ID: 906500787

View in Genome Browser
Species Human (GRCh38)
Location 1:46340741-46340763
Sequence AGGTGGTGAGCGCCACCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906500787_906500795 6 Left 906500787 1:46340741-46340763 CCGCCGGGTGGCGCTCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 906500795 1:46340770-46340792 AACACGCGAGTCTCCTGTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
906500787_906500799 29 Left 906500787 1:46340741-46340763 CCGCCGGGTGGCGCTCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 906500799 1:46340793-46340815 TTCCGGTCGGAATTACCCCGTGG 0: 1
1: 0
2: 0
3: 0
4: 9
906500787_906500797 16 Left 906500787 1:46340741-46340763 CCGCCGGGTGGCGCTCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 906500797 1:46340780-46340802 TCTCCTGTCGCGGTTCCGGTCGG 0: 1
1: 0
2: 1
3: 3
4: 20
906500787_906500796 12 Left 906500787 1:46340741-46340763 CCGCCGGGTGGCGCTCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 96
Right 906500796 1:46340776-46340798 CGAGTCTCCTGTCGCGGTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906500787 Original CRISPR AGGTGGTGAGCGCCACCCGG CGG (reversed) Exonic
902270985 1:15304899-15304921 AGACTGTGAGCGCCACCTGGTGG + Intronic
903478683 1:23637839-23637861 AGGTGGAGAGCACCTCACGGAGG - Intronic
903480380 1:23648913-23648935 TGGTGGTGTGCGCTACTCGGAGG - Intergenic
904400468 1:30253529-30253551 AGGTGGTCAGAGCCACCAGGTGG + Intergenic
904567557 1:31436802-31436824 AGGTGGTGACCTCCACACTGGGG - Intergenic
904618098 1:31760731-31760753 AGGCGGTGACCCCCACTCGGTGG + Intronic
905744713 1:40405008-40405030 AGGCGGAGAGCACCACCTGGTGG + Intronic
905851453 1:41277921-41277943 AGGTGGTGGGGCCCCCCCGGAGG + Intergenic
906500787 1:46340741-46340763 AGGTGGTGAGCGCCACCCGGCGG - Exonic
916102719 1:161406642-161406664 AGGTGGCCACCGCCACCCGTGGG + Intergenic
921456712 1:215380307-215380329 AGGTGATGAATGCCACCAGGTGG - Intergenic
1067038526 10:42935942-42935964 AGGAGGTGTGCCCCACCCTGAGG + Intergenic
1067063507 10:43090230-43090252 AGGTGATGAGAGCCACCCCCAGG + Intronic
1067111502 10:43404503-43404525 AGGTGCTGTGCTCCAACCGGAGG - Intronic
1072616006 10:97049275-97049297 AGGTGGTGGGCTGCACCCTGGGG - Intronic
1076818173 10:132924788-132924810 ACGTGGTGTGCGCCACGCAGTGG - Exonic
1077418496 11:2437008-2437030 AGGTGGGGAGCTACACCCTGTGG - Intergenic
1081462290 11:43283109-43283131 AGGCGGTGAGCGCCATCTAGTGG + Intergenic
1084510163 11:69598334-69598356 TGGTGCTGACAGCCACCCGGTGG + Intergenic
1090605992 11:128423291-128423313 AGATGGTGAGCTCCATCCGTGGG + Intergenic
1090794722 11:130124941-130124963 AGGTGGTGATCTCTACCCGAAGG + Intronic
1091001198 11:131911627-131911649 AGGGGGAGAGCGCCACCCTCAGG + Exonic
1091108249 11:132942925-132942947 AGGGGGAGAGCGCCACCCTCAGG - Exonic
1091448439 12:558164-558186 AGGTGGTGAGCCCCTCAGGGAGG + Intronic
1092003089 12:5047162-5047184 AGCTGCTGAGAGCCACCCTGAGG - Intergenic
1096771498 12:53938697-53938719 AGGTGGAGAGCGGGAGCCGGCGG + Intergenic
1103593342 12:122007715-122007737 GGGTGGTGAGCTACACCCTGTGG - Intergenic
1103901227 12:124304480-124304502 AGGTGGGGAGCGGGACCGGGCGG + Intronic
1103940629 12:124499549-124499571 GGGAGGTGAGCGCCAGCTGGTGG + Intronic
1104017498 12:124970830-124970852 AGTTGGTGGGTGCCACCCTGGGG - Intronic
1105890932 13:24681489-24681511 AGGTGCTGAGCGCCCCTCTGCGG - Intronic
1107359100 13:39600907-39600929 GGGCAGTGAGCGCCACCAGGAGG + Exonic
1109152091 13:58858981-58859003 AGGTCCTGAGCCCCACCCCGCGG + Intergenic
1113572160 13:111365825-111365847 ATGTGCTGAGCTACACCCGGAGG + Intergenic
1118306343 14:64658357-64658379 AGGTCCTGAGCGCCGCCCCGCGG - Intergenic
1119516131 14:75250044-75250066 AGGAGGTGAGAGTCTCCCGGAGG + Intronic
1119612754 14:76077584-76077606 AGGTAGTGAGGGCTACCCTGTGG + Intronic
1123164084 14:106309099-106309121 TGGTGCTGAGCGCCACCTGGTGG + Intergenic
1125125422 15:36214529-36214551 ATGTTGTGAGAGGCACCCGGTGG - Intergenic
1125797300 15:42412102-42412124 AGGTGCTGAGTGCCACCGGCAGG - Exonic
1127221799 15:56887612-56887634 AGGTGGGGAGCGCCGCCGGGAGG + Intronic
1132576335 16:666084-666106 CAGTGGTCAGCGCCACCGGGTGG - Exonic
1133275816 16:4637853-4637875 AGGGGGTGGGGGCCACCCTGAGG + Intronic
1136221279 16:28830718-28830740 AGATGGTGAGGGCCACGAGGTGG - Exonic
1136399598 16:30010358-30010380 GGGTGGTGTGTGCCAGCCGGTGG + Intronic
1136534934 16:30893835-30893857 AGATGGTGAGCGCTGCTCGGGGG - Exonic
1139673074 16:68504955-68504977 AGGTGGGGAGAGCCACCCCACGG - Intergenic
1142717633 17:1755643-1755665 AGCTGGTGCCCGCCAGCCGGGGG + Intergenic
1142764171 17:2056451-2056473 AGGAGGTGAGCGGCCGCCGGTGG - Intronic
1143258632 17:5582599-5582621 AGCTGGTGGGCCCCACCCAGAGG - Intronic
1144889927 17:18488803-18488825 AGGGGGTTAGGGCCACACGGAGG - Intronic
1145142289 17:20455514-20455536 AGGGGGTTAGGGCCACACGGAGG + Intronic
1148156591 17:45428204-45428226 GGGTGGGGAACGGCACCCGGCGG - Intronic
1148750028 17:49940340-49940362 AGGTGGTGAGTGGCAGCCAGGGG + Intergenic
1149303226 17:55324621-55324643 AGAAGGTGATCGCCACCTGGAGG - Exonic
1155636207 18:27958738-27958760 AGGTTGTGAGAGGGACCCGGTGG + Intronic
1160670370 19:359705-359727 AGGTGGTGTGTGCAACCAGGAGG - Intergenic
1160964692 19:1741938-1741960 AGGTCGTGAGAGCCACCCCAAGG + Intergenic
1161069539 19:2253278-2253300 AGCTCGTGAGCGCCCCCCGGGGG - Intronic
1166759928 19:45218041-45218063 AGGTGGGGAGCGGCTCCCTGTGG - Intronic
1166905971 19:46108636-46108658 AGGTGGTGCTTGCCACCCAGGGG + Intergenic
1167035086 19:46990424-46990446 AGGTAGTGAGGGCCACATGGTGG - Intronic
1167506442 19:49873381-49873403 GGGTGGTGAGTGCCATCCAGGGG - Intronic
925095265 2:1193345-1193367 AGGTGGTGAGCGGCTGCCTGCGG - Intronic
932701583 2:73995973-73995995 AGGTGGTGTGCGCCACCCAGAGG + Intronic
934038000 2:88104646-88104668 AGGTGGTGGGGGCCACCCCGAGG - Intronic
936072518 2:109380775-109380797 AGGTGGTGGGGGGCACCTGGTGG - Intronic
942565622 2:177263640-177263662 GCGCGGTGAGCGCCACCAGGGGG + Intronic
1171847576 20:30286366-30286388 AGGTGGTGGGCTCCCCCAGGCGG - Intergenic
1171868962 20:30511339-30511361 GGCTGGTGAGGGCCACCCGCGGG + Intergenic
1172658083 20:36549096-36549118 TGGTGGTGAGCAGCTCCCGGAGG - Exonic
1175860773 20:62148984-62149006 AGGTGGTGCTCGCTAGCCGGCGG + Intronic
1178277411 21:31251773-31251795 AGGTGGAGTCAGCCACCCGGAGG - Exonic
1179908650 21:44436692-44436714 GGGTGCTGAGTGCCTCCCGGGGG - Intronic
1181487567 22:23241289-23241311 GGGTGGTGACCGCCAGCAGGGGG + Intronic
1182963714 22:34502191-34502213 GCGTGGTGAGAGCCACCTGGAGG - Intergenic
1185282849 22:49983122-49983144 AGGTGGTGAGGGTCACCCTGCGG + Intergenic
1185282859 22:49983151-49983173 AGGTGGTGAGGGTCACCCTGAGG + Intergenic
951093034 3:18597720-18597742 AGCTGGTGAAAGCCACCAGGAGG - Intergenic
961666866 3:128498001-128498023 AGGCGCAGAGCGCCACCTGGCGG + Intergenic
968621063 4:1603668-1603690 AGGTGGTGGGGGCTACCTGGTGG - Intergenic
984844362 4:184097447-184097469 AGGAGGAAAGCGCCCCCCGGTGG - Intronic
997835047 5:137185355-137185377 AGGTGGTGAGGGGCAGCTGGTGG - Intronic
998166020 5:139844569-139844591 AAGTGGTTTGCGCCACCTGGTGG + Intergenic
1002334010 5:178465710-178465732 AGGACGTGACCGCCACCCCGCGG - Intronic
1005742994 6:28810178-28810200 AGGAGCTGAGCGCCAGCTGGCGG + Intergenic
1006679492 6:35787119-35787141 AGGTGGGTATCGCCGCCCGGGGG + Exonic
1006944899 6:37778593-37778615 AGGTGGTGAGGGAGACCCAGAGG - Intergenic
1007669411 6:43539245-43539267 AGGTGGCCACCGCCACCCGTGGG - Intronic
1011734124 6:90295893-90295915 CGGTGGTCCGGGCCACCCGGCGG + Intronic
1014317025 6:119880650-119880672 AGGAGGTGAGAGCCATTCGGAGG + Intergenic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1019566412 7:1681737-1681759 AGGTGGTGAGAGACACGCAGGGG - Intergenic
1020145669 7:5640463-5640485 AGGTGGAGAGAGCCACAGGGAGG - Intronic
1023520476 7:41045707-41045729 AGGTGGTCAGTGCCACCTGCAGG - Intergenic
1033231330 7:139600392-139600414 AGGTGGTGAGAGCCACCCTAGGG - Intronic
1034405258 7:150898652-150898674 AGGTGTTGTGCGCCACCTGGTGG - Intergenic
1036757683 8:11482114-11482136 AGGTGGTGAGGGGCTACCGGAGG + Intergenic
1039738284 8:40355992-40356014 GGGTGGTGAGTGCCTCCCAGGGG + Intergenic
1042209905 8:66369667-66369689 AGCTGCTGAGTGCCAGCCGGTGG + Intergenic
1045325457 8:101114471-101114493 AGGTGGTGAGGGCAACTGGGAGG + Intergenic
1047332512 8:123904615-123904637 AGGTGGTGAGCTCCAGCCACTGG + Intronic
1051067591 9:13123135-13123157 TGCTGGTGAGCACCACCCAGAGG - Exonic
1053011367 9:34635655-34635677 AGGTGGTGAGCTCAAGCCGGAGG + Exonic
1057077745 9:92147792-92147814 AGGTGGGGTTGGCCACCCGGTGG - Intergenic
1059448934 9:114357920-114357942 AGGCGGTGGGCCCCACCTGGAGG - Exonic
1190365965 X:49695426-49695448 GGCTGGTGAGCGCCCCCCAGCGG - Intronic
1190629355 X:52369495-52369517 AGCTGGTGACCGCGACCCCGAGG + Intronic