ID: 906494747

View in Genome Browser
Species Human (GRCh38)
Location 1:46296699-46296721
Sequence GACACTAGGGTGTTCTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906494747_906494753 14 Left 906494747 1:46296699-46296721 CCCCTGCAGAACACCCTAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 906494753 1:46296736-46296758 ACTCCATTTGAACTTAGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 263
906494747_906494754 15 Left 906494747 1:46296699-46296721 CCCCTGCAGAACACCCTAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 906494754 1:46296737-46296759 CTCCATTTGAACTTAGTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906494747 Original CRISPR GACACTAGGGTGTTCTGCAG GGG (reversed) Intronic
900029707 1:362173-362195 GTCACTAGGCTGGTGTGCAGTGG - Intergenic
900050305 1:590925-590947 GTCACTAGGCTGGTGTGCAGTGG - Intergenic
901610637 1:10495122-10495144 GACACAAGAGTATTTTGCAGTGG - Intronic
905848109 1:41251041-41251063 GACACTAGGGTCTACTTGAGCGG - Intergenic
906082780 1:43104690-43104712 GACACTAGGCTGGAGTGCAGTGG + Intergenic
906494747 1:46296699-46296721 GACACTAGGGTGTTCTGCAGGGG - Intronic
906896280 1:49776391-49776413 ATCACTAGAGTGTTCTACAGAGG - Intronic
911992239 1:104714586-104714608 CTCACTAGGGTGTTCTTCAAAGG + Intergenic
920498898 1:206474098-206474120 GACACTCTGATCTTCTGCAGGGG - Intronic
922108146 1:222530339-222530361 GACACAGGGGTGTCCGGCAGAGG + Intronic
923686735 1:236158799-236158821 GACACTAGGGTGTCCAGATGTGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065955159 10:30687388-30687410 GACCCCAGGCTGTTGTGCAGGGG - Intergenic
1068022937 10:51607005-51607027 CACACTAGGGTTCTCTTCAGAGG - Intronic
1068661221 10:59625298-59625320 GACACTGGGGTGTTATTGAGTGG + Intergenic
1069036447 10:63650670-63650692 GTCACTAGGTTGGACTGCAGTGG + Intergenic
1070013961 10:72505793-72505815 GACACTAGGGACTACTACAGAGG + Intronic
1072552394 10:96488705-96488727 GACAGCAGCATGTTCTGCAGGGG + Intronic
1075173315 10:120136017-120136039 GACATCAGGGAGTTGTGCAGAGG + Intergenic
1078770113 11:14341635-14341657 GACACAAGTGTTTTCTTCAGGGG - Intronic
1079158692 11:17973240-17973262 GACCTTAGGGTGGTCTGCAGGGG - Intronic
1079648959 11:22902331-22902353 GTCACTAGGGTGTAATTCAGAGG - Intergenic
1081084131 11:38778038-38778060 GACACTGGGGTCTACTGGAGAGG + Intergenic
1082712067 11:56565110-56565132 GACACTGGGGTCTTCTTGAGGGG - Intergenic
1087334951 11:96832176-96832198 GACATTAGGATGCTCTGAAGAGG - Intergenic
1089687526 11:120165832-120165854 GACACTGGGGTCTTCTTGAGAGG - Intronic
1090442957 11:126739330-126739352 TACACAAGGGTGTTATGCAGAGG - Intronic
1092950427 12:13498528-13498550 GGCTCCAGGGTGTTCTGAAGGGG - Intergenic
1094333067 12:29317642-29317664 GTCACTAGGGTTTTCTGAATAGG + Intronic
1094641579 12:32281103-32281125 TCCCATAGGGTGTTCTGCAGAGG - Intronic
1096149891 12:49302518-49302540 GACACTAGGCTGAAGTGCAGTGG + Intergenic
1096723983 12:53546333-53546355 GTCACTAGGGTGAACTGCAGTGG - Intronic
1098071104 12:66675630-66675652 GACAAAAGGGTTTTCTGGAGTGG - Intronic
1098852745 12:75616945-75616967 GACACTGGGGTCTACTTCAGGGG + Intergenic
1099512807 12:83557751-83557773 GACACTGGGGTGTACTTGAGGGG - Intergenic
1103617205 12:122161847-122161869 GACACTGGGGTTTACTGGAGGGG - Intergenic
1106020614 13:25911384-25911406 GGTACTAGGGTGATTTGCAGGGG + Intronic
1109614902 13:64820084-64820106 GACACTAGGGTCTACTTGAGGGG + Intergenic
1113400414 13:109987619-109987641 GACACTCGGTTCTTCTGCAAAGG + Intergenic
1119772140 14:77226805-77226827 GTCACCAGGGTGATGTGCAGTGG + Intronic
1122401627 14:101470760-101470782 GTCAACAGGGTGCTCTGCAGAGG - Intergenic
1123206986 14:106723481-106723503 CACACTATCCTGTTCTGCAGAGG + Intergenic
1123212005 14:106770484-106770506 CACACTATCCTGTTCTGCAGAGG + Intergenic
1125438788 15:39677954-39677976 GTCACTAGGCTGTAGTGCAGTGG - Intronic
1127081733 15:55387188-55387210 GTCATTAGGGTGTTCTGTACTGG - Intronic
1128870834 15:71154211-71154233 GACAGCAGGGTGTGCTGGAGAGG - Intronic
1139557408 16:67721151-67721173 GGCACCAGGGTTTTATGCAGAGG - Intergenic
1140263069 16:73397436-73397458 GCCACTAGGGTGTTTTAAAGTGG + Intergenic
1143394440 17:6580866-6580888 GACACTAGGGGACTCTGCACGGG + Intronic
1146799482 17:35807232-35807254 GACACTGGGGTGTACTTGAGTGG + Intronic
1151468778 17:74304924-74304946 GACACAGTGGTGCTCTGCAGAGG + Intronic
1152950050 17:83224387-83224409 GTCACTAGGCTGGTGTGCAGTGG + Intergenic
1157202293 18:45669235-45669257 AACACTAGACTGTGCTGCAGTGG - Intronic
1157847385 18:51016642-51016664 GTCACAAGGGTGGACTGCAGTGG - Intronic
1160230367 18:77044122-77044144 CACACTGGGCTGGTCTGCAGAGG + Intronic
1161288632 19:3481041-3481063 GCTACTAGGGTGTGCTGAAGTGG + Intergenic
1168588719 19:57615191-57615213 GAATCTAAGGTGTTCTGCACTGG + Intronic
927219745 2:20695981-20696003 CACACTCTGGGGTTCTGCAGTGG - Intronic
928258085 2:29742322-29742344 GTCACAAGGGTGTTCAGAAGAGG - Intronic
929410838 2:41696218-41696240 GACCAGGGGGTGTTCTGCAGAGG - Intergenic
930691441 2:54369826-54369848 CTCACTTGGCTGTTCTGCAGTGG - Intronic
932326869 2:70869039-70869061 GACACTGGGGTGGTATGAAGAGG + Intergenic
932524283 2:72446603-72446625 GACACTGGGGTGTACTAGAGTGG + Intronic
936369794 2:111894238-111894260 GTCACCAGGCTGTTGTGCAGTGG - Intergenic
937470231 2:122168252-122168274 CACACCAGGCTGTTCCGCAGTGG - Intergenic
937762894 2:125627375-125627397 GACACCAGGGTCTGTTGCAGGGG + Intergenic
940795388 2:158071821-158071843 GACACTAAGGTAGTATGCAGTGG + Intronic
942969002 2:181934257-181934279 GAAATTAGTGTGCTCTGCAGAGG - Intergenic
945323759 2:208458607-208458629 GACACTGGGGTGTACTTGAGGGG - Intronic
946812667 2:223542756-223542778 AAGACTGGGGTGTTTTGCAGAGG - Intergenic
948880602 2:240855488-240855510 GATACTGGGGAGTTCTGCTGGGG - Intergenic
1168852491 20:986128-986150 GAAGCTAGGGTGATCTGAAGAGG + Intronic
1172529038 20:35617941-35617963 GGAATTAGGGGGTTCTGCAGGGG - Intronic
1178827889 21:36031816-36031838 GACACTGGCGTGTTGTGCAGGGG + Intergenic
1178827899 21:36031860-36031882 GACACTGGCGTGTTCTGTGGGGG + Intergenic
1178827975 21:36032202-36032224 GACACTGGCGTGTTCTGTGGGGG + Intergenic
1178827996 21:36032307-36032329 GACACTGGTGTGTTGTGCGGGGG + Intergenic
1180930897 22:19590764-19590786 GACAGTAGGGTGTTGTGGAAGGG + Intergenic
1180945104 22:19688431-19688453 GAGACTAGGGAGGTCTCCAGAGG - Intergenic
1181012950 22:20052895-20052917 GCCACTGAGGTGTGCTGCAGGGG + Intronic
1182847484 22:33443466-33443488 GGCACCAGAGGGTTCTGCAGAGG - Intronic
1183007214 22:34913469-34913491 GAGACTAGGGTGAGCTTCAGAGG - Intergenic
1183094807 22:35545711-35545733 GGGAAGAGGGTGTTCTGCAGAGG + Intronic
1184670980 22:46012240-46012262 GACACTGGGCTGGCCTGCAGGGG + Intergenic
1184721605 22:46317757-46317779 GACACACGGGTGTGCAGCAGAGG - Intronic
950742208 3:15061032-15061054 GACACTGGGATACTCTGCAGTGG - Intronic
952554535 3:34517389-34517411 GACACTAAGGACTACTGCAGTGG + Intergenic
955280878 3:57593639-57593661 AATACTAATGTGTTCTGCAGAGG - Intronic
957218370 3:77350495-77350517 GATACTAGGAAGTTCTGGAGTGG - Intronic
960148239 3:114226066-114226088 GGCACATGGGTGTTCTGCATAGG + Intergenic
961719429 3:128882976-128882998 GACACTTGGGTCTTGTGCAATGG - Intronic
968832731 4:2941546-2941568 GCCACTAGGGTGCTCTGCCTGGG - Intronic
969378013 4:6775910-6775932 GGCACGAGGGTGTGCAGCAGAGG + Intergenic
971306791 4:25490065-25490087 GACACTAGGGTGTACTTGAGGGG + Intergenic
980674246 4:136053967-136053989 GTCATTGGGGTTTTCTGCAGTGG - Intergenic
984879603 4:184398926-184398948 GACACGGGGGAGATCTGCAGAGG + Exonic
985658798 5:1145376-1145398 GGCACTCGGGGCTTCTGCAGGGG - Intergenic
986790764 5:11157443-11157465 GCCACTAGGCTGTTGTGCTGGGG + Intronic
987080431 5:14420797-14420819 GAAATTAGTCTGTTCTGCAGAGG + Intronic
987865908 5:23538354-23538376 GACACTAGGGTCTACTTCAGTGG - Intergenic
989575744 5:42986567-42986589 GACACTAGCGTTTTCTGTTGAGG - Intergenic
994145759 5:96393335-96393357 GACACCAGGGTGTTCTCCTTAGG + Exonic
998578979 5:143350157-143350179 AACCCTAGGGTGTTCTAAAGAGG + Intronic
999380138 5:151115687-151115709 GACACTAGGGTGGCTTGCTGAGG - Intronic
1001063523 5:168515759-168515781 GACACAAGGCAGTTCTGCAGCGG - Intronic
1001451850 5:171832123-171832145 GACACTAGGGACTACTACAGTGG - Intergenic
1002744282 5:181458199-181458221 GTCACTAGGCTGGTGTGCAGTGG + Intergenic
1002870572 6:1163794-1163816 GACAGTAGGATGTTTTCCAGGGG + Intergenic
1003443431 6:6164318-6164340 GACACTGGGGTCTACTGGAGTGG + Intronic
1007024853 6:38560740-38560762 GACACTGGGGTGTACTTGAGCGG - Intronic
1009382396 6:63048688-63048710 GACACTAGGGACTACTACAGGGG - Intergenic
1011238674 6:85246831-85246853 GACACTGGGGAGTACTGGAGGGG - Intergenic
1019249199 6:170731752-170731774 GTCACTAGGCTGGTGTGCAGTGG + Intergenic
1019758604 7:2791708-2791730 GAAACAAGGGTCTACTGCAGGGG + Intronic
1020138907 7:5601863-5601885 AACACAGGGGTGTTCTGCAGTGG + Intronic
1020771333 7:12398875-12398897 GACACTAGGGACTACTGAAGGGG + Intronic
1021837492 7:24694594-24694616 GACACTGGGGTCTACTGGAGTGG - Intergenic
1024207803 7:47178702-47178724 CACACCAGGCTGTCCTGCAGAGG - Intergenic
1025004471 7:55343724-55343746 GCCACGAGGGTTTTCTGTAGGGG - Intergenic
1026078589 7:67196881-67196903 GACACCAGGGTGTGCAGCAAGGG + Intronic
1026759426 7:73115354-73115376 CACACTACTGTGTTCTGTAGAGG + Intergenic
1030685943 7:112487237-112487259 GGCACTATGGGCTTCTGCAGTGG - Intronic
1033718083 7:144024011-144024033 AACACTGAGGTGTTCTGAAGAGG - Intergenic
1034427201 7:151020310-151020332 GACACTGGGATGTACTGGAGAGG - Intronic
1035498903 8:75908-75930 GTCACTAGGCTGGTGTGCAGTGG - Intronic
1040060295 8:43097848-43097870 GGGACTGGGGAGTTCTGCAGTGG + Intronic
1040066303 8:43147378-43147400 GACACCAGGGTATTCTCCAGGGG + Intronic
1040986703 8:53302650-53302672 GACCCCAGGGTGTTCCACAGGGG + Intergenic
1043408854 8:79970686-79970708 CACTGTAGGTTGTTCTGCAGTGG - Intronic
1047816963 8:128475136-128475158 AAAACTAGGGTATTCTGCAATGG + Intergenic
1048495894 8:134935976-134935998 GAGACGAAGGTGGTCTGCAGAGG + Intergenic
1048526093 8:135204420-135204442 GACACTAGGGACTACTGGAGTGG + Intergenic
1049219627 8:141422972-141422994 AACAGCAGGGCGTTCTGCAGAGG - Intronic
1052552759 9:29971512-29971534 GTCACTAGGCTGTAATGCAGTGG + Intergenic
1052703769 9:31969554-31969576 GACACTGGGGAGCTCTGCAGAGG - Intergenic
1055061447 9:72072906-72072928 GCCACTTGGCTGTGCTGCAGTGG - Intergenic
1055100855 9:72463796-72463818 GACACTGGGGTGTACTTGAGAGG + Intergenic
1056127398 9:83549112-83549134 GACACTGGGGTCTTCTTGAGGGG - Intergenic
1061213597 9:129207524-129207546 GACACTAGGAGCTGCTGCAGAGG + Intergenic
1203610094 Un_KI270748v1:88693-88715 GTCACTAGGCTGGTGTGCAGTGG + Intergenic
1186536950 X:10359896-10359918 AACAATAGGTTGTTCTGCTGAGG - Intergenic
1186759509 X:12708821-12708843 TACACTAGAGAGCTCTGCAGTGG + Intronic
1193824089 X:86201269-86201291 GACACCAGGGTCTTCTTGAGGGG + Intronic
1193932239 X:87567788-87567810 GACACTGGGGACTTCTGGAGGGG + Intronic
1198245068 X:134822751-134822773 GACACTAGGGTCTACTTGAGCGG + Intronic