ID: 906493683

View in Genome Browser
Species Human (GRCh38)
Location 1:46287554-46287576
Sequence CTTCTCAGGCAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906493683_906493690 28 Left 906493683 1:46287554-46287576 CCTTCCACCCTCTGCCTGAGAAG 0: 1
1: 0
2: 3
3: 36
4: 337
Right 906493690 1:46287605-46287627 ATGCTTTGCTCTAGCCAAGCTGG 0: 1
1: 0
2: 4
3: 59
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906493683 Original CRISPR CTTCTCAGGCAGAGGGTGGA AGG (reversed) Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901265353 1:7905973-7905995 CTTCACAGCCAGTGGGTGGGTGG + Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903478334 1:23635574-23635596 ATTCTTAGGGAGAGGGTGGTGGG + Intronic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
904486125 1:30825426-30825448 ATTCTCAGGCAGTTGGGGGATGG + Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905661447 1:39729179-39729201 ATTCACAGGCAAAGAGTGGAAGG - Intronic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
907475107 1:54700276-54700298 CTTCCCAGGCTGAGGGGGGCAGG - Intronic
911043194 1:93608004-93608026 CTTCTGAGTCAGAGGCTGGATGG + Intronic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
912368120 1:109151470-109151492 CTGCTCAGGCTTTGGGTGGATGG - Intronic
912515885 1:110216362-110216384 CTCCTCAGGAAGGAGGTGGAGGG - Intronic
913966525 1:143381636-143381658 CTTCTAAGGAAGGGTGTGGATGG + Intergenic
914060900 1:144207243-144207265 CTTCTAAGGAAGGGTGTGGATGG + Intergenic
914118250 1:144759126-144759148 CTTCTAAGGAAGGGTGTGGATGG - Intergenic
915002898 1:152609740-152609762 CTACTGAGGAAGAAGGTGGAGGG - Intergenic
915216284 1:154342818-154342840 CTTGTCAGCCAGAGGATTGAAGG - Exonic
916183954 1:162113062-162113084 TATATCAGGCAGAGGGTGGTGGG + Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920698116 1:208197350-208197372 TTACTCAGGCTGAGGGTGAATGG + Intronic
920911148 1:210218103-210218125 CTTTTCTGTCAGAGGGTGGAAGG + Intergenic
922212771 1:223498231-223498253 CTTATCAGTCAGTGGGTGGGAGG - Intergenic
922783715 1:228272849-228272871 CAGCTCAGGGACAGGGTGGAAGG - Intronic
923057501 1:230438105-230438127 ATTCCCAGGCAGAGGGAGCATGG - Intergenic
923099560 1:230801501-230801523 CTCCTGAGGCTGAGGCTGGAAGG + Intronic
1063477425 10:6341046-6341068 CTGCTCAGGTGGAGGGTGAAGGG + Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067551436 10:47239150-47239172 CTTGCCAGGTAGAGTGTGGAAGG - Intergenic
1068936284 10:62638557-62638579 CTGCTGAGCTAGAGGGTGGAAGG - Intronic
1069413991 10:68181783-68181805 TTTCTCAGGCAGGGGGCAGATGG + Intronic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1069636413 10:69927653-69927675 CTTCTAAGGTAGAGGATGGGAGG + Intronic
1069862470 10:71480218-71480240 ATTCTCAGGGAGTGGGTGGCCGG + Intronic
1070530169 10:77330093-77330115 TTTCTCAGGCAGAGGATAGAAGG - Intronic
1072211932 10:93254218-93254240 CTCCTGAGGCAGAGGTTGGTGGG - Intergenic
1072518837 10:96212575-96212597 CTTCTCAAGCACAGCGGGGACGG + Intronic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074230222 10:111526322-111526344 ATTCTGATGCAGAGGGTAGAAGG + Intergenic
1075572876 10:123558330-123558352 CTTCTCATTCTGGGGGTGGAGGG - Intergenic
1075777709 10:124998982-124999004 CTCCTCAGCCAGAGGGTGTCTGG + Intronic
1076029947 10:127149004-127149026 CTTCTTCGGCAGAGGATTGATGG - Intronic
1077065911 11:640847-640869 CTGCTCAGGGTGAGGGGGGAAGG + Intergenic
1077238913 11:1500562-1500584 CCTCTGAGGCAGTGGGAGGATGG - Intronic
1077537012 11:3129274-3129296 CTTCTGAGGCAGGGTGAGGAGGG + Intronic
1077554433 11:3219127-3219149 CTTGTCTGGCACACGGTGGAGGG - Intergenic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1079031257 11:16987974-16987996 TTTCTCAGACAGTGTGTGGAAGG + Intronic
1080556382 11:33421170-33421192 CTTCTCACTCAGGGGATGGAGGG + Intergenic
1080573403 11:33577303-33577325 CTTCTGAGGCAGTTGCTGGAGGG + Intronic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1081775285 11:45671969-45671991 CTCCTCCCGCAGAGGGAGGAGGG - Intergenic
1081984164 11:47289521-47289543 GTTCTCAGGCAGAGGTGGGGTGG + Intronic
1083261141 11:61523796-61523818 CTTCTCCAGCAGAGGATGGGCGG - Intronic
1083808643 11:65089771-65089793 AGTCTGAGGCAGAGGGAGGATGG + Intronic
1084380814 11:68811535-68811557 CTTCTGGGGCAGGGGGTGGGGGG + Intronic
1084607522 11:70181165-70181187 GGGCTCAGCCAGAGGGTGGAAGG - Intronic
1084748427 11:71188309-71188331 CTTCTCAGGCGTATGCTGGAAGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1085428217 11:76423569-76423591 CTTCTCAGTAAGAGGGTTGCTGG - Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089323804 11:117643905-117643927 ATTCTCAGACAGAAGGTGGCAGG + Intronic
1089902548 11:122002630-122002652 ATTATCAGGCTGGGGGTGGAGGG + Intergenic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1091225392 11:133954011-133954033 CTGCTCTGGCAGAGGGGGAAAGG - Intronic
1091841456 12:3624193-3624215 CTTTTCAGGTTGAGGGAGGAAGG + Intronic
1092930020 12:13307072-13307094 CTTCTTGGCCTGAGGGTGGAGGG + Intergenic
1093061932 12:14616488-14616510 TTTCTCTTGCAGAGGATGGAGGG + Intronic
1094141665 12:27188157-27188179 CTTCTGAGGCTGAGGGTGGGGGG - Intergenic
1094319833 12:29172156-29172178 CTTCTCAGACAGTTGGTGGCCGG - Intronic
1094873943 12:34619813-34619835 CATCTCAGACAGGGGGTTGAGGG + Intergenic
1095641311 12:44488553-44488575 CTGCTCTAGCAGATGGTGGAGGG - Intergenic
1096237930 12:49942494-49942516 ATGCCCAGGCTGAGGGTGGAGGG - Intergenic
1096829262 12:54301546-54301568 CTTCTGAGGCTGAGGGGGGAGGG - Intronic
1097753857 12:63387490-63387512 CTTCTCAGGCAAAAAGAGGAGGG + Intergenic
1099012809 12:77312215-77312237 CATCTCAGGCAGAAGGCTGAGGG + Intergenic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101536493 12:105622665-105622687 CTTCTCAGGAAGAGCGTAGGGGG + Intergenic
1101657620 12:106737010-106737032 TTTATCAGGCAGAGGGTAGAAGG - Intronic
1101934857 12:109048949-109048971 CTTCTAAGGAAGAGGGTATAAGG + Intronic
1102188197 12:110965818-110965840 GGTCTCAGGAAGAGGGTGGTAGG + Intergenic
1103310889 12:120006908-120006930 ATTATCGGGCTGAGGGTGGAGGG + Intronic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1106196664 13:27499812-27499834 CTACTCAGAGAGAGAGTGGAAGG - Intergenic
1106541564 13:30695204-30695226 CTTATACAGCAGAGGGTGGAGGG - Intergenic
1107459426 13:40587229-40587251 CTTCTCAGGCAGAGGAGGTCAGG - Intronic
1107834655 13:44403795-44403817 CTTCTCAGCCCCAGGGTAGATGG - Intergenic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1110208593 13:72946903-72946925 CTTTTCAGGCAGACAGTGCAAGG + Intronic
1110507067 13:76299307-76299329 TTTCTCAGGCAGATGGTCCAAGG - Intergenic
1114595711 14:23910008-23910030 CTTCTGAGGCAGGGTGTAGATGG + Intergenic
1115714785 14:36091296-36091318 TTTCTCAGCCAGAGGGAAGAGGG + Intergenic
1118707740 14:68495494-68495516 CTTCTCAGGGCTAGGCTGGAGGG + Intronic
1118763754 14:68896360-68896382 CTTCTCAGGCTGAGGCTGGTGGG - Intronic
1118824810 14:69370349-69370371 CTGCTCAGGCTGAGGGGAGAGGG + Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1120210742 14:81631189-81631211 GAACTCAGGCAGAGGGTGGCTGG + Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121314942 14:92955493-92955515 CTACCCTGGCACAGGGTGGAGGG + Intronic
1121639275 14:95474498-95474520 CTTCCCAGACAGAAGGTGAAGGG + Intronic
1121794579 14:96724451-96724473 TTCCACAGGCAGAGGGTTGAAGG - Intergenic
1122204436 14:100141572-100141594 CTTCCCACGCTGAGGGGGGACGG - Intronic
1122437237 14:101708458-101708480 AGGCTCAGACAGAGGGTGGAAGG + Intergenic
1122925300 14:104896583-104896605 GTTCCCAGGCAAAGGCTGGAGGG - Exonic
1124827088 15:33108103-33108125 CTTCCCTGGCACAGGATGGATGG + Intronic
1124945567 15:34262514-34262536 CTCCACTGGCAGAGCGTGGAGGG - Intronic
1125473772 15:40030126-40030148 CTCCTCAGGCAGGGGTTGGGGGG - Intronic
1126321549 15:47429606-47429628 CTTCCCAGGCAGTTGGTGGCTGG - Intronic
1126881995 15:53109228-53109250 CTCCTGAGGCAGAGGTTAGAAGG - Intergenic
1126937801 15:53730650-53730672 CATCTCAGGGAGAGGATGGTAGG - Intronic
1128521652 15:68379181-68379203 CTGCTCATGCAGAGGTGGGAAGG - Intronic
1129205752 15:74036129-74036151 CTTCTCTGGCTGAGAGGGGAAGG + Intronic
1132165459 15:99583557-99583579 CTTCTCAGGCATATGGTGACTGG - Intronic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1132547330 16:539425-539447 CTCCTCAGCCAGAGGGGGTAAGG + Intronic
1134260415 16:12646882-12646904 CTTCTATGGCGGTGGGTGGAGGG - Intergenic
1134285638 16:12859887-12859909 CTTCTCAGCCCAAGGGTGCAGGG + Intergenic
1135224127 16:20640768-20640790 CTATTCTGGCAGACGGTGGATGG + Intronic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137709425 16:50555955-50555977 TTCCTCAGGGAGAGGGTGGGGGG - Intronic
1137736257 16:50726050-50726072 GGCCTCAGGCAGAGAGTGGAAGG + Intronic
1137883111 16:52073281-52073303 CTTCTCAGGGAGCAGGAGGAGGG + Intronic
1140348018 16:74233795-74233817 CTCCTATGGCAGAAGGTGGATGG - Intergenic
1141173815 16:81706552-81706574 CGTCTCTGGGAGTGGGTGGAGGG + Intronic
1142318816 16:89367577-89367599 CTTGTCAGGCTGAGGAGGGACGG - Intronic
1142559668 17:802694-802716 CTGCTCAGCCCGGGGGTGGAGGG - Intronic
1142687425 17:1585825-1585847 CATGTCAGGCACAGGGTGGGTGG - Intronic
1143108086 17:4539367-4539389 CGTCTCAGGCAGATGGAGGCAGG + Intronic
1143117499 17:4589094-4589116 GTTCTCCGGCAAAGGGAGGAGGG - Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1144727969 17:17511303-17511325 CTGCTCAGGCAGACGCTGTAGGG - Intronic
1145104384 17:20103233-20103255 TTTCTCAGGCAGAGAGGGCAGGG - Intronic
1145772661 17:27504693-27504715 CTGCTCAGGCAGATGGCGGCAGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145966857 17:28925294-28925316 CCTCTCAGGGATATGGTGGAGGG + Intronic
1146667279 17:34713476-34713498 CTCCCCAGCCAGTGGGTGGAGGG - Intergenic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1148815387 17:50324257-50324279 CTTCTTAGGGAAAGGGGGGATGG - Intergenic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1150819250 17:68421851-68421873 CTTCTCAGGAAGAGGCTGGTAGG + Exonic
1151133016 17:71917753-71917775 TTTCTGGGGCAGAGGTTGGAGGG - Intergenic
1151871864 17:76841927-76841949 CTCCTCTGGTAGAGGGTGGGGGG + Intergenic
1151875519 17:76865964-76865986 GTCCTCAGGCAGAGAGTTGAAGG + Intergenic
1152258084 17:79251928-79251950 CTTTTCAGGCAGGGAGGGGAAGG - Intronic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1152613267 17:81326030-81326052 CTTCTCATTCAAAGGTTGGATGG - Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153461717 18:5341694-5341716 CTTCTCAGTAATAGGGTGCATGG - Intergenic
1154336770 18:13472099-13472121 CTCCCCAGACCGAGGGTGGACGG + Intronic
1155447804 18:25930124-25930146 CTTCTCAGTGAGAGGTTGGGTGG + Intergenic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155787157 18:29915213-29915235 TTTTTCAGGCAAAGGATGGAGGG - Intergenic
1156892672 18:42208152-42208174 CTCCTGAGGCAGGGAGTGGAAGG + Intergenic
1160279189 18:77471285-77471307 CTTCTCGTGCAGAGGGAGGGTGG + Intergenic
1160401253 18:78612978-78613000 TTTCTCTGGCAGGGTGTGGAGGG - Intergenic
1160900930 19:1428092-1428114 CTTCTCAGGAGGAGGGTGCGGGG - Intronic
1161652435 19:5493474-5493496 CTTCCCAGGACGAGGGAGGAGGG + Intergenic
1162199085 19:9008361-9008383 TTTCTCAGCCACAGGGTGGAGGG + Intergenic
1163681478 19:18684677-18684699 CCTCTCAGGACCAGGGTGGAGGG + Intronic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1168107723 19:54174517-54174539 CTTCTCGGTCTGAGGGAGGAGGG - Intronic
1168266242 19:55225262-55225284 CTTCTGAGTCTGAGGGAGGAGGG - Intergenic
1168291662 19:55360349-55360371 CTCCTCAGTCTGAGGGAGGAGGG - Intronic
1202700308 1_KI270712v1_random:159131-159153 CTTCTAAGGAAGGGTGTGGATGG + Intergenic
925779971 2:7373077-7373099 CTCCTCTGGCAGAGTTTGGATGG + Intergenic
926892601 2:17650762-17650784 CTTCCCAGGCAGGGAGTTGATGG - Intronic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927694078 2:25228857-25228879 GTTCTCAGGCACAGGGTTGGAGG + Exonic
928102233 2:28445805-28445827 CTGCCCAGGTAGAGGGTGCAGGG - Intergenic
929889634 2:45908229-45908251 CTTCTCAGGCACAGGTTGAAGGG + Intronic
930555248 2:52887004-52887026 TTCCTCATGCAGAGGCTGGAGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932721636 2:74142984-74143006 AAGCTCAGGCAGGGGGTGGATGG - Intronic
932865031 2:75332907-75332929 ATTCTCAGGCAGAGGTTGGGAGG - Intergenic
934171241 2:89542607-89542629 CTTCTAAGGAAGGGTGTGGATGG + Intergenic
934281547 2:91616925-91616947 CTTCTAAGGAAGGGTGTGGATGG + Intergenic
934708272 2:96499699-96499721 CCACTCAGGCAGCGGCTGGAGGG - Intronic
935170856 2:100610625-100610647 CTGCTCAGAAAGAGGGTGCATGG - Intergenic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
936918564 2:117664508-117664530 CTGCTCTGGCTGAGGATGGATGG + Intergenic
937478049 2:122232477-122232499 CTTCCAAGGCACAGGATGGAGGG - Intergenic
938259372 2:129884323-129884345 CTCCTCAGGTACAGGGTGGGTGG + Intergenic
938304833 2:130246062-130246084 TTCCTCAAGCAGATGGTGGAAGG + Intergenic
938449180 2:131401138-131401160 TTCCTCAAGCAGATGGTGGAAGG - Intergenic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
939979393 2:148760130-148760152 CTACTGAGGCTGAGGGAGGAGGG + Intronic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
942822739 2:180135257-180135279 CTTCTCAGGTGTAGGCTGGATGG + Intergenic
943921608 2:193713730-193713752 TTTCAGAGGCAGAGGGTGGGGGG - Intergenic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946252820 2:218423879-218423901 CTGCTCAGGCCTGGGGTGGAGGG + Intronic
946306074 2:218857736-218857758 CTCCTCAGGCAGAGGCAGGGCGG + Intergenic
948308159 2:236965339-236965361 CTGCACAGGCAGTGGGTGTACGG + Intergenic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948710284 2:239821004-239821026 GTTCCCAGGCAGAGATTGGAGGG + Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
948922557 2:241072572-241072594 CTCCTCAGGCAGAGGAGGGAGGG + Intronic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1170328197 20:15179406-15179428 CTCCTCCGGGAGAGGGTGGGAGG - Intronic
1170412456 20:16106199-16106221 TTTCTCAGTCAGAGAGTAGAGGG - Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1173303270 20:41823387-41823409 CTTCTTAGGGAGGGAGTGGATGG - Intergenic
1174102063 20:48135290-48135312 CTCCTCAGGCCAGGGGTGGATGG - Intergenic
1174284707 20:49464528-49464550 CTTTTCAGGCAGGGAGTGGAGGG - Intronic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1177236971 21:18404050-18404072 CATCTGAGTCAGAGGGTAGAAGG - Intronic
1179839710 21:44063456-44063478 CTGCTCAGGCTGAGGATGGTGGG - Intronic
1179980460 21:44893076-44893098 CTTCTCAGTGAGAGGGTGCTGGG - Intronic
1180048139 21:45319048-45319070 CTCCTCAGGCAGAGGGAGACAGG + Intergenic
1180108976 21:45638901-45638923 GTTCTCAGGAAGAGACTGGAGGG - Intergenic
1182074445 22:27485797-27485819 CTTCTCTGGCATTGGTTGGAGGG - Intergenic
1183091523 22:35525465-35525487 GTTCCCAGGCAGAGGGAGGGCGG + Intergenic
1184249839 22:43253771-43253793 CTTCCCAGGAAGAGGATGGGTGG - Intronic
1184884582 22:47334815-47334837 CATCTCACGCAGAGTGGGGATGG + Intergenic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
1184967354 22:47989914-47989936 TTTCTCACTCAGAGGGTAGAAGG - Intergenic
1185232210 22:49689764-49689786 CTTCTCACACTGAAGGTGGAGGG - Intergenic
1185279959 22:49965802-49965824 CTCCTGAGTCAGGGGGTGGAGGG - Intergenic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
949860674 3:8501886-8501908 CTTCTCAGGCAGAGGCGCGAGGG - Exonic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950710135 3:14808071-14808093 CTTCTCTGGAAGAGCCTGGAAGG - Intergenic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953213775 3:40898689-40898711 GGTCTCAGGCTGAAGGTGGAAGG + Intergenic
953328453 3:42032325-42032347 CTTCCCAGGCAGTGGCTGCAAGG + Intronic
953781262 3:45872776-45872798 CCTCTCAGGCTGATGGGGGAGGG + Intronic
954317959 3:49811531-49811553 CTTCTGTGGAACAGGGTGGATGG - Intronic
954578700 3:51691347-51691369 CTGCTCTGGCACAGGGAGGAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955358638 3:58252988-58253010 CTTGTCAGGGAGAGTGTGCAGGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
958185203 3:90110996-90111018 CTTGTCAGACAGTGGGTGCAGGG - Intergenic
960621940 3:119645649-119645671 CTTCACAGGCATAGAATGGAGGG + Intronic
960977842 3:123193726-123193748 CTTATCAGGCAGACTGTGGCAGG - Intronic
961826362 3:129601324-129601346 GTTCTCGGGAAGAAGGTGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963834932 3:150048487-150048509 GTGCCCAGGCAGTGGGTGGAAGG - Intronic
964987813 3:162766157-162766179 CTCCACAGGCAGAGGGCAGAGGG + Intergenic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
965590810 3:170358261-170358283 CTTCCCAGGGAGAGGGTGCGCGG + Intronic
966077160 3:175951268-175951290 CATTTCTGGCAGAGGGTTGAAGG + Intergenic
967364180 3:188667144-188667166 AGTCTCAGGCACAAGGTGGAAGG + Intronic
968150862 3:196335640-196335662 CCTGTCAGCCAGAGGGTTGATGG - Intronic
968202044 3:196763064-196763086 TTTCCCAGGCAGGGGGTGGGGGG - Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
969338882 4:6528149-6528171 CTTCCCAGGCCGAGGGTACAGGG - Intronic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
975720696 4:77245990-77246012 CTTCCCATCCAGAGGGTGGTGGG + Intronic
976218157 4:82733829-82733851 GTTCTGAGTCAGAGGGTGGTGGG - Intronic
979409097 4:120352807-120352829 CATCTCAGGCAGAGAGTGAGAGG - Intergenic
982565030 4:156975310-156975332 CTGCTGAGGCTGAGGGTAGAGGG + Intergenic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
983953494 4:173670448-173670470 CTTCTCACACATAGGGTGGGTGG + Intergenic
984766431 4:183403977-183403999 CTTCTCAGGCTGGGGCTGGGTGG - Intergenic
985566098 5:618486-618508 CTTGTCAGGCACAGTGAGGAAGG + Intronic
985696412 5:1343301-1343323 CTCTTCAGGCAGAGGGTGCAGGG + Intronic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986442690 5:7795547-7795569 CTTCTGGGGCATGGGGTGGATGG + Intronic
988879754 5:35488462-35488484 CTTCAAAGTCAGAGGGTGAAGGG - Intergenic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989723584 5:44559572-44559594 GGACTCAGGGAGAGGGTGGAAGG + Intergenic
990515561 5:56528086-56528108 TTTCTCAGGGACAGGGTGGGGGG - Intronic
991145095 5:63292632-63292654 CATTTCAGGTAGAGAGTGGAGGG + Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994560665 5:101366982-101367004 GTTTTCAGGCAGATGGGGGAGGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997803285 5:136888500-136888522 CTTGCCAGGCAGAGGGATGAGGG - Intergenic
997867383 5:137476575-137476597 CTTCTCAGGCTGAGTGGGGCAGG + Intronic
998139216 5:139690467-139690489 ATTCTGAGGCAGAGGGAGGCAGG - Intergenic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999302420 5:150499466-150499488 CTTCTAAGGCAGCGGGTGTAAGG + Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1001068464 5:168560349-168560371 ATTCTTAGGCAGAGGTTTGAAGG - Intronic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1003108198 6:3231350-3231372 CTTCCCAGGCGGAGGAGGGAAGG - Intronic
1003445549 6:6180320-6180342 TTGCTCTGGCACAGGGTGGACGG - Intronic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004706992 6:18133926-18133948 CTACACAGGCAAAGGCTGGAGGG + Intronic
1005347282 6:24903063-24903085 CTCCTCAGTCAGATGGTGGCTGG + Intronic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1005740328 6:28785396-28785418 CTTCTGGGGGAGGGGGTGGAGGG - Intergenic
1006569493 6:34989309-34989331 CTTCTGAGGTAGAGGGTTGTGGG + Exonic
1007599834 6:43074963-43074985 CTTTTCAGTCAGAGGGTTGGGGG + Exonic
1008691828 6:53987733-53987755 CTGCTCAGGCTGAGGGCGAAAGG - Intronic
1012865816 6:104616670-104616692 ACTCTCAGGCAGTGGGAGGATGG - Intergenic
1017720656 6:157241014-157241036 TTGCTGAGGAAGAGGGTGGAGGG + Intergenic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018397114 6:163386744-163386766 CTTCTCTGGCAGAGGAAGGGAGG + Intergenic
1018452392 6:163921319-163921341 CTTGTCATGCAGAGGTGGGATGG + Intergenic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1018836950 6:167492327-167492349 TCTCTCAGGCAGTGGGAGGATGG + Intergenic
1018858340 6:167691653-167691675 CTTCACAGGCAGTGGGCGTATGG + Intergenic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1019768776 7:2870466-2870488 CTGCTCAGGCAGAGAGGGGCAGG - Intergenic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020003079 7:4766602-4766624 CTTCTCAGGCAGGGAGGAGATGG + Exonic
1020352391 7:7235351-7235373 CCTCTCAAGCAGAGGTTGAATGG + Intronic
1020611521 7:10403520-10403542 CTTCTCTGGTGGAGGGGGGAGGG - Intergenic
1022818679 7:33937769-33937791 CTTCTCTGGCAGAGGTGGGCAGG - Intronic
1022852279 7:34276346-34276368 TTTCTCAGGGATAGGGTAGAAGG + Intergenic
1022983479 7:35626558-35626580 TTTCCCAGACAGTGGGTGGAGGG - Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024128273 7:46323217-46323239 CTCCTAAGCCAGAGGGTGGGAGG + Intergenic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1034540083 7:151752398-151752420 CTTAAGAGGCAGAGGGTGGGAGG + Intronic
1034982896 7:155489933-155489955 CTTCTCTGGCAGCAGGTGGAAGG + Intronic
1035126718 7:156613204-156613226 TTTCTCAGTCAGCGGGTGGAGGG - Intergenic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1037376778 8:18238687-18238709 CTTCTAACGCAGTGGGAGGAGGG - Intergenic
1038143888 8:24875970-24875992 CTTCTCAGGAAGCTGGGGGATGG + Intergenic
1038715970 8:29991528-29991550 CTTCTCAGTCACAAGGTGAATGG + Intergenic
1041191988 8:55364127-55364149 CTGCTCAGGCAGAGGCTGCCTGG - Intronic
1042393563 8:68264550-68264572 CTTCTTAGAAAGAGGGTGAAGGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1047235762 8:123040840-123040862 CTTCTAAGGCAAAGGGGGAAAGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1050194235 9:3063702-3063724 CTGCTCAGGCAGATGCTGGCTGG + Intergenic
1051227629 9:14918536-14918558 CTTCTCAGCAAGAGGGTACAAGG - Intergenic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1053412122 9:37922698-37922720 ATTCTCAGGCAGAGGGAGAAAGG + Intronic
1055248225 9:74272878-74272900 CTTCTCATGTAGATGGTAGAGGG - Intergenic
1056480506 9:86998958-86998980 CTTCTCAGGCAGAGCTTGAAAGG - Intergenic
1057813852 9:98279512-98279534 CCGCTCAGGTAAAGGGTGGAGGG - Intergenic
1058906402 9:109485713-109485735 CTTCTCAGGATGGTGGTGGAAGG - Intronic
1059522381 9:114955752-114955774 CCTCTCAGACAAAGGGTTGAGGG - Intergenic
1061023553 9:128032768-128032790 CTCCTGAGGCTGAGGGGGGAGGG - Intergenic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186267346 X:7846319-7846341 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1186376542 X:9009024-9009046 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1186511764 X:10134994-10135016 TTTCTGGGCCAGAGGGTGGATGG + Intronic
1186675591 X:11814041-11814063 CTTCTCATGTAGAGGGAGAATGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1187972635 X:24674097-24674119 CTTCTCAGACTGATGGTGGGTGG + Intergenic
1190187027 X:48244116-48244138 CTGATCAGGCAGAGGGTTGGGGG + Intronic
1190657440 X:52624525-52624547 CTGATCAGGCAGAGGGTTGAGGG - Intergenic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1195575003 X:106439605-106439627 ATTCACAGAAAGAGGGTGGAGGG - Intergenic
1196121014 X:112050710-112050732 CTTCTCAGGTAGAGGAGAGAAGG + Intronic
1196798909 X:119524633-119524655 CTTCGGAGGCTGAGGTTGGAAGG + Intergenic
1197675216 X:129322604-129322626 CTTCACAGCCAGATGGTTGAGGG - Intergenic
1197894324 X:131294948-131294970 CTTCTCGGGGAGAGGATAGAAGG - Intronic
1199845887 X:151692988-151693010 CTTGTCAAGCTGAGGCTGGAGGG - Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic