ID: 906499874

View in Genome Browser
Species Human (GRCh38)
Location 1:46333820-46333842
Sequence AAGCAGGCTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906499874_906499878 13 Left 906499874 1:46333820-46333842 CCTCAATTTGCATTAGCCTGCTT No data
Right 906499878 1:46333856-46333878 TAATTAAAAGTGGGTGTAAGTGG No data
906499874_906499876 3 Left 906499874 1:46333820-46333842 CCTCAATTTGCATTAGCCTGCTT No data
Right 906499876 1:46333846-46333868 AATTTGCATCTAATTAAAAGTGG 0: 5
1: 125
2: 218
3: 249
4: 525
906499874_906499877 4 Left 906499874 1:46333820-46333842 CCTCAATTTGCATTAGCCTGCTT No data
Right 906499877 1:46333847-46333869 ATTTGCATCTAATTAAAAGTGGG 0: 2
1: 129
2: 218
3: 286
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906499874 Original CRISPR AAGCAGGCTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr