ID: 906488852

View in Genome Browser
Species Human (GRCh38)
Location 1:46252021-46252043
Sequence GTGCACAACAGGAGACCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906488847_906488852 13 Left 906488847 1:46251985-46252007 CCTGTGTAACTACATGGCATAAG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 906488852 1:46252021-46252043 GTGCACAACAGGAGACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906488852 Original CRISPR GTGCACAACAGGAGACCTAT GGG Intronic
906488852 1:46252021-46252043 GTGCACAACAGGAGACCTATGGG + Intronic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910653541 1:89596408-89596430 GTGCACCACAGCACACCTATTGG - Exonic
911122352 1:94309055-94309077 GTGTACAACAGGGGAGCCATTGG + Intergenic
915948178 1:160169662-160169684 GTTCTCAACAGGCGACCTAGCGG + Intronic
916906174 1:169286683-169286705 TTGTACAACAGGAGTGCTATTGG + Intronic
922482888 1:225951217-225951239 GTGCCCAGCAGGGGACCTAGGGG - Intergenic
924409325 1:243786780-243786802 GGGCAGAACAAGAGACCTGTGGG - Intronic
1067808410 10:49408924-49408946 GTGCACAAAAGGAGATCATTTGG + Intergenic
1070934402 10:80282117-80282139 GTGCAGAACAGGACAGCTTTTGG - Intronic
1077739199 11:4826365-4826387 GTGCACATCAGGGGCCCCATGGG - Intronic
1083851677 11:65371368-65371390 CTGGACAACAGGAGTCCAATGGG + Intergenic
1084421601 11:69063269-69063291 GGGGACAAGAGGAGACCCATCGG - Intronic
1095924312 12:47563352-47563374 GTGCACAACAGGACCCATATTGG - Intergenic
1101784410 12:107870429-107870451 ATGCACAACAGGAGTACTACAGG + Intergenic
1102173167 12:110857514-110857536 GTGCCCAACCTGAGACCAATTGG - Intronic
1123133806 14:106009552-106009574 GTGAACAACAGGCCACCTACAGG - Intergenic
1127838024 15:62806462-62806484 GTGCACAATGGCTGACCTATGGG - Intronic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1135108096 16:19668425-19668447 GTGCACAACAGGAGACGGGGTGG - Intronic
1139229715 16:65272111-65272133 GGTCACAACAGGAGACCTCCAGG + Intergenic
1146409226 17:32567754-32567776 GTGCACAGAAGGACACCTACAGG + Intronic
1147798723 17:43066203-43066225 GTGTAATACAGGAGACCTCTGGG - Intronic
1154070994 18:11150798-11150820 GAGCTCAACAGCAGACCTACAGG + Intergenic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
1160735016 19:658432-658454 GTGCACATCAGGAGACCCCAGGG + Intronic
1161099634 19:2415325-2415347 CTGCACTCCAGGAGACCCATGGG - Intronic
927196700 2:20552739-20552761 GAGCACAGGAAGAGACCTATGGG - Intergenic
927577569 2:24212319-24212341 CTCCACAACTGGAGACCTAGAGG + Intronic
928287847 2:30008934-30008956 TTGCACCACAGGAGACCTGGGGG - Intergenic
947363680 2:229372347-229372369 TTGCACAACAGGAGCCCTTACGG + Intronic
1172585638 20:36082138-36082160 ATGCACAAAAGGAAACCTGTTGG - Intergenic
1173856351 20:46252831-46252853 GTGGACAACCTGAGACCTGTGGG + Intronic
1177291183 21:19114032-19114054 ATGCAAAACAGGAGCCATATGGG + Intergenic
1181884674 22:26010813-26010835 GAGCACAACAGAAAACCTCTTGG + Intronic
1181892006 22:26071391-26071413 GTGCAGGACAGGAAACCTGTTGG - Intergenic
1181897759 22:26125918-26125940 GTACACAACAGGTGATCAATAGG - Intergenic
957865855 3:86021903-86021925 ATACACAACATGAGAACTATAGG + Intronic
967967519 3:194973769-194973791 ATGCACAACAGGAGACCCTTCGG - Intergenic
971009599 4:22418783-22418805 CTGCAGAACAGGAGGCCTCTGGG - Intronic
971303728 4:25462812-25462834 GGGCACAACAGGAGCCCAACTGG - Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977376070 4:96205614-96205636 GTGAACAGTAGGGGACCTATGGG - Intergenic
978182330 4:105814231-105814253 TTGCACTACAGGAGACATGTGGG - Intronic
980989341 4:139725567-139725589 TGGCACAACAGGAGGCCTCTAGG + Intronic
985628386 5:1001982-1002004 GTGGACAGCAGGACACCTAACGG + Intergenic
987396386 5:17428598-17428620 CTGCAGAACAGGAGACCTGGCGG + Intergenic
991460078 5:66849014-66849036 CTGCAAAACAGGAAACCTGTTGG + Intronic
997125709 5:131224932-131224954 GTGCCCAGCAGGGGACCTAGAGG + Intergenic
1005076495 6:21913336-21913358 CTGCACACCTGGAAACCTATGGG + Intergenic
1010158946 6:72829177-72829199 CTGCAGAACAGGACACATATTGG - Intronic
1011335001 6:86250564-86250586 GGGCACAACTGGAGACAGATAGG - Intergenic
1023150259 7:37195445-37195467 GTGCTCTACAGGTGACCGATGGG + Intronic
1024731978 7:52263160-52263182 GGTCACAACAGGAAACCTATGGG - Intergenic
1027844622 7:83356880-83356902 GTGGACAATAGGAGACATAAAGG + Intergenic
1030815566 7:114032386-114032408 GTGCACAGCAGGAGAACAATCGG - Intronic
1031069293 7:117144236-117144258 TTGCCCAACAGGTGACCTCTTGG + Intronic
1037783774 8:21889630-21889652 ATGCCCAACAGGAGACTTAATGG + Intergenic
1038453267 8:27653421-27653443 GTGAACCACGGGAGACCTTTGGG + Intronic
1043159376 8:76826776-76826798 CTGCACAACATTATACCTATAGG + Intronic
1050421453 9:5469764-5469786 TTGCTCAAAAGGAGACCCATGGG + Exonic
1051394883 9:16609132-16609154 GTGCACCCCAGGGGACCTTTCGG + Intronic
1053192085 9:36080702-36080724 GTGCACAGCAGGATTCCGATAGG + Intronic
1057924520 9:99132308-99132330 GTGCATAAAAGGAGGCCTAGTGG + Intronic
1061624445 9:131833473-131833495 GTGGACAACAGGGGAGCCATGGG + Intergenic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1191138874 X:57094693-57094715 GTGCAAAACAGGGCAGCTATTGG + Intergenic
1198618542 X:138482571-138482593 GTGCAGGACGGGAGACCTGTGGG + Intergenic