Exonic
1184960075 22:47922228-47922250 GCAGCTGGTGTCTTAGAATGTGG - Intergenic
1185368060 22:50445979-50446001 GCAGCTGGTGACCTGGCCAGAGG - Exonic
951751588 3:26042268-26042290 GCAGCTGGGAAGCTTGAACGGGG - Intergenic
952235651 3:31476963-31476985 GAAGTTGTTGACCTTGAATTGGG - Intergenic
953234090 3:41091082-41091104 GCAGCTGGTTATCTGGGATGTGG - Intergenic
954250412 3:49363011-49363033 TCAGCTGCTGCCCTAGAATGGGG - Intronic
957052635 3:75421944-75421966 CCAGGTGGTGACCTGGGATGGGG + Intergenic
959022665 3:101205536-101205558 ACAGATAGTGACCTTGAATGTGG + Intergenic
960668163 3:120131223-120131245 GCAGCTAGGGACCTTGAATTTGG - Intergenic
960697189 3:120407650-120407672 GCAGCTGCTGACCTAGGAGGAGG + Intronic
961302211 3:125929613-125929635 CCAGGTGGTGACCTGGGATGGGG - Intronic
961324220 3:126100709-126100731 GCATCTGGACACCGTGAATGAGG + Intronic
961886247 3:130098165-130098187 CCAGGTGGTGACCTGGGATGGGG + Intronic
962093779 3:132272470-132272492 GCATCTATTGAACTTGAATGAGG - Intronic
962952689 3:140233822-140233844 ACAGCTGGTGCTCTAGAATGGGG + Intronic
963103262 3:141624879-141624901 GCACCTGGTGATCTGGACTGTGG - Intergenic
964076873 3:152702301-152702323 GCAGCTGGTGACTTTAAGTTGGG - Intergenic
968106368 3:196004492-196004514 GGAGCTGATAATCTTGAATGAGG - Intergenic
968536493 4:1133853-1133875 GCAGCTTGTGGCCTTAAAGGAGG + Intergenic
968995438 4:3942322-3942344 CCAGGTGGTGACCTGGGATGCGG + Intergenic
969054199 4:4391376-4391398 GCAAATGGTGACTTTGAATATGG + Intronic
969758552 4:9166474-9166496 CCAGGTGGTGACCTGGGATGGGG - Intergenic
969818516 4:9703924-9703946 CCAGGTGGTGACCTGGGATGGGG - Intergenic
971746335 4:30586393-30586415 GAGGCTGGTGACTTTGGATGGGG + Intergenic
974016097 4:56650518-56650540 GAGGCTGTTGAGCTTGAATGGGG + Intronic
974827671 4:67151654-67151676 AGAGCTGGTCACCTTGAAGGGGG - Intergenic
974900706 4:67993780-67993802 GTAGCTGGTGACCATGATTTGGG + Intergenic
974995836 4:69157522-69157544 GCTGCTGGTTGCCTTGAAAGTGG + Intronic
978944555 4:114479998-114480020 GCAGCTGGTGCCCCTGTGTGAGG + Intergenic
981423364 4:144576846-144576868 GCATCTGGTGACCATGAATGTGG - Intergenic
982605203 4:157507318-157507340 GCAGCTGATGACCTTAGCTGTGG - Intergenic
988678454 5:33458846-33458868 GAAACTGGTGAGCTTGAAGGGGG + Intronic
988907521 5:35804443-35804465 AAAGCTGGTGATGTTGAATGTGG - Intronic
989146871 5:38258307-38258329 CCCGCTGGTGACCTAGATTGGGG - Intergenic
990521547 5:56586237-56586259 GCAGCTGCTGGCCTTTAACGAGG - Intronic
993460047 5:88172304-88172326 GAAGTTGGTGACCTTCAGTGGGG + Intergenic
997316781 5:132943141-132943163 GCAGCTGGTGAATTTGAAGCTGG + Intronic
997596931 5:135113359-135113381 GCAGGTGGTGACCTGGACAGTGG - Intronic
998849391 5:146339069-146339091 GCAGCGGGTGACATGGAATCAGG - Exonic
1000516665 5:162243882-162243904 GAATCTGGTGACATTGGATGAGG - Intergenic
1007602303 6:43090144-43090166 GCCGCTGGTGACCCAGAAAGGGG + Intronic
1008674842 6:53808203-53808225 GCTGCTGGTGACGTTGACTGTGG + Intronic
1009924086 6:70098811-70098833 GCAGCTTGGGGCCTTGAAGGAGG + Intronic
1010491432 6:76481027-76481049 GCAGCTGGTGCCCCAGTATGAGG - Intergenic
1019479394 7:1259682-1259704 GAAGGTGGTGACCTTTAAGGGGG + Intergenic
1020311424 7:6871526-6871548 CCAGCTGGAGACCTTCAAAGGGG + Intergenic
1020319711 7:6930639-6930661 CCAGGTGGTGACCTGGGATGGGG + Intergenic
1020354538 7:7262197-7262219 GCATCAGGTGCTCTTGAATGTGG - Intergenic
1023629788 7:42152720-42152742 GCTGCTGTTGACCTTGCTTGGGG - Intronic
1030950918 7:115789986-115790008 GCAGCTGCTGGGCTTGATTGCGG - Intergenic
1033447568 7:141436302-141436324 GCAGCTGGTGTGCTTGCACGGGG + Intronic
1034066539 7:148142224-148142246 GCAGCAGTTGGCCTTGAATTAGG + Intronic
1036938591 8:13029982-13030004 GCAGATGGTGCCCTGGCATGGGG + Intronic
1037497725 8:19456484-19456506 GCAGTTGTTGAACCTGAATGTGG - Intronic
1038668594 8:29563061-29563083 TCAGCTGGTGAGTATGAATGAGG - Intergenic
1039667337 8:39547994-39548016 GAAGCTGGTAACCGTGCATGGGG - Intergenic
1039949938 8:42162501-42162523 GAAGTGGATGACCTTGAATGGGG - Intronic
1043819718 8:84847358-84847380 GAAGCTGGGGACCCTGCATGGGG - Intronic
1044273421 8:90273106-90273128 GCACCTGGCCAGCTTGAATGGGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049149050 8:141022619-141022641 GCAGCTGGGGACCTGGTGTGTGG + Intergenic
1051156010 9:14146721-14146743 GCAGCTGGTGAACTTGGAGAGGG + Exonic
1051299043 9:15628517-15628539 GCAGCTGGGAAGCTTGAATTGGG + Intronic
1052550490 9:29941441-29941463 GCAGCTGATGAACTAGAAAGAGG + Intergenic
1055300520 9:74877726-74877748 CCAGCTGGTGGCTTTAAATGAGG - Intronic
1055486030 9:76757268-76757290 GCTGCTGGTTTCATTGAATGAGG - Intronic
1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG + Intergenic
1057139717 9:92719048-92719070 TGAGCTGGTGACCTTCAGTGAGG - Exonic
1058081939 9:100710088-100710110 GCAGCTGGGAAGCTTGAATTGGG - Intergenic
1058564368 9:106265970-106265992 GCAGCTGCTGACTATGATTGAGG + Intergenic
1061283411 9:129609822-129609844 GCAGCAGATGACCCCGAATGTGG + Intronic
1061378432 9:130239981-130240003 GCAGAGGGTGAGCTTGAACGGGG + Intergenic
1062208512 9:135350253-135350275 GCTGCTGCTGACATTAAATGGGG + Intergenic
1185938611 X:4287978-4288000 GCAACTGCTGAACTTGAGTGGGG - Intergenic
1188833661 X:34931494-34931516 GAAGCTGGTAACTCTGAATGGGG + Intergenic
1189940037 X:46112305-46112327 GAGGCTGCTGACCTTGGATGGGG + Intergenic
1190106839 X:47567066-47567088 TCTGCTGGTGACTTGGAATGTGG - Exonic
1190305720 X:49080317-49080339 GGACCTGGAGACCTTGAAAGTGG + Intronic
1193092930 X:77513496-77513518 GAAGCTGGGAACCCTGAATGGGG + Intronic
1197836215 X:130696438-130696460 GAGGCTGGTGACCTTAAATATGG - Intronic
1200880142 Y:8203971-8203993 GAAGTTGGTGACCTTGAATGTGG + Intergenic
1201762274 Y:17553951-17553973 GCATCTGGTGTCCTTGCAGGAGG - Intergenic
1201839278 Y:18352037-18352059 GCATCTGGTGTCCTTGCAGGAGG + Intergenic