ID: 906496085

View in Genome Browser
Species Human (GRCh38)
Location 1:46304912-46304934
Sequence CCAAGTGACCAGAGAACAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906496085_906496090 -8 Left 906496085 1:46304912-46304934 CCGTCTGTTCTCTGGTCACTTGG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 906496090 1:46304927-46304949 TCACTTGGGGGCAGCCATTCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
906496085_906496095 14 Left 906496085 1:46304912-46304934 CCGTCTGTTCTCTGGTCACTTGG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 906496095 1:46304949-46304971 GGCTGTGGGTTCAGAATAATTGG 0: 1
1: 0
2: 0
3: 20
4: 192
906496085_906496092 -1 Left 906496085 1:46304912-46304934 CCGTCTGTTCTCTGGTCACTTGG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 906496092 1:46304934-46304956 GGGGCAGCCATTCTGGGCTGTGG 0: 1
1: 0
2: 1
3: 30
4: 368
906496085_906496093 0 Left 906496085 1:46304912-46304934 CCGTCTGTTCTCTGGTCACTTGG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 906496093 1:46304935-46304957 GGGCAGCCATTCTGGGCTGTGGG 0: 1
1: 1
2: 2
3: 23
4: 197
906496085_906496091 -7 Left 906496085 1:46304912-46304934 CCGTCTGTTCTCTGGTCACTTGG 0: 1
1: 0
2: 0
3: 27
4: 271
Right 906496091 1:46304928-46304950 CACTTGGGGGCAGCCATTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906496085 Original CRISPR CCAAGTGACCAGAGAACAGA CGG (reversed) Intronic
900816663 1:4852452-4852474 GCAAGTGGCCAGTGAACAGCAGG + Intergenic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
903654598 1:24941677-24941699 CCAAGGGACCAGAGGCCAGCAGG + Intronic
905581553 1:39086323-39086345 CCAAGTGAGGAGACAACAGTGGG + Intronic
906003428 1:42446877-42446899 TCAAGTGAGCAAAGAACAAATGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906588164 1:46999151-46999173 CCAGGTGAACAGAGAAGAGCTGG - Intergenic
906982131 1:50642806-50642828 AAAAGGGAACAGAGAACAGATGG - Intronic
913580985 1:120226540-120226562 CCAAGAGCCCAGAGGACTGATGG - Intergenic
913627193 1:120671860-120671882 CCAAGAGCCCAGAGGACTGATGG + Intergenic
914562915 1:148837977-148837999 CCAAGAGCCCAGAGGACTGATGG - Intronic
914609912 1:149292245-149292267 CCAAGAGCCCAGAGGACTGATGG + Intergenic
915496628 1:156286441-156286463 CAAAGAGACCAGTGAGCAGAGGG - Exonic
916231063 1:162541808-162541830 GCAAGAGAACAGAGAACTGAGGG - Intergenic
917802347 1:178581997-178582019 TCAAGGGGCCAGAGAGCAGATGG - Intergenic
918064811 1:181092930-181092952 CCAAGTGTCCAGAGAAAAAGAGG - Intergenic
918332664 1:183474037-183474059 CCCAGTGACCACAGGACAGTTGG + Intronic
919225947 1:194701808-194701830 CCAAGTGATGAGAGCACAGCTGG + Intergenic
919967086 1:202538621-202538643 CCAAGAGTCCAGAGAAAAGAGGG + Intronic
920380340 1:205531400-205531422 CCAAGGGACAAGAGATCACATGG + Exonic
1064934187 10:20662027-20662049 CAAAGTGAGCAGAGATCAGCAGG + Intergenic
1065240877 10:23703012-23703034 CCGAGGGACCAGAATACAGAGGG - Intronic
1065623934 10:27611543-27611565 GTAAGTGACAAGAGAAGAGAGGG + Intergenic
1066076629 10:31884655-31884677 TCAAGTGACCAGTGTACAGTGGG - Intronic
1066178173 10:32932467-32932489 CTAAATGACCAGAGAACAAATGG + Intronic
1067400104 10:45964867-45964889 CCAAACTACAAGAGAACAGAAGG + Intergenic
1068224296 10:54086664-54086686 CAAAGTGACCATAGGATAGAAGG + Intronic
1069625467 10:69865197-69865219 CCAAGTCCCCACAGTACAGATGG - Intronic
1069760784 10:70809595-70809617 CCAAGTAACCACAAGACAGAGGG + Intergenic
1074105715 10:110388426-110388448 AAAAGTGACCAAAGAATAGAGGG + Intergenic
1074810613 10:117101417-117101439 CCAAGGGATAAGAGAACAGCTGG + Intronic
1077025080 11:436518-436540 CCAACCAACCACAGAACAGAAGG + Intronic
1077652597 11:3986982-3987004 CCAAGTGGCTAGATAAAAGAGGG - Intronic
1078189405 11:9079262-9079284 CCAAGGGAGCAGAAAACACAAGG + Intronic
1078412579 11:11138970-11138992 CTAAATGACCAGTGAACACATGG + Intergenic
1079503028 11:21124053-21124075 CCAAATAAACAGAGAACAGAGGG + Intronic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084591049 11:70090777-70090799 CCAAGTTACCAGTGAAAAGTTGG - Intronic
1085206900 11:74740036-74740058 CCAAGTAAACAAAGAACAGTGGG + Intergenic
1085532639 11:77201052-77201074 CCGTGTGACCAGAGCACAGGGGG + Intronic
1087821987 11:102722715-102722737 CAAAATGACCAGAGAACTGGAGG - Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088208225 11:107420111-107420133 CAAAGTGAAAAAAGAACAGATGG + Intronic
1089326686 11:117662233-117662255 CCAAGTATTCAGAGAAGAGAAGG + Intronic
1089362186 11:117898252-117898274 CCAAGTTACCAGAAACCACATGG + Intergenic
1090265745 11:125351808-125351830 CCAAGTGACCCGAGAATGGGGGG - Intronic
1096216568 12:49801068-49801090 CCAAGCTACCAGTGAGCAGAGGG + Intronic
1096658515 12:53106372-53106394 CCTAGTGGCCAGAGAAATGAGGG + Intronic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1097932138 12:65200004-65200026 CCAGGTAACAAGGGAACAGAGGG + Intronic
1098470586 12:70838911-70838933 CCAAGTGTCCACTGAACATATGG + Intronic
1098539380 12:71636771-71636793 CCAAGTAACCAGAAAAAAGTAGG + Intronic
1099060754 12:77904703-77904725 CCAAGCTAACAGGGAACAGAAGG + Intronic
1101412194 12:104478837-104478859 CCAAATGACCAGAGACTAGATGG - Intronic
1102179970 12:110904946-110904968 CCAAGTGACCACAGCCAAGATGG - Intronic
1102182933 12:110926094-110926116 GCAAGGAAACAGAGAACAGAGGG + Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105830078 13:24156436-24156458 CCAAAGGACTAGAGTACAGATGG - Intronic
1106051846 13:26197851-26197873 CCATATGATCAGAGAACAGACGG - Intronic
1106235075 13:27854388-27854410 CCAGGTAACCAGCGACCAGATGG + Intergenic
1106949668 13:34869533-34869555 CAAACAAACCAGAGAACAGATGG - Intergenic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1108773476 13:53734130-53734152 CCAAGTTACCAAGGAACATAGGG - Intergenic
1109118698 13:58425813-58425835 CCAAATTCCCAGAGGACAGACGG - Intergenic
1109150235 13:58837969-58837991 ATTAGTGACCATAGAACAGAAGG - Intergenic
1109571945 13:64204427-64204449 CCAATTGAAAAGAGAACACATGG - Intergenic
1111770218 13:92586754-92586776 CCAAGTGCCCTGGGAGCAGAGGG + Intronic
1113154777 13:107307309-107307331 ACAAGAGATGAGAGAACAGAGGG + Intronic
1116484228 14:45427644-45427666 CCATGGGACCAGGGAAAAGAGGG + Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117354676 14:54912489-54912511 CCAACTGATCATAGATCAGATGG + Intergenic
1118017628 14:61676009-61676031 CAAAGTGACCAGGTAACAGCTGG + Intergenic
1119935132 14:78585381-78585403 CCAAGGGGCCAGAGAATGGAAGG + Intronic
1120346291 14:83294452-83294474 GCAAGTGACCAGTGACTAGATGG - Intergenic
1120695659 14:87641636-87641658 CCAAGGCACCAGAATACAGATGG + Intergenic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1120918092 14:89727730-89727752 CCAAGTGAACACACAACAAAAGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121732684 14:96197527-96197549 ACAAGTGATCAGAGGACAGGAGG + Intergenic
1123004037 14:105312969-105312991 CCAAGTGACAAAAGAGGAGATGG - Exonic
1123724554 15:23089074-23089096 CCAAGTGAGCAGTGAAAATAGGG + Intergenic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1126142727 15:45450984-45451006 CCAAGAGCCCAGAGAAGAGCTGG + Intergenic
1128621081 15:69150473-69150495 TCCAGTGACCAGAGATGAGATGG - Intergenic
1128650040 15:69404377-69404399 CCTAGTGAAGGGAGAACAGAAGG + Exonic
1128695526 15:69759227-69759249 TCAAGGAACCAGAGAACAGGGGG + Intergenic
1129698004 15:77751614-77751636 CCAAGTGATCAGAGGAGGGAGGG - Intronic
1130871889 15:87978288-87978310 CATATTGACCAGAGAACAGGAGG + Intronic
1133660285 16:7909803-7909825 CAAAGTGATGAGAGAGCAGAGGG + Intergenic
1134632706 16:15768396-15768418 CCAAGTGACCAGGGGACACCAGG - Intronic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1135563949 16:23497532-23497554 CTAAGTGAAGAGAGAACACAAGG + Intronic
1135574098 16:23571819-23571841 TCACGTGTACAGAGAACAGAAGG - Exonic
1135899211 16:26441308-26441330 CCCAGTGCCCAGAGCACAGCAGG + Intergenic
1136092235 16:27928785-27928807 CCAAGAGACCAGACACCAGCCGG + Intronic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1138608941 16:58107697-58107719 CCAAGTGATGAGAGAACCCATGG + Intergenic
1139631183 16:68232807-68232829 ACAATTGACCTGAGAAAAGATGG + Exonic
1140809587 16:78564648-78564670 CCGAGTGGCCAGATAAAAGAAGG - Intronic
1141461850 16:84182440-84182462 CCTGGGGACCAGAGAACAGCAGG + Exonic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1143578372 17:7808594-7808616 GCTGGTGACTAGAGAACAGAAGG - Intronic
1144270223 17:13608074-13608096 CCAAGAGACCAGAGAGGACATGG + Intergenic
1144309502 17:13999578-13999600 GCAAATCACCAGAGAAGAGAAGG + Intergenic
1144587218 17:16494378-16494400 CCAGGTGACCAGAGATCACCTGG + Intergenic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151221433 17:72615761-72615783 CGAAGTGCCCATTGAACAGATGG + Intergenic
1151962288 17:77412384-77412406 CCAAATGAAAAGAGAACACAGGG - Intronic
1152723274 17:81933160-81933182 CCTAGTGACAAGAGAAGAGAAGG + Exonic
1154103866 18:11502724-11502746 CCAAGTGATCTGACAATAGAAGG + Intergenic
1155600743 18:27543917-27543939 CCCAGTTCCCAGAGAAGAGAGGG + Intergenic
1158165173 18:54532052-54532074 CCAAGGGACCACTGAACAAAGGG + Intergenic
1158509688 18:58079598-58079620 CCAAGTGATCGGAGCCCAGAGGG - Intronic
1158580458 18:58676461-58676483 ACATGTGACCAGAGTAGAGAGGG - Intronic
1158872265 18:61699474-61699496 GCAAGAGAGCAGAGAACAGATGG + Intergenic
1159314696 18:66757076-66757098 ACAAGGGATCAAAGAACAGAAGG - Intergenic
1161251468 19:3282582-3282604 CACAGTGCCCAGGGAACAGAAGG + Intronic
1162214837 19:9125556-9125578 ACATGAGACCAGAGATCAGATGG - Intergenic
1162540196 19:11291000-11291022 CCAGCTGCCCAGACAACAGAGGG + Intergenic
1164484800 19:28645778-28645800 CCAAGAGAACTGAGAACATATGG + Intergenic
1164802242 19:31087305-31087327 CCAGGTGAGCAGGGAAGAGAGGG - Intergenic
1164941198 19:32253251-32253273 CCTGGTGACCAGGGAAGAGAAGG - Intergenic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1165484306 19:36086216-36086238 GCAAGTGACCAGAGTAGGGAAGG + Intronic
1166519572 19:43471377-43471399 GCCCATGACCAGAGAACAGAAGG + Intergenic
1167782341 19:51607071-51607093 CCAAGTGAACAGAGAAGAGGTGG - Intergenic
1168469743 19:56630434-56630456 ACAAGAGGACAGAGAACAGATGG + Intergenic
925392255 2:3503894-3503916 CCGAGTGAACAGAGAAGAGGGGG + Intronic
925912377 2:8582317-8582339 CCCAGAGCCCAGAGAACAGGCGG + Intergenic
926402020 2:12507021-12507043 CCAGGAGACCAGAGAACATGAGG + Intergenic
927204965 2:20602329-20602351 CCCAGTGACCAAAGCAAAGAGGG - Intronic
927291117 2:21405870-21405892 CCATGTAACCATGGAACAGAGGG + Intergenic
927320773 2:21743032-21743054 CAAATTTACCAGAGATCAGATGG + Intergenic
927887853 2:26729519-26729541 TGAAGTGACCAGAGAGCAAAAGG + Exonic
928270907 2:29853792-29853814 CCAAGTGAAGAGAGAAGAGGAGG - Intronic
929673409 2:43898547-43898569 CCAAGTGCCGACAGAACAGTGGG - Intronic
929898593 2:45982755-45982777 CTAAGGTATCAGAGAACAGAGGG - Intronic
930285790 2:49425730-49425752 GAAAGTGGCCAGAGAACACAGGG + Intergenic
930374244 2:50544493-50544515 TCAAGTAAGCAGAAAACAGATGG - Intronic
931112979 2:59133355-59133377 TGAAGTGACAAGGGAACAGAAGG - Intergenic
932981168 2:76669066-76669088 CCAAGTAACCATAAAACAGATGG - Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934075253 2:88422893-88422915 TAAAATGACCAGAGAACAAAGGG + Intergenic
936668454 2:114627231-114627253 CCAGCTGCCAAGAGAACAGATGG + Intronic
937206334 2:120239260-120239282 TCAAGTGAGCAGAGCACACAGGG + Intergenic
937986974 2:127642329-127642351 CAAAGTGCCCAGAGATCAGAAGG - Intronic
940347215 2:152640170-152640192 CCAAGTGTCCAGGCACCAGAAGG - Intronic
941712908 2:168733378-168733400 CCACATCACCTGAGAACAGATGG + Intronic
943812766 2:192210024-192210046 CCAAGTAACCAGAGAATGGGTGG + Intergenic
946852533 2:223920999-223921021 CAAACTGATCAGAGACCAGAGGG + Intronic
946895051 2:224315309-224315331 AAAAGTGAACAAAGAACAGATGG - Intergenic
947302027 2:228698322-228698344 CTAAGTTAGAAGAGAACAGAAGG - Intergenic
947553585 2:231066974-231066996 CCAATTGACCAGAGATTGGAAGG + Exonic
947847638 2:233258390-233258412 GAAAGATACCAGAGAACAGATGG + Intronic
948512528 2:238478483-238478505 CCAAGAGCTCAGAGAGCAGAAGG - Intergenic
1169015333 20:2288086-2288108 TAAAGTGACAAGAGAACTGAAGG - Intergenic
1173060416 20:39654992-39655014 CCAAGTCCCCAGACAACATATGG + Intergenic
1173287681 20:41687922-41687944 CCAAGACAACAGAGAACTGACGG + Intergenic
1173878050 20:46388780-46388802 CCAAGTGAGCAGTGAAAATAGGG - Intronic
1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG + Intronic
1174867694 20:54152847-54152869 GCAAGTGTGCAAAGAACAGAGGG + Intergenic
1175612442 20:60363028-60363050 TCAAGTGCCCAGAGGACACACGG + Intergenic
1175714279 20:61245359-61245381 CCAAGTGATCAGACACCACATGG - Intergenic
1176002781 20:62840430-62840452 CCAAGTGAAGAGTGAGCAGATGG + Intronic
1176013216 20:62911643-62911665 CCAACTGACCACAGAACAAAAGG + Intronic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1178526091 21:33330709-33330731 CCTAGTGAGCAGAGAAAAGTGGG + Intronic
1179606536 21:42519349-42519371 TCAAGAGAACAGAGAACAGATGG + Intronic
1180740630 22:18050939-18050961 CCACGTAAGCAGAGAAGAGATGG - Intergenic
1181339417 22:22166140-22166162 CCCAGTGAGCAGGGGACAGAGGG - Intergenic
1183218747 22:36498195-36498217 CCCAGTGACCAGAGATAAAATGG - Intronic
1183501857 22:38184956-38184978 CTAAGAGCCCAGAGCACAGAGGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184665570 22:45987205-45987227 CCAAGAGCCCAGGGAGCAGAAGG + Intergenic
949587280 3:5454294-5454316 CCAAGGGAGAAGAGAGCAGAGGG + Intergenic
950924142 3:16723348-16723370 CCATGTGTGCAGGGAACAGAGGG - Intergenic
951037378 3:17948763-17948785 GCAAGTTTCCTGAGAACAGAAGG - Intronic
951820148 3:26799378-26799400 ACAAGTGACTAGAAAACAGTAGG - Intergenic
953772622 3:45790619-45790641 CAAGGAGAGCAGAGAACAGATGG - Intronic
954762332 3:52884899-52884921 CCAAGAGAACAGAAAACACATGG - Intronic
956628901 3:71294925-71294947 CCAAGGGAGGAGAGCACAGACGG + Intronic
956630911 3:71315784-71315806 CAAAGAGGCCAGAGAACAGAAGG + Intronic
957140957 3:76356270-76356292 ACAAGTGAGCAAAAAACAGATGG + Intronic
957954726 3:87171212-87171234 ATAAGTGACCAAAAAACAGAAGG + Intergenic
960040484 3:113145335-113145357 ACAATTGATCATAGAACAGAAGG + Intergenic
961445461 3:126978955-126978977 CCCAGTGACCAGGGATCTGAGGG + Intergenic
962372664 3:134833777-134833799 GCAAGTAACCAGCCAACAGAAGG + Intronic
962456212 3:135567863-135567885 ACAAATGACCAAAGACCAGATGG - Intergenic
962888799 3:139652897-139652919 AAAAGTGACCAGAGAAAAGCAGG + Intronic
965296672 3:166955753-166955775 ACAAGTCACCAGGGAACTGAGGG + Intergenic
965525352 3:169710844-169710866 CTCAGTCACCAAAGAACAGATGG - Intergenic
966713663 3:182994223-182994245 CAGAGTGAACAGACAACAGAAGG - Intergenic
968916753 4:3500015-3500037 CCAAGTACCCACAGAGCAGAAGG - Intronic
968922031 4:3527279-3527301 GCAAGTGTCCAGGGCACAGAGGG - Intronic
969152945 4:5186006-5186028 CGCAGTGACCGAAGAACAGACGG - Intronic
970046851 4:11863839-11863861 TCCAGAGACCAGAAAACAGATGG + Intergenic
970621627 4:17827173-17827195 CCATGTGACTAGAGAATTGATGG + Intronic
972040448 4:34589163-34589185 TTAAGAGACTAGAGAACAGAAGG + Intergenic
972651186 4:41019312-41019334 CCACGTGATGAGAGAAGAGAAGG + Intronic
972805459 4:42525852-42525874 CTTAGTGACCTCAGAACAGATGG + Intronic
974353528 4:60781887-60781909 CTAAGTGGCAAGAGAAAAGATGG - Intergenic
977246293 4:94635732-94635754 CCAAGTGAGCAGAGACTAGGAGG + Intronic
977492411 4:97731884-97731906 CAAAGGGACCAGAGGACAAAGGG - Intronic
978852445 4:113354942-113354964 CGAAGTGCCCAAAGAAAAGATGG + Exonic
980743477 4:136982912-136982934 AAAAGTGACGAGAGGACAGAAGG + Intergenic
980945544 4:139316881-139316903 GGAAGTGACCAGAGCATAGATGG - Intronic
982278465 4:153660382-153660404 CCAAGTAACTAGAGAATAGCAGG - Intergenic
982614800 4:157627184-157627206 CCAAGAGAGCAGGGCACAGATGG - Intergenic
983697046 4:170545244-170545266 CCAAGAGGCCACAGTACAGAGGG - Intergenic
984120051 4:175730913-175730935 CCAAGAGACCAGAAAACTGATGG - Intronic
985354218 4:189099948-189099970 CAAAGTGCCCAGATTACAGATGG - Intergenic
985622233 5:961698-961720 CCATGTGACCAGAGCACAAGTGG - Intergenic
986488316 5:8263290-8263312 CCAAGTTATCACAAAACAGAGGG + Intergenic
987375394 5:17229538-17229560 CAAAGTGAGGAGGGAACAGAGGG - Intronic
988929835 5:36027189-36027211 CAGAGTGTCCAGAAAACAGATGG + Intergenic
992126696 5:73649800-73649822 CCAAGTAGCCAGAGAAAAGACGG + Intronic
994250954 5:97536526-97536548 CCAACTAACCAAAGAGCAGAAGG + Intergenic
997392490 5:133528430-133528452 GCATCTAACCAGAGAACAGAAGG - Intronic
999365898 5:151023201-151023223 CCACGTGCCCAGAGAAGGGAAGG + Intronic
1000444820 5:161306517-161306539 CCCAGTGAACACAGAACAAAAGG + Intronic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003288242 6:4753839-4753861 CCTAGTGGCCAGAGCAAAGAGGG - Intronic
1003703256 6:8494426-8494448 CCAAATGCCCAGATAAAAGAAGG - Intergenic
1005659053 6:27975431-27975453 CTAAATGACCAGAGAAAATAGGG + Intergenic
1005811542 6:29519776-29519798 CCATCAGACCAGGGAACAGAGGG - Intergenic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006287539 6:33108404-33108426 ACAAGTGACAAGACAACAGCAGG + Intergenic
1007329903 6:41098122-41098144 CCAGATGACCAGTCAACAGAGGG - Exonic
1007785085 6:44275300-44275322 CCAGGCAACCAGAGCACAGATGG + Intronic
1010455306 6:76047937-76047959 CCAAAAGACCAGAAAAGAGATGG + Intronic
1012206669 6:96469517-96469539 TCAAGAGAACAGAGACCAGATGG + Intergenic
1013674547 6:112443373-112443395 GAAAGTGACCAGAGCCCAGAGGG + Intergenic
1014792456 6:125689405-125689427 CCAAGTGACCATAGAATGGTAGG + Intergenic
1016225249 6:141727047-141727069 CCCAGTAACTAGAAAACAGAAGG - Intergenic
1018600645 6:165536126-165536148 CCAAGAGAACAGAACACAGATGG + Intronic
1018908703 6:168089663-168089685 CCCAGGGACCTGAGGACAGACGG - Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1021643223 7:22761156-22761178 CCAAAGGACCAGAGAAGGGATGG - Intergenic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1021976648 7:26017752-26017774 CCAAATGTACAGAGAAGAGACGG - Intergenic
1023683913 7:42715995-42716017 ACAAGTGAGCAGATAATAGAAGG + Intergenic
1026682891 7:72482419-72482441 AAAAGTGACCAAAGAACAGATGG - Intergenic
1027775909 7:82463866-82463888 CCAAGGAACAAAAGAACAGAGGG - Intergenic
1027974569 7:85134846-85134868 CCAAGTGTCCAAGGAACATATGG + Intronic
1028877614 7:95841513-95841535 CCAAGTGACCAGCGAATATTGGG + Intronic
1029263643 7:99322007-99322029 CTAAGTTACTTGAGAACAGAAGG + Intergenic
1029642774 7:101831647-101831669 CCCAGTGGCCTGGGAACAGACGG + Intronic
1029677579 7:102081011-102081033 CGAAGTGGCCAGAAACCAGAAGG - Intronic
1031879946 7:127186426-127186448 CCAAGTGGCAGGAGAGCAGAAGG + Intronic
1031948286 7:127864340-127864362 CCCAGTGACCAGTGTAGAGATGG - Intronic
1034135278 7:148762159-148762181 CCAAGTGAACAGGGAATACAGGG - Intronic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035596343 8:861032-861054 ATAAGTGGCCAGAGAACAGCGGG + Intergenic
1041043703 8:53871836-53871858 CCTAGAGACCAGGAAACAGAGGG - Intronic
1042416384 8:68525352-68525374 CCAAGAAATCAAAGAACAGAAGG + Intronic
1043177421 8:77039920-77039942 CCCAGTTGCCAGAGAAAAGAGGG - Intergenic
1043558149 8:81458127-81458149 TCAAGTGGGCAGAGGACAGAGGG + Intergenic
1043882405 8:85559849-85559871 GCATGTGAGCAGAGAACTGAGGG - Intergenic
1045226971 8:100257672-100257694 CAAGGTGACCAGAGAAGACATGG + Exonic
1045548838 8:103152302-103152324 CCATGTATTCAGAGAACAGAGGG - Intronic
1046045487 8:108959136-108959158 CCAAGTGTCCAGCGAGCAAATGG + Intergenic
1046789280 8:118304002-118304024 CCATGTGAACAGAGAATAGAGGG - Intronic
1047175287 8:122535039-122535061 CAAAGTGACTAGAGATCAGTGGG + Intergenic
1048744667 8:137600569-137600591 CTGAGTGTCAAGAGAACAGAAGG + Intergenic
1048911411 8:139138961-139138983 CAAAGTGGTAAGAGAACAGATGG - Intergenic
1049929559 9:443113-443135 CCAAGTTCCCAGGGTACAGAAGG + Intronic
1050261666 9:3847254-3847276 GGAAGTGCCCAGAGAAAAGAGGG + Intronic
1051833606 9:21309658-21309680 CCAAATGACCAGAGAAGAATCGG - Intergenic
1052788784 9:32854793-32854815 CCAAGTGTCCAGAACACAGTTGG - Intergenic
1052963386 9:34319595-34319617 CCAGGTGCCCAGTGAACAGCAGG - Intronic
1055786412 9:79873834-79873856 CCAAGTGACAAAAGTTCAGATGG - Intergenic
1055808833 9:80127480-80127502 CCAAGTGACAAAAGTTCAGATGG - Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1058295021 9:103295393-103295415 TCAAGAGACAAGAGAATAGAAGG - Intergenic
1059064030 9:111063725-111063747 GCAATTGACCAGACAAGAGATGG + Intergenic
1059826135 9:118030951-118030973 CCAAGTGATCAGATAACATATGG + Intergenic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061675405 9:132212795-132212817 ACAAGTGACCAGGGGACACACGG - Intronic
1186001161 X:5012502-5012524 CCAATGGAACAGAAAACAGAAGG + Intergenic
1191703076 X:64064143-64064165 CCAAATCATCTGAGAACAGAAGG + Intergenic
1192010153 X:67260652-67260674 CAAATTGACCAGAGAAGAGCTGG + Intergenic
1194121702 X:89971267-89971289 CTAAGATATCAGAGAACAGATGG - Intergenic
1194993769 X:100571774-100571796 CCAGTTTACCAGAGAAGAGAAGG - Intergenic
1195196667 X:102503682-102503704 CCAAGGGAGCAGTGAACAAAAGG - Intergenic
1195233099 X:102871038-102871060 CCATGTGACTAGAGAGCATATGG + Intergenic
1196899400 X:120368168-120368190 TCAAGTGCCCAGAGAAGATATGG + Intronic
1199231424 X:145440570-145440592 ACAAGAGTCCAGACAACAGATGG - Intergenic
1199419352 X:147626138-147626160 CCAACTGACAAAACAACAGAAGG + Intergenic
1200474558 Y:3628718-3628740 CTAAGATATCAGAGAACAGATGG - Intergenic
1201246041 Y:12004732-12004754 GCAAGTGACCACAGAACCTATGG + Intergenic
1202302686 Y:23434384-23434406 CCAAGAGTCCAGAGAAAAGACGG + Intergenic
1202568125 Y:26236210-26236232 CCAAGAGTCCAGAGAAAAGACGG - Intergenic