ID: 906490377

View in Genome Browser
Species Human (GRCh38)
Location 1:46263672-46263694
Sequence ACAGTGATGAAGCAGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906490377_906490389 24 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490389 1:46263719-46263741 GGTCCAAAGCATTGTGGGAGAGG 0: 1
1: 1
2: 0
3: 12
4: 178
906490377_906490383 -4 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490383 1:46263691-46263713 CTGTGGAGGGGGACTATGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
906490377_906490386 18 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490386 1:46263713-46263735 GAGCCAGGTCCAAAGCATTGTGG 0: 1
1: 0
2: 0
3: 9
4: 145
906490377_906490391 28 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490391 1:46263723-46263745 CAAAGCATTGTGGGAGAGGAAGG 0: 1
1: 0
2: 5
3: 35
4: 414
906490377_906490384 3 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490384 1:46263698-46263720 GGGGGACTATGCCAGGAGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 223
906490377_906490387 19 Left 906490377 1:46263672-46263694 CCTGACATCTGCTTCATCACTGT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 906490387 1:46263714-46263736 AGCCAGGTCCAAAGCATTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906490377 Original CRISPR ACAGTGATGAAGCAGATGTC AGG (reversed) Intronic
901952129 1:12757759-12757781 ACAGAGTTGAAGCAGCTGTGTGG - Intronic
905526063 1:38640831-38640853 ATAGTGTTTAAGCAGATATCTGG - Intergenic
905761502 1:40561996-40562018 TTAGTGATGGAGCAGATGTGAGG + Intergenic
906085210 1:43127125-43127147 ATAGTGATGAATGAGGTGTCTGG + Intergenic
906490377 1:46263672-46263694 ACAGTGATGAAGCAGATGTCAGG - Intronic
907669290 1:56460711-56460733 AAACTGGTGAAGCAGATGTCTGG + Intergenic
908973530 1:69867523-69867545 ACAGTTATGAAGCAAATCTGAGG + Intronic
911042562 1:93602414-93602436 GCAGTGATGATGCAGGTCTCAGG - Intronic
912013687 1:105005198-105005220 TGAGTGATGAAACAGCTGTCAGG + Intergenic
912204123 1:107492055-107492077 ACAATGAGGAAGCACATATCAGG - Intergenic
918388481 1:184035609-184035631 TGAGTGGTGAAGCAGGTGTCAGG - Intronic
918962948 1:191303605-191303627 AGAGAGATGATTCAGATGTCAGG - Intergenic
920564139 1:206960367-206960389 CCAGGGATGAGGCAGATGTGGGG + Intronic
920597758 1:207290395-207290417 ACAGTGCTGATCCAGGTGTCAGG - Intergenic
921255045 1:213331506-213331528 ACAGGGATGAAGGAGATGAATGG + Intergenic
921933459 1:220774569-220774591 ACAGAGATTAAGCAGATGAAGGG + Intronic
923191671 1:231626437-231626459 ACAGTGATGGAGAAGATGGAGGG - Intronic
1063619268 10:7630850-7630872 TCGGTGATGAACCAGATGGCAGG + Intronic
1063864626 10:10350719-10350741 ACCGTGTTGAACCAGGTGTCTGG + Intergenic
1064186646 10:13167718-13167740 ACAGTGATAAAGAAGACATCAGG + Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1066442416 10:35450833-35450855 ACAGTGATGGAGCAGTGGGCTGG + Intronic
1067002769 10:42633150-42633172 ACTGCGATGAAGAAAATGTCAGG - Intronic
1070560833 10:77565309-77565331 ACAGTGATGCAGCAGCGGGCGGG + Intronic
1071936858 10:90541613-90541635 AAAGTGATAAGGCAGATATCTGG + Intergenic
1072668040 10:97408724-97408746 ACAAAGAGGAAGCAGAGGTCTGG + Intronic
1073043345 10:100621903-100621925 ACAGTGAGAAAGCAGTTGACAGG + Intergenic
1075343274 10:121663969-121663991 ACAGTGAGGAAGCAGCCATCTGG - Intergenic
1075717060 10:124561896-124561918 ACTGAGATGACACAGATGTCAGG + Intronic
1075745723 10:124725955-124725977 ACATTGCTGAAGCAGGTGCCAGG - Intronic
1076648206 10:131969169-131969191 ACAGTGCTGCAGCAGCTTTCGGG + Intronic
1077649890 11:3961301-3961323 ACAGTGTTGCAGAAGATGTGAGG + Intronic
1078203546 11:9207244-9207266 ACATTAACGAAGCAGATTTCAGG + Intronic
1078558271 11:12348955-12348977 CCAGTGAAGAAGCAGAGGTTCGG + Intronic
1078735985 11:14021404-14021426 GCAGAAATGAAGCAGAAGTCAGG + Intronic
1084368709 11:68722006-68722028 ACACTGATGTAGCAGGTATCTGG - Intronic
1084943743 11:72627882-72627904 ACAGTAATGATGCAGAGGCCTGG + Intronic
1085823879 11:79822317-79822339 AAAGTGGTAAAGAAGATGTCAGG + Intergenic
1089009911 11:115123814-115123836 ACAGTGATGAGCCATATGGCAGG + Intergenic
1089598591 11:119598639-119598661 ACAGGGTTGAAGGGGATGTCAGG + Intergenic
1089857566 11:121559958-121559980 ACAGGGATTAAGCACATGTTAGG - Intronic
1090428409 11:126626461-126626483 ACAGGGCTGAAGCAGAGGTCTGG + Intronic
1092387409 12:8046694-8046716 ACAGTGGTGAAGTTGATTTCAGG + Intronic
1093808601 12:23465618-23465640 AAATTGATGAAGCAGAAGACAGG + Intergenic
1095453995 12:42363213-42363235 ACAGTGATGATACTGGTGTCAGG - Intronic
1096427002 12:51512441-51512463 ACAGAGATGAAGCAGAAATGAGG - Exonic
1097746120 12:63305108-63305130 TCAGTGATGAAGCAGTCTTCAGG + Intergenic
1098210354 12:68157457-68157479 ACTGTGATGAATCACATGGCTGG - Intronic
1102969558 12:117155529-117155551 ACAGTGGCCAATCAGATGTCCGG + Intronic
1103447588 12:121004271-121004293 ACAGTCCAGAAGCAGAAGTCAGG - Exonic
1105318510 13:19291807-19291829 ACCATGATGAAGCAGATGAATGG - Intergenic
1106143149 13:27027742-27027764 ACAGTCATGAAAAAGATGTTGGG + Intergenic
1107390790 13:39961692-39961714 ACACTGTGGAAGCAAATGTCTGG - Intergenic
1108802754 13:54119609-54119631 ACAGTGAAGAAGTAGCTGACAGG + Intergenic
1110297991 13:73891960-73891982 GTAGTGATGAAGCAGTTTTCTGG - Intronic
1112800885 13:103108644-103108666 GCAGTGATGAGGCAGTAGTCAGG + Intergenic
1113769719 13:112900301-112900323 GCAGAGATGAAGCAGGTGCCCGG + Intronic
1117896215 14:60489994-60490016 AAAGTGATAATGCAGAGGTCAGG - Intronic
1118987121 14:70766026-70766048 CCAGTGATTAACCAGATGTAGGG + Intronic
1123980373 15:25596747-25596769 ACAGTGTGGAAGCTGAGGTCTGG - Intergenic
1127158929 15:56159732-56159754 ACAGTTCAGAAACAGATGTCCGG - Intronic
1127290610 15:57567380-57567402 TCAGTAATGATGAAGATGTCAGG + Intergenic
1129884100 15:79026676-79026698 AGGGTGATGGAGCAGATTTCTGG + Intronic
1132270083 15:100516564-100516586 ACAGGAAAGAATCAGATGTCAGG + Intronic
1133783565 16:8958015-8958037 ACAGTAATGCAGGAGATGGCTGG - Intronic
1134750455 16:16620832-16620854 ACAAAGATGAAGCAGATAGCAGG - Intergenic
1134994999 16:18732758-18732780 ACAAAGATGAAGCAGATAGCAGG + Intergenic
1136407182 16:30054850-30054872 ACAGCGATGAAGACGATGGCAGG - Exonic
1136507746 16:30716417-30716439 GCGGTGCTGAAGCAGATGCCTGG - Exonic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1140672471 16:77292656-77292678 ACATTGATCAAGCCTATGTCTGG - Intronic
1141403228 16:83769336-83769358 ACGGTGGGGAAGCAAATGTCAGG + Intronic
1146212337 17:30952320-30952342 AAAGTTCTGAAGCAGAAGTCGGG - Intronic
1146241060 17:31226571-31226593 TCTGTGAGGAAGCAGATATCCGG + Exonic
1148203449 17:45765153-45765175 ACCTTGGTTAAGCAGATGTCAGG + Intergenic
1148644682 17:49212653-49212675 ACAGTGAGGAAGCTGAGGTTTGG + Intronic
1148719030 17:49737486-49737508 ACAGTGATGAAGCAGCCTTTAGG - Intronic
1150007463 17:61478735-61478757 ACAGAGATGAAGGAGGTCTCTGG - Exonic
1156637724 18:39051209-39051231 ACAGCAATGAATCAGGTGTCTGG + Intergenic
1156867321 18:41903572-41903594 AAAGTGTTGAAGGAGTTGTCTGG + Intergenic
1158568815 18:58579274-58579296 ACAGAGATGAAGCTCTTGTCTGG - Exonic
1159072707 18:63643954-63643976 AGAGTCTTGAAGGAGATGTCAGG - Intronic
1159074152 18:63661591-63661613 AGAGTCTTGAAGGAGATGTCAGG - Intronic
1159442705 18:68501809-68501831 ACAGTGACAAGGCAGCTGTCTGG + Intergenic
1159634418 18:70788061-70788083 AAACTGATGATGAAGATGTCAGG + Intergenic
1159871574 18:73764040-73764062 ACAGTGATGGGGCAGATGAGTGG - Intergenic
1160536569 18:79597706-79597728 TCTGTGATGAGGCAGATGCCAGG + Intergenic
1165826290 19:38707756-38707778 GCAGTTATAAAGCAGTTGTCAGG + Intronic
1167664463 19:50815845-50815867 AGAGTCAAGAAGCAGAGGTCAGG - Intergenic
925715863 2:6783634-6783656 ACCGTAAGGAAGCAGATGCCAGG + Intergenic
928567954 2:32572775-32572797 CCAGTGATGATGCAGAGGACAGG - Intronic
930416045 2:51092727-51092749 ACAGTGAGAAAGCAGATGTTCGG - Intergenic
931127038 2:59289603-59289625 ACAGTGAGGAAGTAGTTGGCTGG - Intergenic
934605310 2:95690715-95690737 AGAGTGATGAAGGAGAAGCCAGG + Intergenic
935185837 2:100732085-100732107 ACAGGCATGAGGCAGAAGTCTGG + Intergenic
936538767 2:113333268-113333290 AGAGTGATGAAGGAGAAGCCAGG + Intergenic
937079824 2:119132923-119132945 AGGGTGATTAAGCAAATGTCAGG - Intergenic
938683826 2:133717755-133717777 ACACTGATAAATCTGATGTCTGG + Intergenic
939437644 2:142199418-142199440 AAAGTGAAGAAGGAGATGTTGGG - Intergenic
942919160 2:181350111-181350133 CCAGTGATGAAGCAGATACAGGG + Intergenic
943719057 2:191183712-191183734 ACACTGATAAAGCAGATGAAGGG + Intergenic
944531531 2:200672739-200672761 AGAGTGATGGAGCAGGTGGCAGG + Intronic
947177986 2:227386504-227386526 AGAGTGATGAAGCTGATGTTTGG - Intergenic
947682770 2:232050882-232050904 ACAGAGATGAAGGAGGTGTATGG + Intronic
1170141694 20:13131343-13131365 CCATTCATGGAGCAGATGTCAGG - Intronic
1170783157 20:19445103-19445125 AAAGAGATGAAGCAGATATAAGG - Intronic
1173323170 20:42008005-42008027 AGAGGGGTGAAGCAGATGTTAGG - Intergenic
1174636446 20:52004929-52004951 ACACAGCTGAAGCAGATGGCAGG - Intergenic
1175245296 20:57578656-57578678 ACAGTGGTGGAGGAGCTGTCAGG - Intergenic
1178226664 21:30726962-30726984 ACTGTGCTGAAACAGATTTCTGG - Intergenic
1178502330 21:33136013-33136035 ACAGTGAGCAAACAGAAGTCAGG + Intergenic
1179444158 21:41419965-41419987 ACAGAGATGAAGGAAAAGTCTGG + Intergenic
1180091091 21:45534169-45534191 ACAGTGCAGAAGCCGATGGCTGG - Intronic
1181345793 22:22219769-22219791 ACATTGTTGGAGCAGGTGTCAGG - Intergenic
1181788020 22:25241645-25241667 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1181819764 22:25466660-25466682 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1183714388 22:39525268-39525290 GCAGAGATGAAGTTGATGTCTGG + Intergenic
1183958961 22:41399445-41399467 ACTGTGATGAAGGGGGTGTCTGG - Intergenic
1185132657 22:49048355-49048377 ACAGTGATGAGGCAGATAGCTGG - Intergenic
950120226 3:10476853-10476875 CCAGTGAGGAAGCAGATGGAGGG + Intronic
950553852 3:13683697-13683719 ACAGTGAGGAAGCAGGAGTATGG - Intergenic
953108166 3:39906242-39906264 ACAGAGATGAAGGAAAAGTCAGG - Intronic
954001933 3:47564554-47564576 AGAGTACTGAGGCAGATGTCAGG + Intronic
954263596 3:49457230-49457252 ACAATGAGGAGTCAGATGTCAGG + Intergenic
955877519 3:63508417-63508439 ACAGAGCTGACTCAGATGTCAGG + Intronic
960583570 3:119300896-119300918 GCAGAGCTGAAGCAGAAGTCAGG + Intronic
961485374 3:127212169-127212191 ACAGTGATGGAGCAGGTACCAGG + Intergenic
964617398 3:158682716-158682738 ACAGTCATAAAGCAAATGACTGG - Intronic
964648039 3:158979725-158979747 ACTGTTATGCAGCAGATGACTGG - Intronic
965464633 3:169012731-169012753 ATAGTGATGAAGCAGATCCGTGG + Intergenic
967053967 3:185811786-185811808 ACAGTGATGGAGCACATGGCAGG + Intronic
980464042 4:133151206-133151228 ACGGTGCTGAAGCTGATCTCTGG - Exonic
981636003 4:146879936-146879958 ACAGTGATGATGAAGATTTGTGG - Intronic
983448308 4:167880255-167880277 ACAGTGAAGAAGGAAATGTGGGG - Intergenic
984499727 4:180544539-180544561 ACAGTGATGATGCTGATGGCTGG - Intergenic
987937327 5:24482833-24482855 TCAGTGCTGAAGCAGATTGCAGG + Intergenic
992392042 5:76338346-76338368 AAGGTGAGGAAGCAGATGTTAGG - Intronic
993351599 5:86856807-86856829 ACAGTGAGAAGGCAGCTGTCTGG - Intergenic
993839867 5:92865108-92865130 TGAGTGATGCAGCAGATATCAGG - Intergenic
994527636 5:100926700-100926722 ACAGTTCTGAAGGAGATCTCTGG + Intergenic
995174561 5:109160267-109160289 ACAGTGATGAATCAAACGACAGG + Intronic
996095834 5:119398195-119398217 ACAGTTATGCAGCTGATGTCAGG - Intronic
996740496 5:126794342-126794364 ACAGTGTTGAAGCTGATGAGTGG + Intronic
997035622 5:130187994-130188016 AGAGTTATGAAGCAGCTGCCAGG + Intergenic
1003610706 6:7612523-7612545 ACAGAGATGAAGCAGGAGCCTGG + Intergenic
1004639539 6:17501735-17501757 ACAGAGATGAAGCTGATAACAGG + Intronic
1004952558 6:20690440-20690462 ACAGTGTTGAAAAATATGTCTGG - Intronic
1005327292 6:24715178-24715200 ACAATAATGAAGCAGAAGTCAGG - Intronic
1006632620 6:35440201-35440223 ACAGTGATGAAGTGGATGGTGGG - Intergenic
1009396043 6:63202153-63202175 ACACTAAAGAAGCATATGTCAGG + Intergenic
1010547709 6:77178639-77178661 ACAGTGTTGATGAAGATGTGTGG - Intergenic
1010722783 6:79302711-79302733 ACAGTCAAGAAGCATATGTTGGG - Intergenic
1012556289 6:100516648-100516670 ACACTCATTAAGCACATGTCAGG - Intronic
1013796588 6:113895692-113895714 ACAGTGAACAAGCAGACGTTTGG + Intergenic
1015119312 6:129684115-129684137 TCAGTGATGACTCAGATGTCAGG + Intronic
1017995736 6:159530270-159530292 TCAGTACTGAAGCAGATGGCGGG - Intergenic
1019134970 6:169902308-169902330 ACAGTGATGAAGGCGATGGTGGG + Intergenic
1021071065 7:16241818-16241840 CCAGTGATAAAGGAGATTTCAGG - Intronic
1021793548 7:24229988-24230010 ACAGAGATGAAGGTGATATCAGG - Intergenic
1021934052 7:25612653-25612675 AGAGAGATGAAGCCAATGTCTGG - Intergenic
1022284214 7:28939635-28939657 ACAGGGAGGAAGCAGCCGTCTGG - Intergenic
1023176097 7:37437144-37437166 ACAGTGAAGGAGCAATTGTCAGG - Intronic
1023888941 7:44379352-44379374 ACAGAGATGAGGCAGTTGGCGGG + Exonic
1024990482 7:55231495-55231517 ACAGTCTTGTAGGAGATGTCTGG + Intronic
1026918025 7:74134297-74134319 ACAGTGATGAAACTGACCTCTGG + Intergenic
1028586152 7:92453837-92453859 ACAGTCATGAAGCAGTAGTAAGG - Intronic
1028941414 7:96526227-96526249 ACAGTGATAAAACAGTTCTCTGG + Intronic
1030402788 7:109073727-109073749 ATAAGCATGAAGCAGATGTCAGG + Intergenic
1032043103 7:128577834-128577856 ACAGTGATTCAGGAGTTGTCTGG + Intergenic
1034743094 7:153496459-153496481 ACAGAGATGAGGCAGATGCAGGG - Intergenic
1035121091 7:156567645-156567667 GCAGTGATGAAACAGAAGTGGGG + Intergenic
1035544462 8:468745-468767 ACAGGCGTGAAGCAGCTGTCAGG - Exonic
1036910235 8:12752992-12753014 AAAGCGAGGAAGCAGATGCCAGG - Intronic
1038315105 8:26477748-26477770 AAAGTGTTGAAGCAAATATCTGG - Intronic
1039371642 8:36990277-36990299 TCAGTGATGAAACAGATATTTGG + Intergenic
1041407494 8:57516199-57516221 ACAGTCAAGAAGCAGAGGACAGG - Intergenic
1041753359 8:61285791-61285813 ATATTTATGAAGGAGATGTCAGG + Intronic
1044076776 8:87831719-87831741 ACAATGTTGAAGGAGAGGTCTGG + Intergenic
1045778168 8:105831332-105831354 ACAGGGATGAGGCATATCTCTGG + Intergenic
1047379228 8:124342134-124342156 ACAGTGATGATACAGTTGACAGG - Intronic
1047680635 8:127250868-127250890 ACAGTGAAGATGCAAATGTGTGG - Intergenic
1047908152 8:129495015-129495037 AAAGTGATGAAGCAGATTTGGGG + Intergenic
1048070575 8:131016722-131016744 ACAGGGATGAAGAAGGTGTAGGG + Intronic
1048630302 8:136234957-136234979 CCAGTGAAGAAACATATGTCAGG - Intergenic
1049156016 8:141067305-141067327 ACAGTGAGGAACCAGGTGCCAGG - Intergenic
1049304341 8:141892459-141892481 ACAGGGATGGAGCAGAGATCAGG + Intergenic
1051485521 9:17604104-17604126 AAAGTGTTGGAGCAGATGACAGG - Intronic
1051951545 9:22640271-22640293 ACTGGGATGAAGCAGAAGGCAGG + Intergenic
1053444194 9:38139036-38139058 TCCGTGTTGAAGCAGGTGTCAGG + Intergenic
1057829470 9:98395748-98395770 ACATGGATGAAGCAGATTTAGGG + Intronic
1058132177 9:101265538-101265560 ACAGTGATAAATCATATCTCAGG + Intronic
1058204670 9:102088501-102088523 ACAGTTATGAAGCACAGTTCTGG + Intergenic
1062074391 9:134576615-134576637 TCAGGGATGAAGCAGACATCAGG - Intergenic
1185683255 X:1906362-1906384 CCAGTGATGGAGGAGAGGTCTGG + Intergenic
1186692650 X:11995297-11995319 ACTGTGAAGAAACAGATGTCAGG - Intergenic
1187815944 X:23231935-23231957 AAAGTGAAGAAGCAGAAGTCAGG - Intergenic
1189296201 X:39920012-39920034 ACAGTGGTCAAGCAGTTGGCTGG - Intergenic
1189952116 X:46243595-46243617 ACAGAGATGAAGAATGTGTCTGG - Intergenic
1193698634 X:84738864-84738886 TCTGTGATGGAGCAGCTGTCAGG + Intergenic
1194662134 X:96639287-96639309 ACAGTGAGGAAGAAAATGTGGGG + Intergenic
1195550152 X:106159941-106159963 ACTGTGATGAGGTAGTTGTCAGG + Intergenic
1195679629 X:107534635-107534657 ACACTGATGCAGAAGAGGTCTGG - Intronic
1196827857 X:119755007-119755029 ACAGTTGAGAAGCAGATGTGTGG - Intergenic
1198766905 X:140089760-140089782 ACTGTGATGCACCAGATGTAGGG + Intergenic
1199297020 X:146170943-146170965 ACAGAGAGGAAGGAGAAGTCGGG - Intergenic
1199344703 X:146724802-146724824 ACAGTAATGAAGCACATGCTGGG + Intergenic
1200208078 X:154332359-154332381 ACAGTCAAGAAGCAGATTTGGGG - Intergenic