ID: 906490720

View in Genome Browser
Species Human (GRCh38)
Location 1:46266472-46266494
Sequence ATGTAGTTCTTGGAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906490711_906490720 23 Left 906490711 1:46266426-46266448 CCAGTATGGGGCTGGATGTAGAA 0: 1
1: 0
2: 0
3: 3
4: 110
Right 906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 314
906490709_906490720 25 Left 906490709 1:46266424-46266446 CCCCAGTATGGGGCTGGATGTAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 314
906490715_906490720 -10 Left 906490715 1:46266459-46266481 CCTAATCTTGCCCATGTAGTTCT 0: 1
1: 0
2: 1
3: 15
4: 178
Right 906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 314
906490710_906490720 24 Left 906490710 1:46266425-46266447 CCCAGTATGGGGCTGGATGTAGA 0: 1
1: 1
2: 0
3: 13
4: 147
Right 906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 314
906490708_906490720 29 Left 906490708 1:46266420-46266442 CCTTCCCCAGTATGGGGCTGGAT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906490720 Original CRISPR ATGTAGTTCTTGGAGAAAGA GGG Intronic
901029470 1:6298684-6298706 ATGTTGTTATTGGAAATAGAAGG + Intronic
901486586 1:9567282-9567304 AGGTCGATCTTGGAGAAAGAGGG + Exonic
903868184 1:26413050-26413072 AAGTAATTGTGGGAGAAAGAAGG + Intronic
904995935 1:34631303-34631325 ATTTAGGTCTTGGAGAACCAGGG + Intergenic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
906573617 1:46867312-46867334 ATTTACATCTTGGAGAAAGAGGG + Intergenic
906598246 1:47099593-47099615 ATTTACATCTTGGAGAAAGAGGG - Intronic
907084686 1:51660030-51660052 ATTTGGGTCTTGGAGAAAGCTGG + Intronic
907796827 1:57726103-57726125 TTCTAGTTCTTGGAGATACAGGG + Intronic
909066700 1:70943573-70943595 GGGTAATTCTTGGAAAAAGAAGG - Intronic
909364383 1:74802259-74802281 ATGGAAATATTGGAGAAAGAAGG - Intergenic
909810847 1:79930480-79930502 AGGTAGATCTTGGAGAATGATGG + Intergenic
909827986 1:80149942-80149964 TTCTAGTTCTTGAAGAATGATGG + Intergenic
910150049 1:84131923-84131945 TCGTAGTTCTTGCAGAGAGAGGG + Intronic
910775736 1:90872853-90872875 TTGTAGTTCTTGTAGAGACAGGG + Intergenic
911578862 1:99612066-99612088 ATGGAGTTCATTGAGAAATAGGG - Intergenic
911716067 1:101134542-101134564 CTGTAGGTCTTGGAGAAGGTGGG - Intergenic
911888925 1:103342075-103342097 ATGTAGATCTTGAAGAAGGCAGG + Intergenic
914255589 1:145959595-145959617 TTGTAGTTGTTGGAGGAACAGGG + Exonic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
914919757 1:151838967-151838989 ATGTGGCTCTTGGAAAAAGCTGG - Exonic
915184737 1:154095775-154095797 ATAAAGTTCTTGGAGAAATATGG - Intronic
915872560 1:159576567-159576589 ATGTAGCTCTTGAAGAAAGCAGG - Intergenic
916844526 1:168635886-168635908 ATGTAGTATTTGTAGAGAGAAGG - Intergenic
918261621 1:182801430-182801452 GTGAAGTTCATGGAGAAAAAAGG + Intronic
918635381 1:186768008-186768030 ACGTACTTCATGGAGAGAGAGGG + Intergenic
919457649 1:197838929-197838951 ATGAAGTCCATAGAGAAAGAGGG - Intergenic
920327845 1:205180635-205180657 TTGTATTTTTTGTAGAAAGAGGG + Intronic
921492281 1:215792285-215792307 ATGAAGCTCTTTGTGAAAGAAGG - Intronic
922206845 1:223455508-223455530 ATGTATTTCTAGGAGATACAGGG + Intergenic
1065410409 10:25420828-25420850 ATGTAGTACTGGCATAAAGAGGG - Intronic
1066088699 10:31996409-31996431 TTGTATTTTTTGTAGAAAGAGGG - Intergenic
1067111004 10:43399994-43400016 ATGAATTTCATGTAGAAAGAAGG + Intronic
1067846949 10:49732046-49732068 ATGTTATTATTGGAGAAAAATGG - Intergenic
1068369860 10:56098327-56098349 ATGTATTTTTTGGAGAGAGAGGG - Intergenic
1068998300 10:63234319-63234341 TTGTATTTCTTGTAGAAACAGGG - Intronic
1070601113 10:77866996-77867018 ATGTGTTTCTTGGAGCAGGATGG - Intronic
1071482903 10:86078540-86078562 ATGAAGTCTTTTGAGAAAGAAGG - Intronic
1071719279 10:88126907-88126929 ATGGAGTCTTTGGAGAATGAAGG + Intergenic
1071955018 10:90748548-90748570 ATGTCATTTATGGAGAAAGAAGG + Intronic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1073625842 10:105095929-105095951 ATGTAGTTCCCAGAGTAAGATGG + Intronic
1073989759 10:109249167-109249189 ATGAAGTTATTGGGGAAAGGGGG + Intergenic
1078795420 11:14587336-14587358 GAGTAGATCTGGGAGAAAGAAGG - Intronic
1079405990 11:20146179-20146201 AGGTAGTTTGTAGAGAAAGAAGG + Intergenic
1080306922 11:30846529-30846551 TTGTTCTACTTGGAGAAAGAGGG - Intronic
1081406787 11:42707632-42707654 ATGCAGAACTTGGAGAAAAATGG + Intergenic
1082205926 11:49434182-49434204 AAGTCGATCTTGGAGAAAGAGGG - Intergenic
1082213934 11:49543825-49543847 ATGTAGTTATTAGGAAAAGAAGG + Intergenic
1083063759 11:59901547-59901569 ATGTAATGTTTGGACAAAGAAGG - Intergenic
1083260892 11:61522488-61522510 ATGTTCTTCTTGTAGAAAGTTGG - Intronic
1084144090 11:67254750-67254772 AGGTAGTTGTGGGACAAAGAGGG + Intronic
1084279244 11:68076419-68076441 ATGTTGGGCTTGGAGTAAGATGG - Intronic
1085981527 11:81732365-81732387 CTGTAGTTCTTGCAGACACATGG + Intergenic
1086635668 11:89080664-89080686 ATGTAGTTATTAGGAAAAGAAGG - Intergenic
1086770017 11:90750477-90750499 ATATAGTAATTGAAGAAAGAAGG - Intergenic
1087398036 11:97627397-97627419 GAGTAGTTCTTGGGAAAAGATGG + Intergenic
1088094179 11:106078296-106078318 AGGGAGTCCTTGGAGAATGATGG - Intronic
1088864106 11:113830082-113830104 ATGTATTTTTTGGAGAAACTGGG - Intronic
1089127097 11:116184275-116184297 ATGTAGATTTTGGAGAAAATGGG - Intergenic
1089400617 11:118162313-118162335 ATGCAGTTCATGGAGAAGGGTGG - Exonic
1089477508 11:118777064-118777086 ATGTAGTCATTAGAGGAAGATGG - Intronic
1092656269 12:10688421-10688443 AGATAGATCTTGGAGAATGACGG - Intergenic
1092801976 12:12177362-12177384 ATACACTTCTTGGAAAAAGAGGG + Intronic
1093121919 12:15280746-15280768 ATATAATTCATGGTGAAAGATGG - Intronic
1093448684 12:19290252-19290274 ATGTAGTTCTGTTAGAAAGTTGG + Intronic
1094121738 12:26982206-26982228 TTGTATTTTTTGGAGAAACAGGG + Intronic
1096077507 12:48814665-48814687 CTGCAGTTCCTGGAGAAAGGAGG + Intronic
1096426124 12:51504721-51504743 CTGTAGTTCTGGGAGCAAGGGGG + Intronic
1096497138 12:52045201-52045223 CTGTAGTTCCTGGAGCAGGAGGG + Intronic
1096745330 12:53723329-53723351 ATGCAGTGCATGGAGAAGGAAGG + Intronic
1098263689 12:68697253-68697275 ATGTATTTCTTGTAGAGACAAGG - Intronic
1098715981 12:73828916-73828938 AGGTGGATCTTGGAGAATGACGG + Intergenic
1098831456 12:75369105-75369127 ATGTAGACCTTGGAGTCAGATGG + Intronic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1100844781 12:98646424-98646446 ATGTAGCACTTGGAAAAACAGGG - Intronic
1101616440 12:106342489-106342511 ATGGTGTTCTAGGAGGAAGAGGG + Intronic
1103369267 12:120406399-120406421 AGGGAGTTCTTGGAGGAAAATGG - Intergenic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1103883950 12:124187320-124187342 TTGTATTTTTTGTAGAAAGAGGG + Intronic
1104374680 12:128253875-128253897 ATGTTATTTTTGAAGAAAGAAGG - Intergenic
1104456455 12:128917447-128917469 CTGTATTTTTTGGAGAGAGAGGG + Intronic
1104623557 12:130336286-130336308 TTGTATTTCTTGTAGAAAGAGGG - Intergenic
1105376773 13:19853022-19853044 ATAAAGTTCTTGGAGAGAGGAGG + Intronic
1106428645 13:29658202-29658224 AATAAGTTCTTGGAGAGAGATGG - Intergenic
1106835355 13:33628437-33628459 ATGTAATTCTGAGAAAAAGAAGG - Intergenic
1107357468 13:39583345-39583367 ATGTATTTTTTGTAGAAACAGGG + Intronic
1108083147 13:46757979-46758001 ATGTATTTCAGGGAGAAGGAAGG + Intergenic
1108895017 13:55315255-55315277 ACGGAGTTTTTGGAGAAAGCAGG + Intergenic
1109703374 13:66056603-66056625 TTGTCATTCTTAGAGAAAGAAGG - Intergenic
1110579830 13:77109010-77109032 AAGTACTATTTGGAGAAAGAAGG + Intronic
1112182767 13:97101414-97101436 AGTTATTCCTTGGAGAAAGAAGG - Intergenic
1112777570 13:102862163-102862185 GTAAAGTTCTTGGAGAAGGAGGG - Exonic
1113143898 13:107185604-107185626 AAAGAGTTATTGGAGAAAGAGGG - Intronic
1115975597 14:38993085-38993107 TTTTAGTTCTTTGAGAAAGGAGG - Intergenic
1117257749 14:53997207-53997229 ATGTAGTTTTTGGGGTCAGAAGG + Intergenic
1117381456 14:55167880-55167902 ATGTAACTCTGGGATAAAGAGGG - Intronic
1118040757 14:61913961-61913983 AAGCAGGTCTTGGAGAAATAAGG + Intergenic
1118551006 14:66950517-66950539 AAGCAGTTCTTTGAGATAGAAGG - Intronic
1119190992 14:72681605-72681627 ATGTAAGTATTGGATAAAGATGG - Intronic
1119289208 14:73481455-73481477 ATGTATTGCTAGGTGAAAGAAGG + Intronic
1119847143 14:77839126-77839148 ATGTAGTCATGGGATAAAGAGGG + Intronic
1120373970 14:83676476-83676498 GTGTACTTTTTGGAGGAAGAAGG - Intergenic
1121748096 14:96318694-96318716 AGGTAGTTCTTTGAAAAAGTAGG - Intronic
1124821266 15:33047833-33047855 ATGGAGTCCTTGGAGGAATAGGG - Intronic
1127149751 15:56061100-56061122 ATGTAATTTTTGTAGAGAGAAGG - Intergenic
1127564612 15:60174934-60174956 CTGTAGTGAATGGAGAAAGAAGG - Intergenic
1129594604 15:76952523-76952545 ATGAAGTTCATGGAGATGGAAGG - Intronic
1130349489 15:83078674-83078696 CTCTAGATCTTGGAGAAAGAGGG - Intergenic
1130774359 15:86962735-86962757 ATATGGTTCTTGGAAAAGGAAGG + Intronic
1133401941 16:5494539-5494561 AGGGAGGTCTTGGAGCAAGAGGG + Intergenic
1134095043 16:11413467-11413489 CTGTGGCTCTTGGAGAAGGAGGG + Intronic
1134410955 16:14002919-14002941 GTGAGGTTCTGGGAGAAAGATGG + Intergenic
1135410395 16:22229922-22229944 TTTTAGTTCTTGGAGATAGTTGG + Intronic
1137929405 16:52572611-52572633 ATGTGGGTCAGGGAGAAAGAAGG + Intergenic
1139846494 16:69925000-69925022 GTGTGGTTCTTGGAGAAAGTTGG + Intronic
1140656910 16:77150499-77150521 ATTTAGTCCATGTAGAAAGAAGG + Intergenic
1140906848 16:79416250-79416272 ATGGAGTTCTTGGGGATTGAGGG + Intergenic
1144308685 17:13992670-13992692 AAGGAGTTCTTTGAGAAGGAGGG - Intergenic
1144890479 17:18491364-18491386 GTTTAGTTCTTGGGGAAGGAGGG - Intronic
1145141738 17:20452954-20452976 GTTTAGTTCTTGGGGAAGGAGGG + Intronic
1145681307 17:26596508-26596530 TTGTAGGTCCTGGAAAAAGAGGG - Intergenic
1145707309 17:26884142-26884164 TTGTAGGTCCTGGAAAAAGAGGG + Intergenic
1146253128 17:31367827-31367849 TTGTATTTTTTGTAGAAAGAGGG - Intronic
1146803673 17:35848037-35848059 ATGTAGTTCTTTGTGACTGAAGG + Intronic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1154325784 18:13389515-13389537 GAGTAGTTCTGGGAGGAAGAGGG + Intronic
1154382510 18:13865432-13865454 ATTTGGTTCTTGGAGAAGGCTGG + Intergenic
1155014667 18:21821507-21821529 AGGTAGCTCTGGAAGAAAGACGG - Intronic
1155259748 18:24030123-24030145 AAGTAGTTCTTGTTGAAGGATGG + Intronic
1156614636 18:38769042-38769064 ATATAGTTATTGAAAAAAGAAGG - Intergenic
1156684264 18:39625744-39625766 GTGCATTTCATGGAGAAAGAGGG - Intergenic
1157251909 18:46102772-46102794 TTGTATTTTTTGTAGAAAGAGGG - Intronic
1157788155 18:50505480-50505502 ATGTAGTTGCTTCAGAAAGAGGG + Intergenic
1158733586 18:60054269-60054291 ATGTGGCTCTTGGAGACAGCAGG - Intergenic
1159354395 18:67318926-67318948 ATGTAGGACATGGAGAAAGATGG - Intergenic
1159514390 18:69438896-69438918 TTGTAGTTTTTGTAGAAACAAGG - Intronic
1159693487 18:71522460-71522482 ATTTAGTTCTTGCATAAATATGG + Intergenic
1161649575 19:5476134-5476156 TTGTAGTTTTTGGAGAGACAGGG - Intergenic
1162326047 19:10000289-10000311 ATTTTGGTCTTGGAGAAAGATGG - Intronic
1162852788 19:13444084-13444106 ATGTGGTTCCTGGTGAAACATGG + Intronic
1163173888 19:15551280-15551302 ATGCAATTCCTGGAGGAAGAGGG - Exonic
1163318761 19:16559445-16559467 GTGTATTTTTTGTAGAAAGAAGG - Intronic
1164391448 19:27825706-27825728 ATTTAGTTGATAGAGAAAGATGG + Intergenic
1166355372 19:42224373-42224395 AGGCAGTGCCTGGAGAAAGAGGG - Exonic
1166536530 19:43578181-43578203 ATGTAGGTCTTGTAGACAGCAGG - Intronic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167803749 19:51764400-51764422 AGGTACTTTTTGGAGAAAGCAGG + Intronic
925558782 2:5164701-5164723 ATGAACTCCATGGAGAAAGAAGG - Intergenic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
930790104 2:55316541-55316563 ATTTAGTTTTTGTAGAAATAGGG - Intronic
931772639 2:65511474-65511496 ATGTAGTTTCTTAAGAAAGAAGG + Intergenic
932698067 2:73973484-73973506 AAGTAGGTCTTTGAGAGAGAAGG - Intergenic
933331873 2:80902643-80902665 ACATAGTTCTTGGAGAAGGCTGG + Intergenic
935519423 2:104085459-104085481 GTGTCCTTCTTAGAGAAAGAGGG + Intergenic
935749472 2:106218402-106218424 ATTGAATTCATGGAGAAAGAAGG + Intergenic
936810703 2:116397612-116397634 ATTTAGGTATTGTAGAAAGAAGG - Intergenic
937635140 2:124147099-124147121 ATACAGAGCTTGGAGAAAGACGG + Intronic
938763253 2:134443753-134443775 ATATAGCTCTTGGAGTAAGGTGG + Intronic
938847743 2:135228561-135228583 ATTGAGGTCTGGGAGAAAGATGG + Intronic
938935300 2:136122284-136122306 CTGTAGGTGTTGGAGACAGAAGG - Intergenic
939435983 2:142178486-142178508 ATGTAGGCCTTGGAGATACAGGG + Intergenic
940615097 2:156039380-156039402 ATGTAGTCATTGGAGAAAAAAGG - Intergenic
940776561 2:157890879-157890901 TTTTATTTCTTTGAGAAAGAAGG + Intronic
941053827 2:160765219-160765241 ATTTAATTCTAGCAGAAAGATGG - Intergenic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
941922347 2:170863820-170863842 ATGTACTACTTGGAGAAGAAAGG - Intergenic
941955806 2:171203110-171203132 ATGTAATTTTAGGAGAAATAAGG + Intronic
942075463 2:172353082-172353104 AGGTAGTTCTCAGAGAAAGCAGG + Intergenic
942822630 2:180133794-180133816 ATATAGTTCTTGAAGAAGGGTGG - Intergenic
944355189 2:198779033-198779055 ATGGAACTCTTGAAGAAAGAGGG - Intergenic
944508323 2:200438695-200438717 ATGTAGCACTTGGAGATAGGAGG + Intronic
944919459 2:204396126-204396148 ATTATGATCTTGGAGAAAGATGG + Intergenic
945006708 2:205416431-205416453 ATTAGGTTCTTGGAGAAACAGGG + Intronic
945407879 2:209471746-209471768 ATATAGTTCCTTGAGAATGAAGG + Intronic
945979980 2:216301759-216301781 ATGTGGTTTTTGGAGAATGTTGG + Intronic
946891618 2:224282841-224282863 ATGTAGTCCCTGGAAAAGGAAGG - Intergenic
947090578 2:226506812-226506834 TTGTAGTTTTTGTAGAGAGAGGG - Intergenic
947973676 2:234345575-234345597 TTTGAGTTCATGGAGAAAGAAGG - Intergenic
948161390 2:235827789-235827811 ATGTAGGCCTTGAAGATAGAGGG + Intronic
948686551 2:239674046-239674068 ATGATGTTCTTGCAGACAGATGG - Intergenic
1169947492 20:11004790-11004812 ATGAAGTTCTAGGAGAAGGAGGG - Intergenic
1169962690 20:11179340-11179362 CAGAAGTTCTTAGAGAAAGACGG - Intergenic
1170269543 20:14509053-14509075 ATCTAGTTTTAGGAGAAAGCAGG + Intronic
1172251819 20:33485003-33485025 ATTTAGTTTTTGTAGAAACAGGG + Intergenic
1178214827 21:30583312-30583334 ATGTAATTCTTAGAGCAAGAGGG - Intergenic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1180893595 22:19310433-19310455 TTGTACTTCTTGTAGAAACAGGG + Intergenic
1184998791 22:48229062-48229084 ATGTCCTTATTAGAGAAAGATGG + Intergenic
1185181848 22:49368271-49368293 GTGAAGATCTTGGAGCAAGAGGG - Intergenic
950183970 3:10933802-10933824 ATGAATTTCTGGGAGAAAGGCGG - Intronic
954559863 3:51547752-51547774 TTGTATTTTTTGGAGAGAGAGGG + Intronic
956012206 3:64843932-64843954 ATGCATTTCATGGGGAAAGAAGG - Intergenic
956314515 3:67919662-67919684 ATGTGGTTCTTGCAGCAACATGG - Intergenic
958993166 3:100871322-100871344 ATGTAGTTTTTAAAGAAACATGG + Intronic
959080384 3:101794685-101794707 GTGTAGTTCTTGGGTAGAGAAGG + Intronic
959182323 3:102997322-102997344 TTTTAGTTTTTGGAGAAACAGGG - Intergenic
959358083 3:105357310-105357332 AGGTAATTTTTGGAGAAAGCTGG + Intergenic
960170554 3:114455598-114455620 ATCTAGATCTTGGAGGGAGAAGG + Intronic
963204075 3:142614859-142614881 ATTTCCTTCCTGGAGAAAGAGGG + Intronic
965418623 3:168428278-168428300 ATGAAGTTAAGGGAGAAAGAGGG + Intergenic
965455190 3:168891162-168891184 ATTTAGTGCTTGGACAGAGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967366499 3:188692488-188692510 AATTAGGTCTTGGACAAAGATGG - Intronic
967560565 3:190913370-190913392 AGGTGGTTCTGGGAGATAGAAGG - Intergenic
967687159 3:192431025-192431047 ATCTGGTGCTTGGAGAAAGTGGG - Intronic
969197270 4:5573033-5573055 ATTTAATCCTTGCAGAAAGATGG - Intronic
970150536 4:13084791-13084813 CTGTAAGTCTTGGATAAAGAAGG - Intergenic
970892175 4:21059393-21059415 ATGTAATTTTGTGAGAAAGAAGG - Intronic
972704135 4:41524700-41524722 ATTTAGCTCTTTGAGAATGAAGG - Intronic
972932895 4:44096365-44096387 ATATAATTCTTGGAAAAACAAGG - Intergenic
973088319 4:46097903-46097925 ACAAAGTTCTTGGAAAAAGATGG - Intronic
973125389 4:46577223-46577245 GTGTAGTTCCAGGAGAAAGTTGG + Intergenic
973271663 4:48269024-48269046 ATGTACTTCTTGGAAAAACTAGG - Intronic
973604670 4:52574778-52574800 ATCTAGTTTTTGAACAAAGATGG - Intergenic
973665923 4:53159355-53159377 ATGTATATTTTGAAGAAAGATGG - Intronic
976000368 4:80367506-80367528 GTATAGTTTTTGGAGAAAAAAGG - Intronic
977848339 4:101792494-101792516 AGATAGTTGTTGGAGAGAGAGGG - Intronic
977854149 4:101867410-101867432 AAGAAGTTCTTTGGGAAAGAAGG + Intronic
978357790 4:107895458-107895480 ATGTTGATCTTGGAAATAGAAGG + Exonic
978451341 4:108837428-108837450 ATTTAGTTGTTGTGGAAAGAAGG + Intronic
978540880 4:109815449-109815471 ATGTTGCTCTTGGAGATAGCTGG - Intergenic
978977140 4:114891659-114891681 ATGAAGTTCTAGAACAAAGATGG - Intronic
980138492 4:128885910-128885932 AGGAAGTTTATGGAGAAAGAAGG - Intronic
980304339 4:131037912-131037934 TTGTAGTTTTTGGCTAAAGATGG - Intergenic
980693680 4:136328882-136328904 AGGTACTTCTTGGGGAAACACGG - Intergenic
981087046 4:140694880-140694902 ATGTATTGCTTGAAGAAAAAAGG + Intronic
981691122 4:147510171-147510193 ATCTAGTCCTTTGAGAGAGATGG + Intronic
982606312 4:157520671-157520693 ATGAAGTTCTAGGAGAACGCCGG + Intergenic
982798699 4:159675157-159675179 ATGTAATTCTAGGTAAAAGAAGG + Intergenic
983002294 4:162431647-162431669 ATGTAGTTTTTAGAAAAAAATGG - Intergenic
983192435 4:164769016-164769038 ATGAAGTTCAGGGAGAAAGAGGG - Intergenic
983988415 4:174089100-174089122 ATGAAGTTTTGGCAGAAAGAAGG - Intergenic
984567654 4:181349854-181349876 AGGAAGTTTTTGAAGAAAGAAGG - Intergenic
985333397 4:188865864-188865886 ATCTAGATCATGGAGAAAGCAGG + Intergenic
985941374 5:3139016-3139038 ATGAAGTCCGTGGAGGAAGAGGG - Intergenic
986629116 5:9752435-9752457 AAGTAATTGTTGGAGAAAGAGGG - Intergenic
989379331 5:40798159-40798181 ACTCAGTTCCTGGAGAAAGATGG - Exonic
989439932 5:41458379-41458401 ATGTAATTCTGAGAGATAGAAGG + Intronic
989524081 5:42433105-42433127 TTTTAGTACTTGGAGCAAGATGG + Intronic
991954187 5:71975979-71976001 CTGTAGTTGTGGGAGTAAGAGGG + Intergenic
993009227 5:82460490-82460512 ATGTAAGTCTTTGAGAAATATGG + Intergenic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
995338207 5:111026973-111026995 ATATCCTTTTTGGAGAAAGATGG - Intergenic
995516783 5:112962248-112962270 TTGTAGTTTTAGGAGAAACAGGG - Intergenic
995823505 5:116266528-116266550 AAGTAGTTCCTGTAGAAAGTAGG - Intronic
996129742 5:119768112-119768134 ATGTTCTTGTTGGAGAAAGAAGG + Intergenic
996286733 5:121802992-121803014 ATGGAGTCCTTGGAGAAGCATGG + Intergenic
996820059 5:127616522-127616544 ATCTATTTCTAAGAGAAAGAAGG + Intergenic
996868222 5:128154545-128154567 CTGTAGTTGTGAGAGAAAGAGGG - Intronic
996910259 5:128648921-128648943 ATGTATTTCTTCTAGAAACATGG + Intronic
999044579 5:148453245-148453267 ATTTAGACCTTTGAGAAAGAGGG - Intronic
999071511 5:148748419-148748441 AGGTAATCTTTGGAGAAAGATGG - Intergenic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1000744309 5:165013193-165013215 ATCTAGTGCTTGGAAAAAAATGG - Intergenic
1000858425 5:166428796-166428818 AAGTGGTTGTTGTAGAAAGAAGG + Intergenic
1001275325 5:170346576-170346598 ATGCAGTTCCTGGAGACAGAGGG + Intergenic
1001700449 5:173702856-173702878 ATCTGCTTTTTGGAGAAAGAGGG + Intergenic
1001737995 5:174022793-174022815 GTGGAGTTGTTGGAGACAGAGGG + Intergenic
1002978756 6:2112948-2112970 AAGTAGTAACTGGAGAAAGACGG - Intronic
1003975900 6:11344334-11344356 ATGTTTATCCTGGAGAAAGAGGG + Intronic
1004395910 6:15246199-15246221 ATGTAGTTTTTGGAGGAAAAAGG + Intergenic
1004467794 6:15902090-15902112 TTTTAGTTCTTGGAGAAATGGGG - Intergenic
1006380822 6:33696126-33696148 ATGTAGTGCTTGGAGTTAAAGGG - Exonic
1006398805 6:33803928-33803950 AAGTAGCCCTTGGAGAAAGTGGG - Intronic
1006482498 6:34308283-34308305 ATTTATTTCTTGTAGAGAGAGGG - Intronic
1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG + Intronic
1007278157 6:40690738-40690760 AAGTTTTTCTTGGAGACAGAGGG - Intergenic
1007439755 6:41848546-41848568 ATATATTTTTTGGAGAAATAGGG + Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008771740 6:54987227-54987249 ATGTATTACATGGAGAGAGATGG + Intergenic
1008913129 6:56758124-56758146 ATTTGTTTCTTTGAGAAAGAAGG - Intronic
1008988643 6:57577045-57577067 ATGCAGTTTTTGGGGAAACATGG - Intronic
1009002318 6:57733930-57733952 AGATATTTCTTGAAGAAAGAAGG - Intergenic
1009177245 6:60475604-60475626 ATGCAGTTTTTGGGGAAACATGG - Intergenic
1009711619 6:67329527-67329549 TGTTAGTACTTGGAGAAAGAGGG + Intergenic
1010709247 6:79153492-79153514 AGGGATTTCTTAGAGAAAGATGG + Intergenic
1012741684 6:103023490-103023512 ATTTAGTTCTGAGAGACAGAAGG + Intergenic
1013257173 6:108399358-108399380 TTGTAGTTTTTGGAGAGACAGGG + Intronic
1013415462 6:109920733-109920755 ATGATGATCTTGGAGAAACAAGG - Intergenic
1014246056 6:119070257-119070279 ATGTAATCCTTGGTGAAATAAGG + Intronic
1014797423 6:125742180-125742202 ATGTGATTCTTAGGGAAAGATGG - Intergenic
1015080295 6:129216855-129216877 AATTAGATCTTGGAGCAAGAAGG + Intronic
1015362583 6:132356901-132356923 AAGTAGAATTTGGAGAAAGAGGG + Intronic
1018778046 6:167036472-167036494 AGGTAGATGTTGGAGGAAGAGGG + Intronic
1019303190 7:319489-319511 AGGTGGTTCGTGGAGCAAGAGGG + Intergenic
1020689741 7:11339566-11339588 AGGTAGTTCTTGGGTTAAGAAGG - Intergenic
1022404916 7:30079867-30079889 ATTTAGTTCTTGAAGAAAACTGG - Exonic
1022407914 7:30109412-30109434 TTGTATTTTTTGTAGAAAGAGGG - Intronic
1022513097 7:30954383-30954405 ATGTAGTGCTGGCACAAAGATGG - Intronic
1022719053 7:32926308-32926330 TTGTATTTTTTGTAGAAAGAGGG - Intergenic
1022982127 7:35613896-35613918 GTGTAGTTCTTTGAGGCAGATGG + Intergenic
1024451213 7:49545535-49545557 ATGTGGTTCTTGGAGCAAGGAGG + Intergenic
1025936328 7:66040760-66040782 ATGTATTTTTAGGAGAAACAGGG - Intergenic
1026529263 7:71183293-71183315 GTGTAGCTCTTGAAGACAGAAGG + Intronic
1030999657 7:116399992-116400014 AAGTAGTGCTTTGAGAGAGAGGG - Intronic
1031403675 7:121356689-121356711 ATGAATGTCTTGGAGTAAGAAGG - Intronic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1033316850 7:140304581-140304603 ATGAAGAACTTGGAGAGAGAAGG + Intronic
1037996585 8:23356869-23356891 ATGTACGCCTTGGAGAAAGCTGG - Intronic
1038548071 8:28441403-28441425 ATGTAATTCTTAGGGAAGGAAGG - Intronic
1038728869 8:30108798-30108820 TTGTATTTCTTGTAGAAACATGG + Intronic
1038944627 8:32344736-32344758 ATGTGGTTCTTGGCCAAATATGG - Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1042431288 8:68709654-68709676 AGGGAGTTGATGGAGAAAGAGGG - Intronic
1043672612 8:82906500-82906522 ATGTAATTATTGGAGGAGGAAGG + Intergenic
1044207483 8:89508462-89508484 ATGTACTTCTGGGTGAAAGGAGG + Intergenic
1044526185 8:93254033-93254055 ATTAAGTTCTTGAAGAAATAAGG + Intergenic
1045071813 8:98514115-98514137 GTCTAATTCTTGGAGAGAGAGGG - Intronic
1045481141 8:102593236-102593258 TTGTATTTTTTGTAGAAAGAGGG + Intergenic
1045975583 8:108127669-108127691 TTGTATTTTTTGTAGAAAGAGGG - Intergenic
1048186544 8:132247184-132247206 TTGGAGTTCATGGAGAAAGTAGG - Intronic
1049588845 8:143445880-143445902 ATGTATTTCTGGGAGAATAATGG + Intronic
1051129092 9:13839514-13839536 ATTTATTTCTAGTAGAAAGAAGG - Intergenic
1051530811 9:18101123-18101145 ATGTAGGACTTCTAGAAAGATGG - Intergenic
1051891396 9:21945758-21945780 ATGTGCTTCTTGGAGAAACACGG - Intronic
1057747006 9:97760407-97760429 GAGTAGCTCTTTGAGAAAGAAGG - Intergenic
1060875440 9:127080113-127080135 TTGCAGTTCTATGAGAAAGATGG + Intronic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1188688536 X:33100378-33100400 ATGTATTTCTTTGTTAAAGATGG + Intronic
1190856960 X:54305532-54305554 ATGTATTTGTTGGAGAAACTAGG + Intronic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1192233815 X:69283914-69283936 ATTTAGTGCCTGGAGAAAGAGGG - Intergenic
1192597926 X:72431146-72431168 ATGAAGGTGATGGAGAAAGAGGG - Intronic
1193191872 X:78580061-78580083 GTGTATGTCTTGGAGAAAGGTGG - Intergenic
1193484874 X:82075161-82075183 ATATATTTTTTGGAGAAGGAGGG - Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1194844065 X:98781732-98781754 AATTATTTCTTGGAGAAATAAGG - Intergenic
1196149730 X:112359930-112359952 ATGAAGATCTTGTAGAAATATGG + Intergenic
1197369219 X:125605751-125605773 ATGATTTTCTTGGAGAAATAAGG + Intergenic
1197757492 X:130006003-130006025 ATCTAGGTCTGGAAGAAAGATGG + Intronic
1197926526 X:131652620-131652642 ATTTATTTTTTGTAGAAAGAGGG + Intergenic
1198630351 X:138630342-138630364 TTAAAGTTCTTAGAGAAAGAGGG + Intergenic
1199407337 X:147477930-147477952 TGGTAGCTCTTGGAGAAAAATGG + Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1201534592 Y:15031872-15031894 ATGTATTCTATGGAGAAAGAGGG + Intergenic
1201688915 Y:16740744-16740766 ATGTTGTGCTTGGAGAAAAGAGG - Intergenic