ID: 906491360

View in Genome Browser
Species Human (GRCh38)
Location 1:46271309-46271331
Sequence CAGTTGTTGGGAAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 594}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906491360_906491377 26 Left 906491360 1:46271309-46271331 CCTCCTGCCCTTCCCAACAACTG 0: 1
1: 0
2: 3
3: 59
4: 594
Right 906491377 1:46271358-46271380 CCAATTTTAGATGGCAGGACGGG 0: 1
1: 0
2: 0
3: 10
4: 121
906491360_906491371 17 Left 906491360 1:46271309-46271331 CCTCCTGCCCTTCCCAACAACTG 0: 1
1: 0
2: 3
3: 59
4: 594
Right 906491371 1:46271349-46271371 CTCTCCCTACCAATTTTAGATGG 0: 1
1: 0
2: 1
3: 10
4: 114
906491360_906491373 21 Left 906491360 1:46271309-46271331 CCTCCTGCCCTTCCCAACAACTG 0: 1
1: 0
2: 3
3: 59
4: 594
Right 906491373 1:46271353-46271375 CCCTACCAATTTTAGATGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 68
906491360_906491367 -10 Left 906491360 1:46271309-46271331 CCTCCTGCCCTTCCCAACAACTG 0: 1
1: 0
2: 3
3: 59
4: 594
Right 906491367 1:46271322-46271344 CCAACAACTGCCTGGCTACCTGG 0: 1
1: 0
2: 0
3: 18
4: 165
906491360_906491375 25 Left 906491360 1:46271309-46271331 CCTCCTGCCCTTCCCAACAACTG 0: 1
1: 0
2: 3
3: 59
4: 594
Right 906491375 1:46271357-46271379 ACCAATTTTAGATGGCAGGACGG 0: 1
1: 0
2: 1
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906491360 Original CRISPR CAGTTGTTGGGAAGGGCAGG AGG (reversed) Intronic
900244988 1:1632532-1632554 CAGTTGTTGGGAGGGGTGGGAGG + Intronic
900256219 1:1699691-1699713 CAGTTGTTGGGAGGGGTGGGAGG + Intronic
900589451 1:3453311-3453333 CAGCTCTTGGGAAAGGCAGGTGG - Intergenic
901415536 1:9113540-9113562 CCTCTGTAGGGAAGGGCAGGAGG + Intronic
901451345 1:9338470-9338492 CACTTGCTGGGGAGGACAGGGGG + Intronic
901535983 1:9883275-9883297 GAGATGTGTGGAAGGGCAGGTGG + Intronic
902851695 1:19163271-19163293 CAGTTCATGGGTTGGGCAGGAGG + Intronic
903483386 1:23670849-23670871 CTGCTGTGGGGATGGGCAGGGGG + Intergenic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
904026196 1:27505090-27505112 AAGTTTCTGGGAAAGGCAGGAGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
906461799 1:46040249-46040271 CAATTGTTGGGGAGGGTAGGGGG - Exonic
906491360 1:46271309-46271331 CAGTTGTTGGGAAGGGCAGGAGG - Intronic
907232330 1:53011600-53011622 CAGTTGGTTGGAAGTACAGGTGG + Intronic
907270396 1:53287786-53287808 CAGGTGCTGGGATGGGCAAGAGG + Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907918943 1:58895472-58895494 CAGCTGTAGGGAAGAACAGGAGG + Intergenic
908096836 1:60748181-60748203 CAGGATTTGGTAAGGGCAGGAGG - Intergenic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
908496824 1:64702689-64702711 CAGATGCTGGGAAGGGTAGCTGG - Intergenic
908788617 1:67758876-67758898 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
908920811 1:69189245-69189267 CTGTTGTGGTGAAGGGGAGGGGG - Intergenic
909534777 1:76724283-76724305 CTCTTGTTTGGATGGGCAGGGGG - Intergenic
910509536 1:87988171-87988193 CGGTGGAGGGGAAGGGCAGGGGG - Intergenic
911095020 1:94047979-94048001 CAGTTGCAGGCAAGGCCAGGAGG - Intronic
912458204 1:109813501-109813523 CAGTTTTTGGGAAGCTGAGGTGG - Intergenic
913164260 1:116170375-116170397 CAGTTCTTCCTAAGGGCAGGAGG + Intergenic
915099409 1:153488147-153488169 CAATTGCTGGGAAGGGGAGAAGG + Intergenic
915179627 1:154047090-154047112 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
915571650 1:156748153-156748175 CACTTGTGGGGAAGGGCCAGGGG + Intronic
917581956 1:176388026-176388048 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
917740502 1:177957811-177957833 CAGAGGCTGGGAAGGGCAGTAGG - Intronic
917909359 1:179626058-179626080 CTGTTGTGGGGTGGGGCAGGGGG + Intronic
918231850 1:182541246-182541268 CAGAAGCTGGGAAGGGTAGGGGG - Intronic
918457097 1:184732301-184732323 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
918940842 1:190994172-190994194 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
918997735 1:191783974-191783996 CAGGTGCTGGCCAGGGCAGGAGG + Intergenic
919034501 1:192289276-192289298 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
920673434 1:208022543-208022565 AAGTTGTGGGGAAAGGCAGGTGG + Exonic
921422015 1:214959081-214959103 GACTTGGAGGGAAGGGCAGGAGG - Intergenic
921604084 1:217136102-217136124 CAGTTGTTGGGTGGGGGAGAAGG - Intronic
921958378 1:221008108-221008130 CAGAGGTTGGGAAGGGTAGCAGG - Intergenic
922299732 1:224287254-224287276 CAGAGGCTGGGAAGGGAAGGTGG + Intronic
922549824 1:226485843-226485865 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
922689443 1:227676668-227676690 CTGTTGTGGGGAGGGGGAGGGGG - Intronic
923130474 1:231070509-231070531 CAGAGGCTGGGAAGGGTAGGTGG + Intergenic
923768949 1:236920481-236920503 CAGTTGTTGGTCATGGGAGGCGG + Intergenic
923808912 1:237290333-237290355 GAGTGGTTGGCAAGGGCTGGAGG + Intronic
924247232 1:242096896-242096918 CTGTTGTGGGGAGGGGGAGGGGG - Intronic
924820942 1:247490118-247490140 CAGTTGTCAGGATGGACAGGTGG + Intergenic
1062764915 10:54187-54209 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1064131477 10:12713680-12713702 CAGATGTGGGGAAGGGCAGGTGG + Intronic
1064461624 10:15540293-15540315 CAGAGGCTGGGAAGGGAAGGTGG - Intronic
1065483126 10:26214106-26214128 CAGTGAATGGGAAGGGAAGGCGG - Intergenic
1065882989 10:30053154-30053176 TTGTTGTTGGTAAGGGCATGAGG + Intronic
1065897285 10:30175134-30175156 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1066559668 10:36656288-36656310 CAGTTGTTGAGAAGGGGGTGTGG - Intergenic
1067248513 10:44566846-44566868 CAGTTGGTGGCAGGGACAGGAGG - Intergenic
1067456073 10:46420158-46420180 AAGTTGTTGGGAGGAGCAGGAGG + Intergenic
1067631126 10:47964481-47964503 AAGTTGTTGGGAGGAGCAGGAGG - Intergenic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1068658547 10:59599682-59599704 CAGAAGTTGGGAAGGGCAGTTGG + Intergenic
1068805190 10:61187191-61187213 CAGGTGTGGAGAAGGGCAGGGGG + Intergenic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1071932695 10:90490818-90490840 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
1071956036 10:90760330-90760352 CAGAGGCTGGGAAGGGTAGGAGG + Intronic
1072430922 10:95369860-95369882 CAGGTGATGGGTGGGGCAGGTGG - Intronic
1072738327 10:97894782-97894804 GGGTTCTTGGCAAGGGCAGGGGG - Intronic
1072764893 10:98087348-98087370 CAGTAGTGGGGCAGGGCAGAGGG + Intergenic
1073100583 10:101004282-101004304 CAACTGGTGGGGAGGGCAGGGGG - Intronic
1073206930 10:101774522-101774544 CATTTGCTGGGCAGGGAAGGGGG + Intronic
1073671174 10:105591797-105591819 CAGTTGTGGGGAGGGTGAGGAGG + Intergenic
1074426755 10:113358263-113358285 CGTTTGGTGGGAAGGGCAGAGGG + Intergenic
1075048765 10:119166327-119166349 CTGTGCTGGGGAAGGGCAGGTGG - Intergenic
1075244676 10:120810592-120810614 GAGCTGTTGGGAAGGGCTGCAGG - Intergenic
1075783684 10:125033693-125033715 CAGTGCTTGGGGTGGGCAGGGGG - Intronic
1075838887 10:125480124-125480146 CTGTTGGTGGGAAGGACAGGAGG + Intergenic
1075931441 10:126300191-126300213 CAGTTCTTGGCCAGGGCAAGAGG - Intronic
1077151921 11:1076563-1076585 CAGGTGTGGGCATGGGCAGGTGG + Intergenic
1077309953 11:1883863-1883885 CAGGTGCTGGGCAGGGCAGGAGG + Intronic
1077549850 11:3195357-3195379 CCATTGCTGGGAAGAGCAGGTGG - Intergenic
1077946983 11:6910557-6910579 CTGTTGTGGGGTGGGGCAGGGGG + Intergenic
1078051625 11:7970146-7970168 CAGTTTTGGGGAAGGGGTGGGGG + Intergenic
1078692179 11:13593278-13593300 CAGAGGTTGGGAAGGGTAGTTGG + Intergenic
1080375613 11:31706732-31706754 TAGATGTTGGGATGGGTAGGTGG - Intronic
1080875051 11:36267248-36267270 CAGTGGTGGGGAGGAGCAGGTGG - Intergenic
1081493391 11:43583525-43583547 CACTTATTGTGAAGGGAAGGGGG - Intronic
1081661802 11:44892959-44892981 CAATTGGTGGGAAGAGCAGCGGG + Intronic
1081940656 11:46938544-46938566 CAGTGGTTGGCAAGGGCTGCAGG - Intronic
1083538785 11:63496223-63496245 CAGATGCTGGGAAGGGTAGTGGG - Intergenic
1083765600 11:64840066-64840088 CAGGGGTTGGGCAGGGCAGCGGG + Intronic
1083925087 11:65801216-65801238 CAGCTGCTGGGAACGGCTGGAGG + Intergenic
1083996710 11:66276596-66276618 CAGTTCTTGGGCAGGACAGCAGG - Exonic
1084170062 11:67396737-67396759 CAGGTGGCTGGAAGGGCAGGTGG + Intronic
1084675090 11:70629537-70629559 CATGTGGTGGGAAGGGCAGCGGG + Intronic
1084923925 11:72496271-72496293 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
1085106957 11:73853087-73853109 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1085440602 11:76559176-76559198 CAGTTGCTGGAAAGGGAAGTGGG + Intergenic
1086554362 11:88091373-88091395 GAGTTGAGGGGAAGGGCATGTGG - Intergenic
1087699188 11:101416272-101416294 TAGTAGCTGGGAAGGGTAGGAGG - Intergenic
1087821407 11:102716953-102716975 GTGTTGTTGGGGTGGGCAGGAGG + Intronic
1088341261 11:108770513-108770535 CAGAGGTTGGGAAGGGTAGTGGG - Intronic
1088586254 11:111362461-111362483 CAGAAGCTGGGAAGGGCAGCAGG - Intronic
1088821262 11:113459627-113459649 CAGAGGCTGGGAAGGGGAGGGGG + Intronic
1088971110 11:114775376-114775398 CAGTTGTTAGGGGGGGCAAGAGG + Intergenic
1089066382 11:115665261-115665283 CAGAGGCTGGGAAGGGCAGCGGG + Intergenic
1089158668 11:116421513-116421535 CTCTTGTTGGGAAGGGGAAGGGG + Intergenic
1089663883 11:120004586-120004608 CAGTTGGTGAGAAGTGCAGGTGG - Intergenic
1089761097 11:120723973-120723995 CAGTGGTTGCCAAGAGCAGGGGG - Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090425907 11:126606910-126606932 CAGATGATGGGAAGGGGCGGGGG + Intronic
1090694269 11:129221720-129221742 CAATAGTGGGCAAGGGCAGGAGG + Intronic
1091208852 11:133839525-133839547 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1091524443 12:1284059-1284081 CAGAGGCTGGGAAGGGTAGGAGG - Intronic
1091867093 12:3849639-3849661 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
1092287404 12:7136762-7136784 CAGATGGTGAAAAGGGCAGGAGG - Intronic
1093528486 12:20133399-20133421 CAGTTGTTGAGAGAGGGAGGTGG + Intergenic
1093678220 12:21968814-21968836 CAGAGGTTGGGAAGGGCAGCTGG + Intergenic
1093902414 12:24651058-24651080 CAGAGGTTGGGAAGGGAAGTGGG - Intergenic
1094056878 12:26277319-26277341 TTGTTGTTGAGAAGGGCAGTGGG + Intronic
1094815123 12:34175662-34175684 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1095807384 12:46334903-46334925 CAGAAGCTGGGAAGGGTAGGGGG - Intergenic
1096653768 12:53075703-53075725 CAGTGGGTGGGCAGAGCAGGGGG - Intronic
1096803438 12:54126508-54126530 CGGCTCTTGGGGAGGGCAGGCGG - Intergenic
1096812390 12:54179701-54179723 CAGTTGGTCAGAAGTGCAGGTGG - Intronic
1099144209 12:79018338-79018360 CGGTTGTGGGGTAGGGGAGGGGG + Intronic
1099732705 12:86525963-86525985 CACTTGTTGGCTATGGCAGGGGG + Intronic
1100930638 12:99605487-99605509 CAGAGGTTGGGAAGGGTAGAGGG - Intronic
1101504413 12:105332395-105332417 CAGTTTTAGGGATGGGGAGGGGG + Intronic
1101676588 12:106922440-106922462 CAGAGGGTGGGAAGGGCAGTGGG - Intergenic
1102902776 12:116651254-116651276 GAGTTGTGGGGAGGGGCATGGGG + Intergenic
1103939304 12:124493171-124493193 CAGTTGGGGCAAAGGGCAGGAGG + Intronic
1104626785 12:130363267-130363289 GAGGTGATGGGAAGGGCAGAGGG + Intronic
1105718277 13:23088954-23088976 CAGGAGTTGAGAAGGGCAAGAGG + Intergenic
1105780895 13:23704652-23704674 CATTTGCTGGGAAGTGGAGGAGG - Intergenic
1105925779 13:25006520-25006542 CAGGGGCTGGGAAGGGTAGGGGG + Intergenic
1106038921 13:26071096-26071118 CAGGGGCTGGGAAGGGTAGGGGG - Intergenic
1106675806 13:31956743-31956765 CAGAGGTTGGGAAGGGCAAGGGG - Intergenic
1106703090 13:32250418-32250440 AAGATGTTGGGAAGGGAAGGTGG - Intronic
1107286218 13:38795746-38795768 CAGAGGTTGGGAAGGGTATGTGG - Intronic
1107332552 13:39317327-39317349 CAGTTGGTCAGAAGTGCAGGAGG + Intergenic
1108093791 13:46879528-46879550 AAATTCTTGGGAAGGACAGGAGG + Intronic
1108601626 13:51999987-52000009 CTGTTGGTGGGAAGGATAGGAGG - Intronic
1109738450 13:66518776-66518798 CTGTTGTTGGGAGGGGCAAAGGG + Intronic
1110248074 13:73350194-73350216 CAAGAGATGGGAAGGGCAGGAGG + Intergenic
1110611978 13:77498677-77498699 CAGATGCTGGGATGGGCAGTTGG + Intergenic
1110910850 13:80961013-80961035 CAGAGGCTGGGAAGGGCAGCAGG - Intergenic
1111426346 13:88089246-88089268 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
1111520507 13:89396401-89396423 CAGATGCTGGGAAGGGTAGTTGG - Intergenic
1112326098 13:98443692-98443714 CAGATGTTGGGATGGCCAGAGGG + Intronic
1112419754 13:99237471-99237493 CAGAGGCTGGGAAGGGTAGGAGG + Intronic
1112828269 13:103417667-103417689 AGGATGTTGGCAAGGGCAGGCGG + Intergenic
1113239524 13:108320790-108320812 CAAGTGTTGGGAAGGGGCGGTGG + Intergenic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1114080453 14:19198630-19198652 GAGTTGGAGGTAAGGGCAGGGGG + Intergenic
1114519638 14:23325144-23325166 CAGTTACTGTGAAGGGAAGGGGG - Intronic
1115115345 14:29874826-29874848 CAGATGCTGGGAAGGGTATGAGG + Intronic
1115695234 14:35890637-35890659 CAGTAACTGGGAAGGGTAGGTGG - Intronic
1115930950 14:38493918-38493940 CAGATGTTGGAAAGGGAAGGGGG - Intergenic
1117021427 14:51574660-51574682 CAGAGGTTGGGAAGGGTAGTGGG + Intronic
1117200067 14:53381222-53381244 CAGTGGTTGGGATGGGGAGGAGG + Intergenic
1117331477 14:54716861-54716883 AAGTTGCGGGGCAGGGCAGGTGG + Intronic
1117482562 14:56162261-56162283 CAGTGGCTGGGAAGGCCAAGAGG - Intronic
1118055193 14:62072486-62072508 AGGTTGTTGGGAAAGGTAGGGGG + Intronic
1118779121 14:68994546-68994568 CATGTGCTGGGAAGGGGAGGAGG + Intergenic
1118980591 14:70713146-70713168 CAGTTGTGGGGCAGGGTAGGGGG + Intergenic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1119182532 14:72614462-72614484 CAGTAGCTGGGAAGGGAAGAGGG - Intergenic
1120100839 14:80444038-80444060 CAGAGGTTGGGAAGGGTAGTAGG + Intergenic
1121054535 14:90841875-90841897 CAGTTGGTGGGCCGGGCACGGGG + Intergenic
1121226094 14:92323075-92323097 CACGTGCTGGGAAGGGCGGGGGG + Intronic
1122979332 14:105184609-105184631 GAGGGGTTGGGCAGGGCAGGTGG + Intergenic
1123048831 14:105531052-105531074 CAGTTGTTGGGAAATGCACTTGG - Intergenic
1123111093 14:105867160-105867182 CAGCTGTTGGGAGAGGCTGGGGG - Intergenic
1123501529 15:20887876-20887898 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123558782 15:21461575-21461597 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123595011 15:21898856-21898878 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123889580 15:24763387-24763409 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1124154393 15:27212735-27212757 CAGTTGTTGCCAAGGTCAGGGGG - Intronic
1124389262 15:29239221-29239243 CATTTGGTGGCAAGGGAAGGAGG - Intronic
1124431372 15:29611564-29611586 AAGTGGCTGGGAAGGGCAGAGGG - Intergenic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1126944136 15:53799654-53799676 CAGAGGTTGGGAAGGGTAGTGGG + Intergenic
1127143302 15:55998941-55998963 AAGTTGTAGGAATGGGCAGGGGG - Intergenic
1127156637 15:56134761-56134783 CTGTTGTTGGGGAGGGCGGTAGG - Intronic
1127260580 15:57323843-57323865 CAGATCCTGGGAAGGGCAGGAGG + Intergenic
1127460306 15:59192657-59192679 TATTTGCTGGGAAGAGCAGGTGG + Intronic
1127881376 15:63161457-63161479 CAGTTCTTTGGAAAGCCAGGTGG - Intergenic
1127973373 15:63979433-63979455 CAGTTGCTGAGAGGGGCAGTGGG + Intronic
1128162593 15:65434140-65434162 CCGTTGATGGGATGGACAGGTGG - Intergenic
1129975797 15:79820549-79820571 TAGTGGTTGCCAAGGGCAGGAGG + Intergenic
1130317416 15:82808750-82808772 CAGGTGGTGGGAATGGGAGGAGG - Intergenic
1131007502 15:88990438-88990460 CAGTTTGGGGGAAGGGCGGGTGG + Intergenic
1202967130 15_KI270727v1_random:188734-188756 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1133215923 16:4292501-4292523 CAGAGGTTGGGAACGGAAGGTGG + Intergenic
1133400918 16:5486290-5486312 CATTTGGTGGGAAGGACAAGGGG + Intergenic
1134693090 16:16203793-16203815 GAGTTGGGGGGCAGGGCAGGAGG + Intronic
1134978758 16:18590902-18590924 GAGTTGGGGGGCAGGGCAGGAGG - Intergenic
1135815720 16:25631138-25631160 CAGTGGTTGTCAAGGGCTGGGGG + Intergenic
1135817040 16:25644050-25644072 CATTTGTTGGCTAAGGCAGGTGG + Intergenic
1136109700 16:28057089-28057111 GAGGAGTGGGGAAGGGCAGGAGG + Intronic
1136286517 16:29247318-29247340 CAGTTGTGGGCACAGGCAGGAGG - Intergenic
1136609395 16:31357079-31357101 CAGCAGCTGGGAAGGGCTGGTGG - Exonic
1137857198 16:51806789-51806811 AAGATGTGGGGCAGGGCAGGGGG + Intergenic
1138466182 16:57192828-57192850 CAGCTACTGGGAAGGGCAGTGGG - Intronic
1138517373 16:57543653-57543675 CTGTGGTTGGCAGGGGCAGGTGG + Intronic
1139034771 16:62930819-62930841 CATATCTTGGGAAGGCCAGGTGG - Intergenic
1141038478 16:80650958-80650980 CAGGGGCTGGGAAGGGCGGGGGG + Intronic
1141930207 16:87197096-87197118 CAGCTCATGGGAAGGGCAGGTGG - Intronic
1142002599 16:87672021-87672043 CAGGTGTAGGGCTGGGCAGGTGG + Intronic
1142092105 16:88219892-88219914 CAGTTGTGGGCACAGGCAGGAGG - Intergenic
1142263156 16:89051810-89051832 TAATTGCTGGGAAGGGCAGCAGG + Intergenic
1142406653 16:89893955-89893977 TTCCTGTTGGGAAGGGCAGGAGG - Intronic
1142560110 17:804764-804786 CCATTGTTGGAAAGGGCGGGTGG - Intronic
1143159339 17:4858970-4858992 CTGGTGTTGGGAGGGGCCGGGGG - Intronic
1143160690 17:4868413-4868435 CAGAAGCTGTGAAGGGCAGGGGG - Intronic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1143816766 17:9522761-9522783 CAGAGGCTGGGAAGGGCAAGAGG + Intronic
1143916259 17:10295451-10295473 CTGTTCCTGCGAAGGGCAGGAGG + Intergenic
1144430227 17:15184337-15184359 CAGAGGTTGGGAAGGGTAGCAGG + Intergenic
1144716282 17:17437953-17437975 CAGAGGCTGGGAAGGGCAGGAGG + Intergenic
1144890901 17:18493834-18493856 CAGCTATTGCAAAGGGCAGGAGG + Intronic
1145141323 17:20450484-20450506 CAGCTATTGCAAAGGGCAGGAGG - Intronic
1145739362 17:27259700-27259722 CAGTGGATGGGAGGGGAAGGAGG - Intergenic
1146062466 17:29614407-29614429 CAGCTGGTGGGAAGGGGTGGGGG - Exonic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1147419098 17:40313224-40313246 CAGGTCCTGGGCAGGGCAGGAGG - Intronic
1147587368 17:41660181-41660203 TAGATGAAGGGAAGGGCAGGTGG - Intergenic
1147692297 17:42323860-42323882 CCGAGGTTGGGAAGAGCAGGGGG - Intronic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148868130 17:50639690-50639712 CAGTGGTTGGGGCTGGCAGGGGG + Intronic
1148957411 17:51365232-51365254 AAGTTGTTGGGCGAGGCAGGCGG - Intergenic
1149184235 17:53978494-53978516 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1149317095 17:55448741-55448763 CGGGTGTTGGGAGGGGGAGGTGG + Intergenic
1149444735 17:56704904-56704926 CATTTCTTAGGCAGGGCAGGTGG - Intergenic
1149530026 17:57387812-57387834 CACTAGTGGGGAAGGGAAGGTGG + Intronic
1149877101 17:60246176-60246198 CAGAGGCTGGCAAGGGCAGGAGG - Intronic
1151251788 17:72841540-72841562 CAGAGGCTGGGAAGGGCAGTCGG + Intronic
1151321337 17:73354438-73354460 ATGTTGGTGGGAAGGCCAGGAGG + Intronic
1151479830 17:74363399-74363421 CAGCCCATGGGAAGGGCAGGCGG - Intergenic
1152287691 17:79422215-79422237 CAGCAGTTGGGACGGGCACGCGG + Intronic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152565180 17:81097204-81097226 CCGTTGTTTTGAGGGGCAGGTGG + Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152806027 17:82356756-82356778 CAGATGTTGGGATGGACAGCTGG - Intergenic
1152957828 18:54532-54554 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1153676441 18:7459992-7460014 CCGTGCTTGGGAAGGGCACGGGG - Intergenic
1154949906 18:21199886-21199908 AAGGTGTTGGGAAGGGGTGGAGG - Intergenic
1155455179 18:26004655-26004677 CAGTTTTAGGGAGGGACAGGGGG - Intergenic
1155767929 18:29659126-29659148 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1156156365 18:34307424-34307446 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1156285670 18:35693067-35693089 CAGGTGGTGGTAAGGGCAGAAGG + Intronic
1156317861 18:35987745-35987767 CAGTTGTTGCCAGGGGCTGGTGG + Intronic
1156676963 18:39538900-39538922 CAGCGATTGAGAAGGGCAGGAGG - Intergenic
1157325989 18:46669144-46669166 CAGGTGCTGGGCAGGGCATGAGG + Intronic
1157793222 18:50551495-50551517 CAGAGGTTGGGAAGGGTAGTTGG - Intergenic
1157885535 18:51362720-51362742 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
1158160489 18:54477625-54477647 CAGTGGTGGGGAGGAGCAGGAGG + Intergenic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1159385608 18:67721714-67721736 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
1159884986 18:73895309-73895331 CACTTGGTGGGCAGGGCAGGGGG + Intergenic
1159922422 18:74237876-74237898 CAGTCCTTGGGAAGGGTATGTGG - Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160496226 18:79377418-79377440 AAGGTGCTGGGAAGGGCAGAAGG - Exonic
1160630714 18:80245373-80245395 CAGCTGCTGTGAAGGGCAGCAGG + Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162624552 19:11874236-11874258 CAGTTGCTGAGAAGTACAGGTGG + Intronic
1162629647 19:11917070-11917092 CAGTTGCTGAGAAGTACAGGTGG + Intergenic
1162634700 19:11958300-11958322 CAGTTGCTGAGAAGTACAGGTGG + Intronic
1162931267 19:13959134-13959156 CAGAAGCTGGGGAGGGCAGGGGG - Exonic
1163093831 19:15041303-15041325 CAGTTGTGGGGTGGGGGAGGGGG - Intergenic
1163384515 19:16991331-16991353 CAGTAGGTGGGAAGCACAGGTGG + Intronic
1163658391 19:18561700-18561722 CAGTTGTTAGGCAGGGGATGAGG + Intronic
1163730239 19:18944875-18944897 CAGCTTTCGGGAAGAGCAGGTGG - Intergenic
1164886124 19:31780104-31780126 CCGGTGTTGTGAAGGACAGGGGG + Intergenic
1165427450 19:35753924-35753946 TTGTTGCTGGGAAAGGCAGGAGG + Intronic
1165797584 19:38527883-38527905 AAGTTTTGGGGCAGGGCAGGAGG + Intronic
1165985901 19:39768672-39768694 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
1166102730 19:40580691-40580713 CTGTTGATGGGAAGGGCATGCGG + Intronic
1166378738 19:42343690-42343712 CAGGTGAGGGGAAAGGCAGGAGG + Intronic
1166543883 19:43622967-43622989 CAGTTTCTGGGAAGGGTGGGGGG - Exonic
1166970715 19:46565455-46565477 CAGGTATTGGGAAGGGAAGATGG - Intronic
1166975990 19:46605344-46605366 CAGTCCTTGGGTAGGGCAGAGGG - Intronic
1167846449 19:52168934-52168956 CAGTTGTTGCCAGGGGCTGGTGG + Intronic
1168252780 19:55149784-55149806 CAGGTGTGGGGAGGGGGAGGGGG + Intergenic
1168468270 19:56621334-56621356 CCGTTGTTGGGGAGGCCACGGGG + Exonic
925087935 2:1126149-1126171 TAGATGTTGGGAAGGGGAGGAGG - Intronic
925181298 2:1818685-1818707 CATATGTGAGGAAGGGCAGGAGG + Intronic
925993283 2:9270717-9270739 CAGAGGCTGGGAAGGGTAGGTGG - Intronic
927294686 2:21440569-21440591 CAGCTGTTGGGAAGGTCAGGTGG - Intergenic
927425700 2:22979016-22979038 CAGCTTTTGGGAAGGGGAGAGGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928091423 2:28377265-28377287 CAGTAGTTGGGAGGTGCGGGAGG + Intergenic
928441202 2:31293639-31293661 CAGTTTGGGGGAAGGGCTGGGGG + Intergenic
929484684 2:42342881-42342903 GATGTGTTGGGATGGGCAGGTGG - Intronic
929767429 2:44858376-44858398 CAGTTGTTGCTTAGGGCTGGGGG + Intergenic
930018094 2:46984572-46984594 CAGTTGTGGGGAAGGGGAGCAGG - Intronic
930704654 2:54492531-54492553 CAGTTGGTGCAAAGGGCAGTAGG - Intronic
931404581 2:61963648-61963670 CAGTTGTTTAGAAGTGAAGGTGG + Intronic
932011077 2:67977769-67977791 CAGTTGGTGGGAGGAGCAGGTGG - Intergenic
932012116 2:67989046-67989068 CATTTGGTGGGAATAGCAGGTGG - Intergenic
932701781 2:73997174-73997196 CAGTAATTAGGAGGGGCAGGAGG - Intronic
932804998 2:74775922-74775944 CAATTGTTGGTAAGGGCCTGAGG + Intergenic
934102527 2:88666671-88666693 CAGCAGTTGGGGAGGGCAGGAGG - Intergenic
935015472 2:99177852-99177874 CAGAAGCTGGGAAGGGCAGTGGG - Intronic
935106120 2:100045149-100045171 CAGAGGTGGGGAAGGGGAGGAGG + Intronic
935506293 2:103908293-103908315 CAGTGGTTGGCAAGGGGTGGAGG - Intergenic
935637344 2:105259554-105259576 CATCTTTTGGGAAGGGAAGGAGG - Intergenic
935927586 2:108087565-108087587 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
936229444 2:110687263-110687285 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
936820994 2:116520970-116520992 CCGTTGGTGGGCAGGGGAGGTGG - Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
936944977 2:117921914-117921936 CAGTTCATGGGCAGGGCAGTGGG + Intronic
936994260 2:118397026-118397048 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
937387239 2:121446856-121446878 GGGTTGTGGGGAATGGCAGGAGG - Intronic
937403217 2:121603903-121603925 CAGAGGCTGGGAAGGACAGGAGG + Intronic
937753802 2:125511725-125511747 CAGAGGTTGGGAAGGGTAGTGGG + Intergenic
937905919 2:127052734-127052756 GAGATGCTGGGAGGGGCAGGCGG - Intronic
938872185 2:135490974-135490996 TAGTGGTTGGGAAGGGTAGTGGG + Intronic
939929929 2:148220932-148220954 CAGATGTTGGGAAGGGTAGTTGG - Intronic
940098925 2:150010910-150010932 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
941134063 2:161691306-161691328 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
941212974 2:162666360-162666382 AAGTTGTGGGGAGGGGCGGGGGG - Intronic
941242874 2:163062805-163062827 CAGTTGTTTGGAAGGGAACAAGG - Intergenic
942352705 2:175069561-175069583 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
942383318 2:175416288-175416310 CAGAAGCTGGGAAGGGCAGTGGG - Intergenic
942834032 2:180271096-180271118 CAGAGGCTGGGAAGGGTAGGAGG - Intergenic
944361264 2:198860107-198860129 CAGAAGCTGGGAAGGGCAGTGGG + Intergenic
944593027 2:201236178-201236200 CAGGGGTGGGGAGGGGCAGGAGG - Intronic
944814674 2:203363531-203363553 CAGAGGATGGGAAGGGTAGGGGG - Intronic
944955848 2:204807828-204807850 CAGTGGTTGGGAAGGGTTGTGGG + Intronic
946197763 2:218046356-218046378 TAGAGGCTGGGAAGGGCAGGTGG - Intronic
946251107 2:218413087-218413109 CAGTTTGTGGGAAGTGCAGAAGG + Intergenic
946363686 2:219235416-219235438 GTGATGTTGGGAAAGGCAGGAGG + Intronic
946792462 2:223315077-223315099 GAGTTGATTGGAAGGGCAAGAGG - Intergenic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
946924725 2:224615570-224615592 GAGGTGTTGGGCAGGGTAGGTGG + Intergenic
947839174 2:233196797-233196819 GAGTTGTGGGGAAGGGAGGGAGG - Intronic
948012036 2:234656647-234656669 CAGTTTGTGGGAAGGGATGGGGG - Intergenic
948094311 2:235321401-235321423 CAGGCGTTGGAAAGAGCAGGAGG - Intergenic
948200571 2:236127245-236127267 CAGGTGCTGGGACGGGCAGATGG + Exonic
948964775 2:241370020-241370042 CAGAGGTTGGGAAGGGTAGTAGG + Intronic
1168909665 20:1437633-1437655 CATTTGTTGTGAAGGACATGTGG - Intergenic
1168945683 20:1755011-1755033 CAGAGGCTGGGAAGGGTAGGAGG + Intergenic
1169914994 20:10674796-10674818 CAGGCTTTGGGAAGGGCCGGCGG + Intergenic
1170266630 20:14473307-14473329 CAGCGGCTGGGAAAGGCAGGAGG - Intronic
1171938433 20:31299677-31299699 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1172035828 20:32010309-32010331 CATCTGATGGGGAGGGCAGGGGG - Intergenic
1172056186 20:32155700-32155722 CAGTTGTGGGGAGGGGGAGTGGG + Intronic
1172228900 20:33323828-33323850 CTGATGTTGGGAAGGGCTGGGGG - Intergenic
1173451540 20:43168688-43168710 CAGTTGTGGGGCAGGGCACATGG - Intronic
1173582492 20:44157459-44157481 CACTTGTGGGGAAGGGAAGAAGG - Intronic
1173654473 20:44690177-44690199 CACTTGTGGGGGAGGGGAGGAGG + Intergenic
1174068380 20:47882449-47882471 CAGAAGCTGGGAAGGGTAGGGGG + Intergenic
1174334796 20:49851963-49851985 CAGTGGTTGGGATGTTCAGGTGG + Intronic
1174941332 20:54931923-54931945 CAGATGCTGGGAAGGGTAGTCGG - Intergenic
1175229526 20:57464972-57464994 GGGTTGTTGGGAAGTGCAAGAGG + Intergenic
1175443583 20:59006563-59006585 CAGGTGTTGGGAAAGGCGGGAGG - Intronic
1175470587 20:59224198-59224220 CACTTGTTGGGAGGGGAAGCAGG - Intronic
1175962692 20:62645168-62645190 CACTTGTTGGAATGGGCACGTGG + Intronic
1176138574 20:63535734-63535756 CAGGTGGTTGGAGGGGCAGGTGG - Intronic
1177128548 21:17228027-17228049 CAGAGGTTAGGAAGGGCAGGAGG + Intergenic
1177534824 21:22411109-22411131 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
1178108682 21:29349419-29349441 CAGGTGCTTGGCAGGGCAGGTGG - Intronic
1178291130 21:31369394-31369416 TAGATGGTGGGAAGGGTAGGAGG + Intronic
1179074547 21:38107593-38107615 CAGGGGGTGGGAAGCGCAGGGGG - Intronic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1180097744 21:45567338-45567360 GAGTTTGTGGGAAGGGCTGGAGG + Intergenic
1180500326 22:15924054-15924076 GAGTTGGAGGTAAGGGCAGGGGG - Intergenic
1181819627 22:25465577-25465599 CAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182318736 22:29464670-29464692 CAGTTGTAGAGAAGGGCAGTGGG - Intergenic
1183231742 22:36586634-36586656 GTGCTGTTGGGAAGGGGAGGTGG + Intronic
1183597680 22:38822320-38822342 CAGTTGATGGGCAGGGAGGGTGG + Exonic
1183608863 22:38883995-38884017 CAAATGCTGGGGAGGGCAGGCGG - Intergenic
1183664571 22:39239883-39239905 CCCTTGGTGGGAATGGCAGGCGG - Intronic
1184804147 22:46781615-46781637 CTGTTTTTGGGGAGGGCATGGGG + Intronic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185167261 22:49269388-49269410 CTGTTGTGGGGTGGGGCAGGGGG - Intergenic
1185224817 22:49646503-49646525 CAGGGGTGGGGAATGGCAGGGGG - Intronic
949130799 3:498316-498338 CAGTTGCTGGGAAGGCCATGTGG - Intergenic
949182491 3:1150986-1151008 TAGATGCTGGGAAAGGCAGGGGG + Intronic
949451774 3:4193429-4193451 CAGTTGATCAGAAGTGCAGGTGG + Intronic
950772526 3:15323688-15323710 AAGCCGTGGGGAAGGGCAGGTGG - Intronic
951097992 3:18654027-18654049 CAGAGGCTGGGAAGGGTAGGAGG - Intergenic
951314583 3:21173335-21173357 CAGATGTTGGGAAGGGAAGGAGG - Intergenic
951458313 3:22919169-22919191 CAGAGGCTGGGAAGGGCTGGGGG + Intergenic
951494622 3:23312521-23312543 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
951904895 3:27695382-27695404 CAGTGGCTGGGAAGGGTAGTGGG + Intergenic
952331071 3:32364969-32364991 CAGCTGCTAGGAAGGGGAGGAGG - Intronic
952603223 3:35109767-35109789 CTGTTGTGGGGAAGAGGAGGGGG + Intergenic
953283076 3:41577614-41577636 CAGAGGTTGGGAAGGGTAGTGGG - Intronic
953740474 3:45534312-45534334 CAGATGCTGGGAGAGGCAGGAGG - Intronic
953809720 3:46101687-46101709 CAGTTGATAAGAAGGCCAGGTGG - Intergenic
954109138 3:48424533-48424555 CAGTTGGTGGAAGGGGCTGGAGG + Exonic
954948042 3:54443892-54443914 GTTTTGTTGGGAAGGGCATGGGG + Intronic
955366047 3:58311073-58311095 CAGAGGCTGGGAAGGGTAGGAGG - Intronic
955658679 3:61273020-61273042 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
955932908 3:64075842-64075864 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
956300926 3:67771462-67771484 TAGTTGTTGCCAAGGGCTGGGGG + Intergenic
956513538 3:70020811-70020833 CAGTTGTTGGGAAGATGACGTGG - Intergenic
956740075 3:72268938-72268960 CAGTTCTTGGGAAGAAGAGGAGG - Intergenic
956877938 3:73481874-73481896 CTGTTTTTTGGAAGGGAAGGAGG - Intronic
956960926 3:74399826-74399848 CAGAGGCTGGGAAGGGCAGGAGG - Intronic
957112470 3:75981919-75981941 CAGAAGCTGGGAAGGGTAGGGGG - Intronic
957645725 3:82922309-82922331 CAGAGGCTGGGAAGGGCAGGGGG + Intergenic
959360694 3:105387178-105387200 CTGCTATAGGGAAGGGCAGGCGG + Intronic
959598950 3:108157434-108157456 CAGTTGTTCAGAAGTGTAGGAGG + Intergenic
959640026 3:108622220-108622242 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
959733472 3:109630648-109630670 CACTTGGAGGCAAGGGCAGGTGG - Intergenic
960641437 3:119827816-119827838 CAGAGGTTGGGAAGGGTAGCGGG + Intronic
962150399 3:132886646-132886668 CAGAGGTTAGGAAGGGCAGTGGG + Intergenic
963774116 3:149421189-149421211 CAGTTGGTGGGGAGGAGAGGAGG + Intergenic
965135511 3:164761742-164761764 CAGAGGCTGGGAAGGGCAAGGGG + Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
966133176 3:176667531-176667553 CAGAGGTTGGGAAGGGTAGTGGG - Intergenic
966400580 3:179543220-179543242 CAGAGGTTGGGAAGGGTAGAGGG - Intergenic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967172057 3:186829390-186829412 GTGTTGTTAGGAAGGGCAGTGGG - Intergenic
967172083 3:186829588-186829610 GTGTTGTTAGGAAGGGCAGTGGG - Intergenic
967504915 3:190243219-190243241 GAATTGCGGGGAAGGGCAGGAGG + Intergenic
967882659 3:194312963-194312985 CTGCTGGTGGGAAGGGAAGGAGG - Intergenic
967963914 3:194945684-194945706 AGGCTGTTGGGAGGGGCAGGAGG + Intergenic
967994478 3:195156279-195156301 CAGTTGATTGTATGGGCAGGTGG - Intronic
969196745 4:5569228-5569250 CAGGTGTGGGGCAGGGGAGGTGG + Intronic
969627233 4:8312201-8312223 CTGTTGATGGGATGGGCTGGAGG - Intergenic
970030819 4:11672641-11672663 CAGTGGTGAGGAAGGGCTGGAGG - Intergenic
971473817 4:27053903-27053925 CAGTTACAGGGAAGGGCTGGTGG + Intergenic
972772345 4:42209134-42209156 CAGATGTTGGGCCGGGCACGTGG - Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
976340241 4:83939184-83939206 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
977233986 4:94485075-94485097 GAGGTGTTGGGAAGGAAAGGAGG + Intronic
977554740 4:98477291-98477313 GAGCTGGTGGGAAGGGCAGCTGG + Intronic
977623586 4:99164941-99164963 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
977691017 4:99911027-99911049 CAGGGGTTGGGAAGGGAGGGAGG - Intronic
978110926 4:104963492-104963514 CAGTGGATGGGATGGGCAGGTGG + Intergenic
978351223 4:107822939-107822961 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
979116905 4:116835998-116836020 CAGTGGCTGGGATGGGTAGGTGG + Intergenic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
981677700 4:147359024-147359046 TAGTAGTTGGCAAGGGCTGGGGG + Intergenic
981807356 4:148732200-148732222 CATTTGTAGGGCAGGGCAGCAGG - Intergenic
982064663 4:151643592-151643614 CAGAGGCTGGGAAGGGAAGGGGG - Intronic
983393470 4:167163581-167163603 CAGAGGTTGGGAAGGGTAGTGGG - Intronic
984453111 4:179929054-179929076 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
984950755 4:185005870-185005892 CAGAGGCTGGGAAGGGCAGTAGG - Intergenic
986371795 5:7087655-7087677 CAGTTGGTGGAAAGGGGAGATGG + Intergenic
986386623 5:7240491-7240513 CAGAGGCTGGGAAGGGGAGGAGG - Intergenic
986694369 5:10338972-10338994 TATTAGCTGGGAAGGGCAGGAGG + Intergenic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
987683937 5:21172119-21172141 CAGTTGTTGGTAGGGCCTGGGGG - Intergenic
987708821 5:21484710-21484732 CACTTGCTGGCAATGGCAGGAGG + Intergenic
988750789 5:34189435-34189457 CACTTGCTGGCAATGGCAGGAGG - Intergenic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
989173172 5:38493745-38493767 AAGTTGTTGGGATGGGAAAGGGG - Exonic
989254231 5:39349430-39349452 GTGTTATTGTGAAGGGCAGGAGG - Intronic
989651019 5:43690417-43690439 CAGGTTTTGGGAAGAGCAGTGGG + Intronic
991371906 5:65926991-65927013 CAGATGGTGGGGGGGGCAGGGGG - Intronic
991573504 5:68079508-68079530 AACTTGGTGGGCAGGGCAGGGGG + Intergenic
991931113 5:71753315-71753337 CAGTTGTTGGCAAGGATATGGGG + Intergenic
992708689 5:79426630-79426652 CAGAAGTTGGGAAGGGTAGTGGG + Intronic
993426075 5:87765665-87765687 CAGTTGTTGTGTAGGGCCAGAGG - Intergenic
993958907 5:94272178-94272200 CAGGAGTTGGGAAGGGTAGTGGG + Intronic
994265441 5:97710630-97710652 CAGAAGCTGGGAAGGGTAGGTGG + Intergenic
994420953 5:99526061-99526083 CACTTGCTGGCAATGGCAGGAGG + Intergenic
994486090 5:100388253-100388275 CACTTGCTGGCAATGGCAGGAGG - Intergenic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
994613765 5:102078177-102078199 CAGTGGTGGGGAAGCACAGGGGG - Intergenic
994753056 5:103763131-103763153 CATTTGTAGGGAAGGGAAGGGGG + Intergenic
995758090 5:115532887-115532909 CAGTGATTGGCAAGGGCTGGGGG + Intronic
996571319 5:124935305-124935327 CAGTTGGTTAGAAGTGCAGGTGG - Intergenic
996619867 5:125487443-125487465 CAGATGTTGTGAAAGGAAGGAGG - Intergenic
998584738 5:143415334-143415356 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
998817760 5:146031152-146031174 CAATTGTTTGGAAGTGCAGATGG - Intronic
998894573 5:146785864-146785886 CAGTGGTTGGGAAGGGCATAGGG + Intronic
1001480578 5:172086542-172086564 CCGTTTTAGGGAAGGACAGGAGG + Intronic
1002105029 5:176875816-176875838 GAGCTGGTGGGAGGGGCAGGGGG - Intronic
1002412343 5:179091948-179091970 CAGATGCTGGGAAGGGAAGTGGG - Intergenic
1002450938 5:179318124-179318146 CCTTGGATGGGAAGGGCAGGAGG - Intronic
1002581337 5:180211068-180211090 CAGGTGTGGGGAAAGGGAGGAGG + Intergenic
1002887503 6:1310382-1310404 CTGGGGTTGGGCAGGGCAGGAGG - Intergenic
1003058652 6:2844653-2844675 CATTTGGTGGGAAAGGCAGAAGG - Intergenic
1003605454 6:7556032-7556054 CATTTGTTGGGAGGGGGACGGGG - Intronic
1003711337 6:8594165-8594187 CAGAGGTTGAGAAGGGTAGGGGG + Intergenic
1003877382 6:10450733-10450755 CAGGTGCTGGGAAGGGCAGTAGG - Intergenic
1003982204 6:11400611-11400633 CAGAGGCTGGGAAGGGTAGGAGG + Intergenic
1004608334 6:17214834-17214856 CTTTTTTTGGGAGGGGCAGGGGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005548860 6:26895740-26895762 CACTTGCTGGCAATGGCAGGAGG - Intergenic
1005693781 6:28332816-28332838 CTGTTGTTGGGATGTTCAGGGGG - Intronic
1006146059 6:31960363-31960385 CAGTTGGGGAGAAGGGGAGGTGG + Intronic
1006688293 6:35856408-35856430 CAGTTGATTAGAAGTGCAGGTGG + Intronic
1007154191 6:39725734-39725756 CAGTTTTTGGGAAGCCGAGGTGG + Intergenic
1007175332 6:39892525-39892547 GAGTTGTTGGGAGAGGCAGGAGG + Intronic
1007255276 6:40523981-40524003 GAGGGGCTGGGAAGGGCAGGGGG + Intronic
1007686698 6:43671414-43671436 CACTGCTTGGGAAGTGCAGGGGG - Exonic
1007811053 6:44485913-44485935 CCGGTGATGGGGAGGGCAGGGGG - Intergenic
1008477430 6:51947636-51947658 CAGTGGTTGGGATGATCAGGAGG - Intronic
1008640439 6:53456940-53456962 CAGTTGTGGGCAAGGGAATGGGG - Intergenic
1008823715 6:55665567-55665589 CAGTTGTGGGGTGGGGAAGGAGG - Intergenic
1008841253 6:55907410-55907432 CAGAGGCTGGGAAGGACAGGGGG - Intergenic
1009391414 6:63148223-63148245 CAGAAGCTGGGAAGGGTAGGGGG + Intergenic
1009995461 6:70890636-70890658 CAGTTGATCAGAAGTGCAGGTGG + Intronic
1011408658 6:87042812-87042834 TAGAGGTTGGGAAGGGTAGGGGG + Intergenic
1011425532 6:87225002-87225024 CAATTGTTGGTAAGGGTATGGGG - Intronic
1012140893 6:95625305-95625327 CAGTGGTTAAGAAAGGCAGGAGG - Intergenic
1012425190 6:99106282-99106304 GAGTGGGTGGTAAGGGCAGGGGG + Intergenic
1013443151 6:110191762-110191784 CAGAAGTTGGTAGGGGCAGGGGG + Intronic
1013451929 6:110290346-110290368 CAGTGGTTGCCTAGGGCAGGTGG - Intronic
1013502574 6:110767208-110767230 CAGAGGTTGGGAAGGGCCAGGGG + Intronic
1014502087 6:122204003-122204025 AAGTTGTTGGGAAGGTAAAGAGG - Intergenic
1014840320 6:126211925-126211947 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
1014976946 6:127898955-127898977 CAGGTGCTGGGAAGGGTAGTGGG + Intronic
1015858052 6:137646574-137646596 CAGAGGCTGGGAAGGGGAGGAGG - Intergenic
1015959974 6:138638201-138638223 CAGAAGCTGGGAAGGGCAGTGGG + Intronic
1016182538 6:141164820-141164842 CACTTGTTTGTAAGGGCAAGAGG + Intergenic
1017074714 6:150607025-150607047 AAGTTGGAGGGAAGGGAAGGGGG - Intronic
1017998221 6:159553537-159553559 GGGTTGCTGGAAAGGGCAGGGGG - Intergenic
1018369174 6:163151373-163151395 GTGTTGCTGGGGAGGGCAGGGGG - Intronic
1018469013 6:164080167-164080189 CAGTTGTTTGGGATGGCAGAGGG + Intergenic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1019101371 6:169633253-169633275 CAGGTGTTGGCAAGAGCAGGTGG + Intronic
1019281216 7:201198-201220 CAGTGGCTGTGAAGAGCAGGGGG + Intronic
1019493179 7:1324480-1324502 CAGGGGCTGGGAGGGGCAGGGGG + Intergenic
1020127460 7:5541050-5541072 GAGGTGTTGGGAGGTGCAGGCGG + Intronic
1020571039 7:9861789-9861811 CAGATATTGGGAAGGGTAGTGGG + Intergenic
1020702802 7:11504304-11504326 CACTTGATGGGAAGGGTGGGAGG + Intronic
1022468880 7:30669599-30669621 CAGATGGAGGGATGGGCAGGAGG - Intronic
1023449842 7:40271834-40271856 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
1023833537 7:44054789-44054811 CAGGGGTTGGGAAGGGCATGGGG - Intronic
1023998532 7:45176690-45176712 CAGAGGTTGGGAAGGGCAGTGGG + Intronic
1024029053 7:45441241-45441263 CAGGGGCTGGGAAGGGCAGTGGG + Intergenic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1024822856 7:53353592-53353614 CAGTTGTTGGGGAGGACTGCTGG + Intergenic
1026224940 7:68432010-68432032 CTATTGCTGGGCAGGGCAGGTGG - Intergenic
1026493138 7:70880431-70880453 CAGTTGTTGGGTGCGGGAGGGGG - Intergenic
1026527251 7:71165192-71165214 CAGGGATTGGGAAGGGCAGCTGG + Intronic
1026721265 7:72832709-72832731 TAGTGGTTGGGAAGGGCCTGTGG - Intergenic
1026848960 7:73713039-73713061 CAGTGGTTGGGAAGGGCTTGGGG - Intronic
1027507856 7:79040449-79040471 CAGAGGCTGGGAAGGGCAAGCGG + Intronic
1027834644 7:83224570-83224592 CAGGTGATGGCAAAGGCAGGAGG + Intergenic
1028365705 7:90028275-90028297 CAGAGGTTGGGAGGGGCAGTGGG + Intergenic
1028761875 7:94506445-94506467 CAGTTTTGGGAAAGGGGAGGAGG + Intergenic
1029088392 7:98029241-98029263 CAGAGGCTGGGAAGGGTAGGTGG - Intergenic
1030629660 7:111881920-111881942 CAGTGGCTGGGAAGGGTAGTGGG + Intronic
1030896558 7:115068377-115068399 CAGTGTTTGCCAAGGGCAGGAGG + Intergenic
1031584647 7:123519634-123519656 CAGAAGCTGAGAAGGGCAGGAGG + Intronic
1031718761 7:125141705-125141727 GATTTGTGGGGAAGGGAAGGAGG + Intergenic
1031792834 7:126132005-126132027 CAGAGGTTGGGAAGTGTAGGGGG + Intergenic
1031907220 7:127474101-127474123 CAGAGGTTGGGAAGGGTAGGGGG - Intergenic
1032003123 7:128278787-128278809 CAGGTGTTAGGAATGGAAGGAGG + Intergenic
1032086423 7:128886348-128886370 CAGTTGTTGGGGCAGGGAGGTGG + Intronic
1032125572 7:129189918-129189940 CATTTGGAGGGAAGGGTAGGGGG + Intronic
1032277480 7:130472076-130472098 TAGAGGCTGGGAAGGGCAGGTGG + Intergenic
1032350607 7:131159554-131159576 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
1032473997 7:132199974-132199996 CAGATGTGGGGAAGGTCAGAGGG + Intronic
1034352687 7:150427740-150427762 CCGTGGTTGGGAAAGGCAGAGGG - Intergenic
1034503443 7:151467292-151467314 CAGTAGGAGGGCAGGGCAGGCGG - Intronic
1035057672 7:156046771-156046793 CAGCTGTGGGGAAATGCAGGTGG + Intergenic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1035414115 7:158668324-158668346 CAGTTGTGGGTAAGGGAGGGCGG - Intronic
1036289493 8:7474957-7474979 CAGTTGCTGGGGATGACAGGGGG - Intronic
1036331981 8:7836574-7836596 CAGTTGCTGGGGATGACAGGGGG + Intronic
1036751247 8:11444777-11444799 CTCTTCTCGGGAAGGGCAGGTGG + Exonic
1036926029 8:12906900-12906922 CAGTTTTTCAGAAGAGCAGGTGG + Intergenic
1038282798 8:26181157-26181179 CAGATGTTGGGATGGGCACTTGG - Intergenic
1038518365 8:28206481-28206503 AAGGAGTTGGGAAGGGGAGGGGG + Intergenic
1039569826 8:38577874-38577896 CAGTTGCTGGGATGGGGAAGAGG - Intergenic
1039636330 8:39170846-39170868 CAGAGGTTGGGAAGGGTAGGGGG + Intronic
1040484020 8:47853411-47853433 GAGTGATTGGGCAGGGCAGGCGG + Intronic
1040628489 8:49179965-49179987 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1041545751 8:59040612-59040634 CAGTAGTTGGCTAGGGCATGAGG - Intronic
1041798046 8:61767668-61767690 CACCTGGTGGGAAGGGCAGATGG + Intergenic
1042874279 8:73426466-73426488 TAGAGGTTGGGAAGGGTAGGGGG - Intronic
1043511605 8:80955521-80955543 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1043654851 8:82650178-82650200 CAGATGCTGGGAAGGGTAGTGGG + Intergenic
1045721345 8:105114432-105114454 CAGTTGGTGGAAAGGAGAGGGGG - Intronic
1045947797 8:107816454-107816476 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
1046118757 8:109818650-109818672 CAGAGGTTGGGAAGGGTAGTTGG - Intergenic
1046275573 8:111955652-111955674 TAGTTGTGGGGAAGAGCTGGTGG - Intergenic
1047161846 8:122389281-122389303 CAGTAACTGGGAAGGGGAGGGGG + Intergenic
1048365757 8:133737383-133737405 CAGATGGTGGAAAGCGCAGGTGG - Intergenic
1048765232 8:137836626-137836648 CAGTTGTAGGGAAAGACATGGGG - Intergenic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1050499754 9:6284241-6284263 CAGATGTTGGGAAGAGCAATGGG - Intergenic
1051789787 9:20788275-20788297 TAGTTGTTGCCAAGGGCTGGAGG + Intronic
1052208556 9:25872641-25872663 CAGAAGATGGGAAGGGCAGTGGG - Intergenic
1054456481 9:65434007-65434029 GAGTTGGTGGGTGGGGCAGGTGG - Intergenic
1054826484 9:69578701-69578723 CAGTTGGTGGCCAGGGGAGGGGG - Intronic
1054964342 9:71005157-71005179 CAGTACTTAGGAAGGCCAGGTGG + Intronic
1055329777 9:75171688-75171710 CACTTCATGGGAAGGGCAAGGGG - Intergenic
1055987123 9:82063264-82063286 CATCTGTGGGGAAGCGCAGGAGG - Intergenic
1056171551 9:83990162-83990184 CAGAGGCTGGGAAGGGTAGGGGG + Intronic
1056664771 9:88572635-88572657 CAGGTGTTGGGAGGTGAAGGGGG + Intronic
1057090978 9:92257927-92257949 CAGTTGTGGGGCATGGAAGGTGG + Intronic
1057160056 9:92882997-92883019 CATCTGTTGGGGAGCGCAGGAGG + Intergenic
1057709044 9:97420454-97420476 CAGTGGTTGCCAAGGGCTGGGGG - Intronic
1059395077 9:114029008-114029030 CAGGTGGTGAGAAGGGCAGTGGG - Intronic
1059594216 9:115698854-115698876 CACTGGCTGGGAAGGGTAGGAGG + Intergenic
1059809432 9:117839343-117839365 CACCTGTTGCTAAGGGCAGGTGG - Intergenic
1060047715 9:120353849-120353871 CAGTGGCTGGGAAGGGTGGGAGG + Intergenic
1060375390 9:123112070-123112092 CAGGTGTGGGGAAAGGCGGGAGG - Intronic
1060446480 9:123693285-123693307 GAGATGGTGGGAAGGACAGGTGG - Intronic
1060866121 9:126999012-126999034 CTGTTGTTGGGTGGGGGAGGGGG + Intronic
1061216770 9:129226177-129226199 CAGCTGGTGGGGTGGGCAGGGGG + Intergenic
1061294072 9:129667485-129667507 CAGGGGTTGGGAAGAGAAGGAGG + Intronic
1062205130 9:135332099-135332121 CAGCTGGTGGGGAGGGCTGGTGG - Intergenic
1062740328 9:138170072-138170094 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1185758765 X:2673371-2673393 CAGGAGCTGGGAGGGGCAGGGGG + Intergenic
1186884581 X:13900396-13900418 GAGTTACTGGGAAGGGCTGGAGG + Intronic
1187170657 X:16848123-16848145 CAGTAGTTGCCAAGGGCTGGAGG + Intronic
1187379478 X:18787291-18787313 CAGGGGTTGGGAAGGGTTGGGGG + Intronic
1187449511 X:19384329-19384351 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1187724542 X:22188909-22188931 CAGAGGTTGGGAAGGGCGGTAGG - Intronic
1187841163 X:23490054-23490076 CAGAGGCTGGGAAGGGGAGGGGG + Intergenic
1187947520 X:24440904-24440926 GAGTTGCTGGAAAGGGCATGAGG + Intergenic
1188328097 X:28832254-28832276 CAAAGGTTGGGAAGGGTAGGAGG - Intronic
1188576330 X:31655293-31655315 CTGATGCTGGGAAGGGTAGGGGG + Intronic
1188831663 X:34905857-34905879 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1189076846 X:37925024-37925046 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
1189787391 X:44571635-44571657 CAGTGGTTGGCAGGGGAAGGAGG + Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190236070 X:48616748-48616770 CAGTTGATGTAAAGGGAAGGAGG + Intergenic
1190760786 X:53436438-53436460 TAGATGCTGGGGAGGGCAGGAGG - Intergenic
1190774852 X:53544519-53544541 CAGTTGAGGGGAAGGGTTGGTGG - Intronic
1191040639 X:56075664-56075686 CAGAGGCTGGGAAGGGTAGGTGG - Intergenic
1191057003 X:56252369-56252391 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1192293498 X:69822843-69822865 CAGTTGTGGGGTGGGGGAGGGGG - Intronic
1192362562 X:70448859-70448881 CAGATGGCTGGAAGGGCAGGGGG + Intronic
1192844834 X:74895778-74895800 CAGAGGCTGGGAAGGGTAGGGGG + Intronic
1193304783 X:79935381-79935403 CAGATGCTGGGAAGGGTAGTGGG + Intergenic
1193642806 X:84032717-84032739 CAGTGGCTGGGAAGGGCAGTGGG - Intergenic
1194521680 X:94926668-94926690 CAGATGCCGGGAAGGGCAGTCGG + Intergenic
1194902152 X:99525645-99525667 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1195286336 X:103387956-103387978 CAGAGGTTGGGAAGGGTAGTAGG + Intergenic
1195596089 X:106691526-106691548 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1195819782 X:108931351-108931373 CAGAGGTTGGGAAGGGTAAGGGG - Intergenic
1196232907 X:113245397-113245419 CAGCTGTTGAGAAGGGTAGTGGG - Intergenic
1196477000 X:116099033-116099055 CAGAGGTTGGGAAGGGTAGCTGG - Intergenic
1197165343 X:123371036-123371058 CAGAGGTTGGGAAGGGTAGTGGG - Intronic
1197553093 X:127918826-127918848 CATTTGTTGGAAAGGTCAGGTGG - Intergenic
1197768745 X:130075678-130075700 CAGCTGATGGCAAGGGCAAGGGG + Intronic
1197792957 X:130273409-130273431 TAGTAGTTGTGTAGGGCAGGAGG - Intergenic
1198586729 X:138129535-138129557 CAGGTGCTGGGGAGGGCTGGAGG + Intergenic
1198724856 X:139666256-139666278 CAGAGGCTGGGAAGGGCATGGGG - Intronic
1198756017 X:139983409-139983431 CAATTGCTGTGAAGGGCAGGTGG + Intergenic
1198796581 X:140403080-140403102 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1199467985 X:148161360-148161382 CAGTGGGTGGGAAGAGGAGGAGG - Intergenic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1200137615 X:153882725-153882747 CAGGGGTTGGGTGGGGCAGGAGG - Intronic
1200139109 X:153889096-153889118 CAGTGGTGGCCAAGGGCAGGGGG - Intronic
1200232097 X:154449183-154449205 CAGGAGTTGGGAAGGGAAGGCGG - Intronic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200424543 Y:3006760-3006782 CACTTATTGGGATGGGCAGGTGG + Intergenic
1200954854 Y:8933204-8933226 AAGTTGGGGGGCAGGGCAGGAGG + Intergenic