ID: 906490025

View in Genome Browser
Species Human (GRCh38)
Location 1:46260993-46261015
Sequence GGATGAAATAGACCAAAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906490024_906490025 -4 Left 906490024 1:46260974-46260996 CCATCGATGGAGGATCTAAGGAT 0: 1
1: 0
2: 0
3: 4
4: 41
Right 906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 222
906490022_906490025 3 Left 906490022 1:46260967-46260989 CCTCTGGCCATCGATGGAGGATC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 222
906490020_906490025 7 Left 906490020 1:46260963-46260985 CCAACCTCTGGCCATCGATGGAG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906490025 Original CRISPR GGATGAAATAGACCAAAAGC TGG Exonic
905430187 1:37916853-37916875 GGAGGAAATAGAGCAAAAGGAGG - Intronic
906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG + Exonic
907718118 1:56946711-56946733 GTATGGAATAGACTGAAAGCTGG + Intronic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
909863138 1:80633780-80633802 GGATGAAAAAGAAGAAAAGGGGG - Intergenic
910131495 1:83912709-83912731 GGATGAAAAATAACCAAAGCAGG + Intronic
911409152 1:97480022-97480044 GAAAGAAATAGAAGAAAAGCAGG - Intronic
912897029 1:113602999-113603021 AGATCAAAGAGACAAAAAGCTGG + Intronic
916215911 1:162394357-162394379 AGATGAACAAAACCAAAAGCTGG + Intergenic
917590466 1:176470890-176470912 GGTTGAAAGAGAGCAAAAGCTGG + Intronic
917708712 1:177661179-177661201 GGATGGAATAGAGCTAAAGAAGG + Intergenic
917855374 1:179095113-179095135 GGATGAAATAGCCCAGATGATGG + Exonic
919465161 1:197916909-197916931 GGATGAAAAAGTCCACAAGGAGG + Intronic
920128547 1:203712944-203712966 GGAGGAAAAAGAAAAAAAGCAGG + Intronic
921066208 1:211623890-211623912 GGAGGCTATAAACCAAAAGCAGG + Intergenic
1063172740 10:3524099-3524121 GGAAAAAATAGTCCAAAGGCTGG + Intergenic
1063556812 10:7088155-7088177 GTATGTATTAGGCCAAAAGCTGG + Intergenic
1065500337 10:26375251-26375273 GGATGTAATGGAACAAAAGGAGG - Intergenic
1065993384 10:31033297-31033319 GGAATAAATAGACCCAAAGGAGG + Intergenic
1067435196 10:46272199-46272221 GAAACAAAAAGACCAAAAGCTGG + Intergenic
1067518748 10:46978435-46978457 GTATTAAATGGACCAAAAGGTGG + Intronic
1067643500 10:48073399-48073421 GTATTAAATGGACCAAAAGGTGG - Intergenic
1068836776 10:61563981-61564003 GCATGAAATATACCAAAATGAGG + Intergenic
1068975798 10:63007793-63007815 AGATGTAAAAGATCAAAAGCAGG + Intergenic
1068985086 10:63100848-63100870 AGATGAAATAGCACAAAAACTGG - Intergenic
1071214289 10:83380955-83380977 GGAAGAAACAGTCCCAAAGCAGG + Intergenic
1072751817 10:97986160-97986182 GGATGAAATGCACCAAGGGCAGG + Intronic
1075463285 10:122632645-122632667 GGATGAGATTGACCAAAGCCTGG - Intronic
1075539900 10:123303557-123303579 GGATGAAAAAGAACAGAACCAGG + Intergenic
1075914132 10:126151975-126151997 AGATGAATTAAACCAAAAGCTGG - Intronic
1077380015 11:2228355-2228377 GGATGAAATAGACCAATTTCTGG + Intergenic
1081599243 11:44481157-44481179 GGATGAAACAGACCAAAGCACGG - Intergenic
1083896292 11:65621577-65621599 GGAAGAAATGAACCAGAAGCGGG - Intronic
1083998273 11:66282859-66282881 GGATCAAACAGGCCCAAAGCAGG - Intronic
1085530057 11:77186847-77186869 AGCCGAGATAGACCAAAAGCTGG - Intronic
1090168163 11:124573807-124573829 AGATGAAATGGACCAAATCCTGG + Intergenic
1098172555 12:67761447-67761469 GGAGGGAAGAGACCATAAGCAGG - Intergenic
1099591377 12:84595354-84595376 GGAAATAATAGACCAAAATCTGG + Intergenic
1100421554 12:94439226-94439248 AGATAAATTAGACAAAAAGCTGG + Intronic
1100566752 12:95802408-95802430 GGATGTAAGAGAGGAAAAGCAGG + Intergenic
1105013050 12:132768488-132768510 GGATGAAAAAGACGAGAATCTGG + Intergenic
1106005245 13:25763682-25763704 CAATGAAATATACCAAAATCTGG + Intronic
1106163153 13:27218214-27218236 GGAAGAAACAGACAAAAAGAAGG + Intergenic
1107035012 13:35892945-35892967 CGCTGAAATATACCAAAAGATGG + Intronic
1107446133 13:40471739-40471761 GGATGCCATTGACCAAAAACAGG + Intergenic
1108008159 13:45974011-45974033 GGATGAAAAAAGCCTAAAGCAGG + Intronic
1108037860 13:46310703-46310725 GGATCAACAAAACCAAAAGCTGG + Intergenic
1109319567 13:60793095-60793117 AAATGTAATAAACCAAAAGCTGG - Intergenic
1109439811 13:62354811-62354833 GGATGAAAGATAACAAAAGTTGG + Intergenic
1109548843 13:63865378-63865400 GGATTAAATACAACAAAAGAGGG + Intergenic
1112747021 13:102538045-102538067 GGAAGATATAGACCAGAAGTGGG - Intergenic
1115344495 14:32327863-32327885 GGAATTAAGAGACCAAAAGCAGG - Intergenic
1115471891 14:33776495-33776517 GGAAGAAAAACGCCAAAAGCAGG - Intronic
1116188776 14:41635974-41635996 GAATGAAATAGACCCCAAACAGG - Intronic
1118968819 14:70613946-70613968 GGGAGAAATAAACCAGAAGCAGG - Intergenic
1119817458 14:77582771-77582793 GGATGTTAGGGACCAAAAGCGGG + Intronic
1120952305 14:90052705-90052727 TACTGAAATAGACCAAAAGCAGG + Intergenic
1121026510 14:90620363-90620385 GGATTAAAGACACCAGAAGCTGG + Intronic
1122671184 14:103373590-103373612 GGATGAAAAACACAAAAATCAGG - Intergenic
1202940941 14_KI270725v1_random:144453-144475 AGCTGAAAGAGGCCAAAAGCAGG - Intergenic
1123456593 15:20431903-20431925 GAAGGACAGAGACCAAAAGCAGG - Intergenic
1123661469 15:22568457-22568479 GAAGGACAGAGACCAAAAGCAGG + Intergenic
1124070631 15:26389760-26389782 TTTTGAAATGGACCAAAAGCTGG - Intergenic
1124262736 15:28207052-28207074 GAAGGACAGAGACCAAAAGCAGG - Intronic
1124315269 15:28662689-28662711 GAAGGACAGAGACCAAAAGCAGG + Intergenic
1125158993 15:36622137-36622159 CAATGAAAAAGATCAAAAGCAGG - Intronic
1125247578 15:37659565-37659587 AAATGAAATAGATCAAAAGTTGG + Intergenic
1125491498 15:40152008-40152030 GGCTGAAATGGAACAAAAGAGGG + Intergenic
1126609040 15:50509791-50509813 AGATGAAATAGACAAATATCTGG + Exonic
1126880357 15:53088279-53088301 GGATCAATAAAACCAAAAGCTGG - Intergenic
1127044217 15:55009116-55009138 GGATGAAATATATCAATAGCTGG - Intergenic
1127961764 15:63895494-63895516 GGATGAAATAGGCGCTAAGCTGG - Intergenic
1130056211 15:80528170-80528192 GGATGAAGTAGGCCACAGGCGGG + Intronic
1130359426 15:83168349-83168371 GGATCAATGAAACCAAAAGCTGG + Intronic
1134343185 16:13364246-13364268 ACATGAAATAGACCAGAATCTGG + Intergenic
1139055857 16:63182698-63182720 GTATGCAATAAAACAAAAGCTGG + Intergenic
1141895054 16:86953965-86953987 GGAGGAAATATCCCAAATGCTGG + Intergenic
1146412653 17:32600879-32600901 AGCTGAGATAGGCCAAAAGCTGG - Intronic
1149365326 17:55938272-55938294 GGATGTCATAGAACAAAAGGAGG + Intergenic
1149631654 17:58130359-58130381 GAATGTGATACACCAAAAGCAGG + Intergenic
1150770693 17:68038404-68038426 GGCAGAAATAAACCAAAAACGGG - Intronic
1151155476 17:72121136-72121158 GGAGGAAAAAGAGCAAAAGTGGG - Exonic
1151656276 17:75497649-75497671 GGATGGAATAAAACAAAGGCTGG - Intronic
1153287912 18:3473394-3473416 AGCTGAGACAGACCAAAAGCTGG + Intergenic
1156118214 18:33812686-33812708 AGATGAAATAGACCAATTCCTGG + Intergenic
1156538503 18:37887092-37887114 GAATGAAATAGACTATATGCAGG - Intergenic
1156709292 18:39924208-39924230 AGATGAAATAGACAGATAGCTGG + Intergenic
1158874625 18:61721524-61721546 GTAAGAAATAGACCAGAACCTGG + Intergenic
1158925971 18:62260886-62260908 GAATGAAATGGACCAGAAGCTGG + Intronic
1159306618 18:66651747-66651769 AGTTTAAATAGACAAAAAGCTGG - Intergenic
1159432925 18:68379082-68379104 GGAAGAAATATAATAAAAGCAGG + Intergenic
1159525880 18:69588147-69588169 GTATGATAGAGACCAAAATCAGG + Intronic
1159611895 18:70535016-70535038 GAAGGAAATAGAATAAAAGCAGG - Intergenic
1160616646 18:80135704-80135726 AGATGAAATTGACCAAGAGCTGG + Exonic
1161977616 19:7615200-7615222 GGACGAGATGGCCCAAAAGCGGG + Exonic
1162318832 19:9958873-9958895 AGATGAAAGAGATCAAGAGCTGG + Intergenic
1163575444 19:18108733-18108755 AGATGAAAGAAACCAAAGGCCGG + Intronic
1165598380 19:37031245-37031267 GAATGAAATAGAGCAAAGGAGGG - Intronic
1167330687 19:48854015-48854037 GGAGGAGATAGACCAGAAGCAGG - Exonic
925360060 2:3272352-3272374 AGCTGAAGTAGACCAAGAGCCGG - Intronic
927313092 2:21652160-21652182 TGATGAACTAAAACAAAAGCAGG - Intergenic
930608250 2:53514491-53514513 AGATGTAATAGACTAAAGGCTGG - Intergenic
931188490 2:59976739-59976761 GGAGGAAATAGAACAAAAGCAGG + Intergenic
931208703 2:60172016-60172038 GGATATAATAGACTAAAGGCAGG - Intergenic
931573157 2:63691135-63691157 GGATAATAGAGACTAAAAGCTGG - Intronic
931821250 2:65954606-65954628 GGATAAAAAAGACAAAAGGCTGG - Intergenic
935255355 2:101305452-101305474 GGATTAAACAGAGCAAAAGCTGG - Intronic
937874110 2:126807914-126807936 GGAAGAAACAGACACAAAGCGGG + Intergenic
938276850 2:130034032-130034054 TGATGAAATAAAGCAAAAGTTGG - Intergenic
938438535 2:131303364-131303386 TGATGAAATAAAGCAAAAGTTGG + Intronic
939206963 2:139119122-139119144 GTAGAAAATAGAGCAAAAGCTGG + Intergenic
939548938 2:143589348-143589370 GGTTGAGACAGACAAAAAGCAGG - Intronic
940731118 2:157393576-157393598 GAATGAAACAGACAAAAATCTGG - Intergenic
940749237 2:157605969-157605991 GAATGATAGATACCAAAAGCTGG - Intronic
942482980 2:176408946-176408968 AGAAGAAATAGACCAAATCCTGG - Intergenic
943241890 2:185395817-185395839 GGAATAAATAGATCAAAATCAGG - Intergenic
943579833 2:189672294-189672316 GGAGTAAATAGACAAAAAGGTGG - Intergenic
943580759 2:189681393-189681415 GGGTGAAATAGACCAGATCCTGG - Intronic
944511431 2:200469889-200469911 GGAGGAAAGAGATGAAAAGCAGG - Intronic
944907753 2:204280039-204280061 GAATGAAAGTGACCAAGAGCAGG + Intergenic
946133464 2:217625839-217625861 GGATGAAATAGAGAAAAACTAGG - Intronic
947942470 2:234070291-234070313 GGATGAGATGGGCCAAAAGAAGG - Intronic
1169182817 20:3585012-3585034 AGAAGGAATAGACCAGAAGCTGG + Intronic
1170240212 20:14157233-14157255 GGATGAAAGAGAAAAAAAGGAGG - Intronic
1170773557 20:19355642-19355664 GCATAAAATAGAACAACAGCAGG + Intronic
1171516841 20:25745223-25745245 GCAGGAAACAGACCCAAAGCAGG + Intergenic
1171804263 20:29661361-29661383 AGCTGAAAGAGGCCAAAAGCAGG + Intergenic
1171839788 20:30195062-30195084 AGCTGAAAGAGGCCAAAAGCAGG - Intergenic
1172195739 20:33090286-33090308 GGAAGGAAGAGCCCAAAAGCTGG + Intronic
1173615250 20:44399174-44399196 GGCTGAAAGAGACCAAATACCGG - Intronic
1173699483 20:45055548-45055570 GGATCAACAAAACCAAAAGCTGG - Intronic
1174757564 20:53174873-53174895 GGAGGAAATGGATCAAGAGCAGG + Intronic
1176582220 21:8542491-8542513 AGCTGAAAGAGGCCAAAAGCAGG + Intergenic
1177169497 21:17640080-17640102 GGGAGAAATAGGCCAAAAGAAGG + Intergenic
1177593183 21:23200683-23200705 GGTAGAAATAGACAAAAAGATGG + Intergenic
1177897237 21:26868137-26868159 GGCTTAAATAGAACAAAAGGTGG - Intergenic
1178265532 21:31139343-31139365 GAATGAAATAAACCAAAGGATGG + Intronic
1180265055 22:10519539-10519561 AGCTGAAAGAGGCCAAAAGCAGG + Intergenic
1182088184 22:27575808-27575830 GGGTGAAACAGACCAAAGCCCGG + Intergenic
1182395340 22:30031819-30031841 GGATGATAAAGACTGAAAGCAGG - Intergenic
1182613497 22:31569547-31569569 GCATGAAAGAGAAAAAAAGCAGG + Intronic
949664138 3:6317362-6317384 GTATGACATAAACTAAAAGCAGG + Intergenic
951261117 3:20510322-20510344 GGATCAAATAAAGCAAAAGTGGG - Intergenic
951636842 3:24788556-24788578 GCAGGATATAGAGCAAAAGCAGG + Intergenic
953789723 3:45937986-45938008 GGATGAAAGCAAACAAAAGCAGG - Intronic
954328272 3:49875468-49875490 GGGTGTGATAGACCAAAAGCTGG + Intergenic
955852132 3:63231927-63231949 GGATTAAAAAGAACAACAGCGGG - Intronic
959122619 3:102250832-102250854 GATTGAAAAATACCAAAAGCTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959890841 3:111554372-111554394 GGAGGAAGTAGATCAAAAGGTGG - Intronic
959977305 3:112475017-112475039 GGCTGAAATTGACCAAAATGGGG + Intronic
961616278 3:128183948-128183970 GGATACAATAGACCACCAGCAGG + Intronic
961803511 3:129471221-129471243 AGAAGAAATGGCCCAAAAGCTGG - Intronic
963273618 3:143308989-143309011 GGCTGAAATAGACTTAGAGCTGG - Intronic
967671063 3:192235805-192235827 AGATGAACAAGCCCAAAAGCTGG - Intronic
968293012 3:197553625-197553647 GGATGGACTAGAGCAGAAGCAGG + Intronic
969090781 4:4692492-4692514 GGCTCAAATAGAACAAAAGGTGG - Intergenic
970113053 4:12660377-12660399 GGATAAAAGAGACAAACAGCAGG - Intergenic
971439218 4:26661686-26661708 GGATGCAATAGACGATAACCTGG + Intronic
971706979 4:30057795-30057817 GGATGAAATAGACAATAAAATGG - Intergenic
971952435 4:33371347-33371369 TGATAAAATAGACCACCAGCTGG + Intergenic
972007671 4:34131492-34131514 GAATGTCATAGAGCAAAAGCAGG - Intergenic
972523666 4:39886254-39886276 TGAGGAAAGAGAACAAAAGCTGG - Intronic
974126575 4:57703961-57703983 GAATCAAGTAAACCAAAAGCTGG - Intergenic
974592913 4:63977622-63977644 GGATTAATAAGACCTAAAGCTGG - Intergenic
975121029 4:70728670-70728692 AAAGAAAATAGACCAAAAGCTGG - Intronic
975559538 4:75696123-75696145 GACCAAAATAGACCAAAAGCAGG + Intronic
976204189 4:82609164-82609186 GGATGAAATGTTCCAAAAGCAGG - Intergenic
976357386 4:84134738-84134760 GCATGTAATAAACCAAAAGTTGG + Intergenic
976442762 4:85094884-85094906 GCATGAAATAGAACAAAGGAAGG + Intergenic
976606127 4:86984637-86984659 GGATGAAAAAGAAAGAAAGCTGG + Intronic
978146662 4:105381810-105381832 GGATCAACTAAAACAAAAGCTGG - Intronic
979752539 4:124297062-124297084 AGATGAAAAAGACCAAAAAGAGG + Intergenic
980889219 4:138796430-138796452 GGATGGCAGAGCCCAAAAGCTGG - Intergenic
985328341 4:188797794-188797816 AGCTGAAACAGACCAAAAGCTGG + Intergenic
987063322 5:14263060-14263082 GGAAGAAGTAGTCCAAAACCGGG - Intronic
987264091 5:16234422-16234444 GGAGGAAAGAGAAAAAAAGCTGG + Intergenic
987835279 5:23152732-23152754 GGATAAAATACACCTAAGGCTGG - Intergenic
993245233 5:85442676-85442698 GGCTGAAATATAGTAAAAGCAGG + Intergenic
994872887 5:105376430-105376452 GGATCAATGAAACCAAAAGCTGG - Intergenic
995151150 5:108846956-108846978 GAAGAAAAAAGACCAAAAGCTGG - Intronic
995710940 5:115035004-115035026 GGATGAGATAGGTCAAGAGCAGG - Intergenic
995764206 5:115598301-115598323 AGATGAAATAGAGCTAAACCTGG - Intronic
996464835 5:123787896-123787918 AGATCAAACAGGCCAAAAGCAGG - Intergenic
996586641 5:125095632-125095654 AGCTGAGATAGGCCAAAAGCTGG + Intergenic
997048291 5:130347013-130347035 AGATAAAATAAACCAAAAGTTGG - Intergenic
997986536 5:138505714-138505736 TGATGAAACAGAACAAAAGAAGG - Intergenic
1000333504 5:160224548-160224570 TAATGAGATAGACCAAAAGCTGG + Intronic
1000492618 5:161933513-161933535 AGCTAAGATAGACCAAAAGCTGG + Intergenic
1004212742 6:13667951-13667973 GAATGAACTAAACCCAAAGCAGG + Intronic
1004910888 6:20282243-20282265 GGATCAAAGAAACCAAAAGTTGG + Intergenic
1005582756 6:27249966-27249988 AGATGAAAGAAACAAAAAGCAGG - Intronic
1006174390 6:32113273-32113295 GGATGAGAGAGAACAAAAGGTGG + Intronic
1010326918 6:74575065-74575087 CGAGGAGATAGACCAAAACCAGG + Intergenic
1013067278 6:106695986-106696008 GTATGAAACTGACCAAAAGCAGG - Intergenic
1016258613 6:142140489-142140511 GGAAAAAAGAGAACAAAAGCAGG + Intergenic
1016517187 6:144908293-144908315 GGATGAAAGAGAGAAAAAGATGG + Intergenic
1016530983 6:145057931-145057953 GGAGTAAATAGAACAGAAGCTGG - Intergenic
1017091525 6:150763483-150763505 GGATTAACTAGGCCAAAAGTAGG + Intronic
1022334674 7:29411385-29411407 TGATGAAATAGACACAAAGATGG - Intronic
1022409500 7:30127578-30127600 GACTGAAATAGACCGAAAGGTGG + Intronic
1025288312 7:57686502-57686524 AGCTGAAAGAGGCCAAAAGCAGG - Intergenic
1028624444 7:92862618-92862640 GGAAGAAATTGGCCAAAACCAGG + Intergenic
1030098713 7:105925236-105925258 AGCTGAAACAGGCCAAAAGCAGG - Intronic
1031323412 7:120362543-120362565 GTATGAATTATAGCAAAAGCAGG + Intronic
1032566050 7:132945559-132945581 GAATGGAAAAGACCAAAAGAGGG + Intronic
1033071976 7:138211202-138211224 GGAGGAAATAGATTAAATGCAGG + Intergenic
1033221842 7:139531994-139532016 AGATGAAATAGACCAAACCAAGG + Intronic
1034302943 7:150032038-150032060 AGATGAAATAGACCGGAAGAAGG - Intergenic
1034422944 7:150998792-150998814 GGATGAAAAACACCAAAGGAGGG + Intronic
1034530933 7:151696136-151696158 GGGTGAAATAGAACAAAGGCCGG - Intronic
1034803104 7:154065230-154065252 AGATGAAATAGACCGGAAGAAGG + Intronic
1037072776 8:14673049-14673071 GGGTAATCTAGACCAAAAGCTGG - Intronic
1037086968 8:14864243-14864265 GGATGAAATAGAAAAAAAATAGG - Intronic
1037106971 8:15120697-15120719 TTGTGAAGTAGACCAAAAGCAGG - Intronic
1038170870 8:25130290-25130312 GGATCAAAAAAACCAAAAGTTGG + Intergenic
1040076817 8:43245201-43245223 GGATGAAATGGACGAATTGCTGG - Intergenic
1041778214 8:61548021-61548043 GGAGGAAATAGACAAAGATCTGG + Intronic
1043383130 8:79723839-79723861 GGATGCAATAGTCCAAGAGGTGG + Intergenic
1043706837 8:83360743-83360765 AGATTAAATAGAACAAAAGGTGG + Intergenic
1044078136 8:87848340-87848362 TGATGAAACATACAAAAAGCAGG + Intergenic
1044462327 8:92459899-92459921 GGGTGAGAGAGACAAAAAGCAGG - Intergenic
1047751808 8:127887282-127887304 GACTAAAATTGACCAAAAGCAGG + Intergenic
1048514579 8:135094318-135094340 GGTAGGAATACACCAAAAGCAGG + Intergenic
1050116228 9:2266307-2266329 GGATGACATACAGCAAAATCTGG - Intergenic
1050773529 9:9233682-9233704 GGGAGAAATAGACCAAAAAAAGG + Intronic
1050957953 9:11687980-11688002 GGATGATATAGTTAAAAAGCTGG + Intergenic
1056103972 9:83328690-83328712 GGATGAAATGGCCGAAAATCTGG + Intronic
1057503368 9:95613325-95613347 TGGTGAAATATACCCAAAGCAGG - Intergenic
1058196386 9:101981990-101982012 AGTTGAGATAGGCCAAAAGCTGG + Intergenic
1058269704 9:102955448-102955470 GGATGAAAGAGACCAACTGTGGG + Intergenic
1058523166 9:105832120-105832142 AGATGAAAGAATCCAAAAGCAGG - Intergenic
1060123338 9:121017723-121017745 CGATGTAATAGACCAGAAGTCGG + Exonic
1203612235 Un_KI270749v1:20502-20524 AGCTGAAAGAGGCCAAAAGCAGG + Intergenic
1185626152 X:1483869-1483891 GGCTGCCTTAGACCAAAAGCTGG + Intronic
1186884091 X:13895410-13895432 TTTTGGAATAGACCAAAAGCTGG + Intronic
1188187736 X:27135828-27135850 GGAAGAAATAGCCCTACAGCTGG - Intergenic
1193444323 X:81581049-81581071 GTATGAATGAAACCAAAAGCTGG + Intergenic
1193995194 X:88358141-88358163 GGATGAAATATAACAAATGCTGG + Intergenic
1194216465 X:91135257-91135279 GGAAGAAATTGGCCAAAAGAAGG - Intergenic
1198975987 X:142336430-142336452 GGATGAACCAAACCAAAAGTTGG + Intergenic