ID: 906503213

View in Genome Browser
Species Human (GRCh38)
Location 1:46357420-46357442
Sequence GAGAGGCCAAGGCGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6654
Summary {0: 2, 1: 27, 2: 254, 3: 2616, 4: 3755}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906503213 Original CRISPR GAGAGGCCAAGGCGGGCGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr