ID: 906508918

View in Genome Browser
Species Human (GRCh38)
Location 1:46400234-46400256
Sequence AGTCTGAGAGGACCACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906508916_906508918 1 Left 906508916 1:46400210-46400232 CCTGGGTGGGGAGAGGTGCACAT 0: 1
1: 1
2: 0
3: 26
4: 240
Right 906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG 0: 1
1: 0
2: 0
3: 22
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906508918 Original CRISPR AGTCTGAGAGGACCACAGCT TGG Intronic
900429803 1:2596221-2596243 CACCTGAGAGGCCCACAGCTGGG - Intronic
901691573 1:10976803-10976825 AGCCTGAGAGGACCTCTGATGGG + Intronic
902774260 1:18664551-18664573 GGGCTGTGAGGATCACAGCTTGG - Intronic
905401922 1:37709948-37709970 TGTCTGGGAGGACAACACCTAGG + Intergenic
905442190 1:38002750-38002772 AGGCTGAGCGGACACCAGCTTGG - Intronic
906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG + Intronic
906664423 1:47609173-47609195 CGTCTGAGAGCACCTCAGCCTGG + Intergenic
906773254 1:48504275-48504297 AGTCTGATAGTACCACATGTTGG - Intergenic
906791153 1:48659706-48659728 AGTCTGGGAGGCCCACACCTGGG + Intronic
908041782 1:60121521-60121543 GGTATGACAGGATCACAGCTTGG - Intergenic
911084142 1:93962605-93962627 TGGCTGAGAGAACCACAGGTAGG + Intergenic
911090728 1:94015022-94015044 CATCTGAGATGACCTCAGCTGGG - Intronic
912055790 1:105596746-105596768 TGTCTGAGACCACCTCAGCTTGG - Intergenic
915627452 1:157124073-157124095 AGTCTGAGAAGCTCACAGCAGGG + Exonic
916712651 1:167425476-167425498 AGTTTGTGAGGGCCAAAGCTAGG - Exonic
921002415 1:211056810-211056832 AGTCTGCAAGAGCCACAGCTTGG + Intronic
921127565 1:212190960-212190982 AGTCAGAGAGTACCTCAGCAGGG + Intergenic
922255247 1:223888018-223888040 TGTCTGAGAGGAACTGAGCTAGG + Intergenic
923356464 1:233160802-233160824 TGTCTGGAAGGACCACAGCCAGG + Intronic
923536670 1:234857893-234857915 GGTTGGAGAGGACCAGAGCTTGG + Intergenic
1064540882 10:16403890-16403912 AGCCTGAGGGAACCACAGCCTGG - Intergenic
1067556526 10:47277045-47277067 AGTCTGAGAGGAACACAGTCAGG - Intergenic
1067712276 10:48658721-48658743 TGTCTGTGAGGACCAGAGTTGGG + Intergenic
1067834916 10:49632570-49632592 AGGCTGAGAGGAGCTCAGCTTGG - Intronic
1068867546 10:61910557-61910579 AGTCAGTGAGGAACACAGCGTGG - Intronic
1070609632 10:77924712-77924734 ACTCTGACATGACCACAACTGGG + Intronic
1071479135 10:86050060-86050082 AGTCTGGTAGGAACACACCTGGG - Intronic
1071566203 10:86672661-86672683 AGGCTCAGAGGCTCACAGCTGGG + Intronic
1073077091 10:100830918-100830940 AGTGTGGGAGGACCAGAGCTGGG - Intergenic
1077738127 11:4813430-4813452 AGTTTGAGAGCAGCCCAGCTGGG - Intronic
1077869650 11:6251041-6251063 AGGCTGAGAGCCCCCCAGCTAGG - Intergenic
1080969122 11:37248718-37248740 AGTCTGCCATTACCACAGCTAGG + Intergenic
1081814751 11:45932322-45932344 AATCTGAGAAGACCACGGGTAGG + Intronic
1083770241 11:64863196-64863218 AGTCTGAGAGTCGCACAGCTTGG + Intronic
1083978072 11:66140441-66140463 AGTCTGGGAGGTCCACGGTTGGG - Intronic
1084470287 11:69355517-69355539 AGTCTGAGAGTCCCAGAGCCTGG - Intronic
1086828783 11:91533924-91533946 TATCTGAGAGTACCTCAGCTTGG - Intergenic
1088379186 11:109174343-109174365 AGTCTGAAAGGATCAAAGCTGGG - Intergenic
1089168763 11:116498297-116498319 AGGCTGAGAGGAGCCCAGCGTGG + Intergenic
1089453094 11:118610435-118610457 CGGCCGAGAGGACCCCAGCTCGG + Intronic
1091122833 11:133070841-133070863 ACTCTGTCAGGACCACACCTGGG + Intronic
1091236584 11:134026228-134026250 AGTCCTAGAGGTCCACAGCAAGG + Intergenic
1092901411 12:13062900-13062922 AGTCTGGCAGTACCACAACTGGG - Exonic
1093213173 12:16331674-16331696 AGTGTGAGATGACCTCAGGTAGG - Intergenic
1096120698 12:49087877-49087899 AGTAGGAAAGGTCCACAGCTTGG + Intergenic
1096752717 12:53772281-53772303 TGTCTGAGATGATCAGAGCTAGG - Intergenic
1102096002 12:110241945-110241967 ACTCTGTGAAGACCACAGCAAGG - Intergenic
1102573674 12:113842935-113842957 AGTCTGGGAAGACCACAGTGTGG + Intronic
1103989688 12:124790533-124790555 AGTCTGAAAGGAACACAACAAGG - Intronic
1105507272 13:21021036-21021058 AGTCTGAGAGGAAGAGAGGTGGG + Intronic
1107555219 13:41512112-41512134 AGTCTTACAGGATCCCAGCTGGG + Intergenic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1109407405 13:61919499-61919521 CGTTTGAGAGGACCTCAGCCTGG + Intergenic
1109500559 13:63231834-63231856 AGTCTGATAGGCCCTCTGCTTGG + Intergenic
1112552400 13:100434018-100434040 AGGCTGAGAGGAACCCAGCAAGG + Intronic
1112635846 13:101217563-101217585 AGTCAGAAAGGAAGACAGCTAGG - Intronic
1116456167 14:45123257-45123279 GGTCTCAGAGGACCCTAGCTAGG - Intronic
1119040311 14:71268799-71268821 AGTCTGAGACTACCTCAGCCTGG - Intergenic
1119387014 14:74263844-74263866 GGTCTGCGAGGACCACATCTGGG - Intergenic
1120654238 14:87169903-87169925 CATCTGAGACGACCTCAGCTTGG + Intergenic
1202904287 14_GL000194v1_random:59599-59621 AGCCTGAGAGGACCCTGGCTGGG - Intergenic
1124901485 15:33827179-33827201 AGTCTGAGAGCACCAGTGCTGGG - Exonic
1125579162 15:40773655-40773677 AGCCTGAGAGGAGCCCAGGTAGG + Intronic
1125720403 15:41842486-41842508 AGGGTAAGAGGACCAGAGCTGGG + Intronic
1129077509 15:73009662-73009684 AGTGCTAGGGGACCACAGCTGGG - Intergenic
1129459998 15:75695798-75695820 AGTCTCAGAGGACAGCAGCAAGG + Intronic
1130271946 15:82456320-82456342 AGTCTCAGAGGACAGCAGCAAGG - Intergenic
1130464296 15:84183707-84183729 AGTCTCAGAGGACAGCAGCAAGG - Intergenic
1130488390 15:84411112-84411134 AGTCTCAGAGGACAGCAGCAAGG + Intergenic
1130499970 15:84489828-84489850 AGTCTCAGAGGACAGCAGCAAGG + Intergenic
1130534206 15:84771454-84771476 AGTGTGAGAGAACCACCACTGGG + Intronic
1130586591 15:85188342-85188364 AGTCTCAGAGGACAGCAGCAAGG - Intergenic
1130632123 15:85580134-85580156 AGTCCGAAAGCACCACAGCAAGG + Exonic
1130890152 15:88126909-88126931 AGTCTGTTAGGAGCCCAGCTGGG - Intronic
1132980579 16:2736907-2736929 GGTCTGAGATGACCCAAGCTGGG + Intergenic
1134914362 16:18057517-18057539 TGTCTGTGAGGACCAGATCTTGG - Intergenic
1135468657 16:22709531-22709553 AGTCTGAGAGGGCCAGAACTGGG - Intergenic
1136158487 16:28402011-28402033 AGTATGAGAGGCCAACAGCAAGG + Intronic
1136204600 16:28713272-28713294 AGTATGAGAGGCCAACAGCAAGG - Intronic
1136478962 16:30529726-30529748 AGTTTGAGAGAACCACGGCTGGG - Intronic
1136543393 16:30941786-30941808 ATGCTGGGAGGCCCACAGCTGGG + Intronic
1138502738 16:57458127-57458149 GGTCTCAGAGAACCAGAGCTTGG + Intronic
1139361108 16:66400835-66400857 TGTCTGAGATGACCACGGGTAGG - Exonic
1141134267 16:81455621-81455643 AGGCTGTGTGCACCACAGCTGGG - Intronic
1141613730 16:85198420-85198442 GGTCTGTGTTGACCACAGCTAGG - Intergenic
1141773303 16:86104693-86104715 AGTCAGACAGGACCACATATAGG - Intergenic
1144891309 17:18495890-18495912 AGCCTGTGAGGGCCACAGCAGGG + Intergenic
1145140914 17:20448427-20448449 AGCCTGTGAGGGCCACAGCAGGG - Intergenic
1145794905 17:27649853-27649875 AGCCTGTGAGGGCCACAGCAGGG + Intergenic
1145809399 17:27755571-27755593 AGCCTGTGAGGGCCACAGCAGGG + Intergenic
1146175541 17:30663912-30663934 AGTCAGCTGGGACCACAGCTTGG + Intergenic
1147526382 17:41227832-41227854 AGAAAGAGAGGACCTCAGCTTGG - Intronic
1147527413 17:41239184-41239206 AGAAAGAGAGGACCTCAGCTTGG - Intronic
1147528530 17:41250839-41250861 AGAAAGAGAGGACCTCAGCTTGG - Intronic
1147887089 17:43691349-43691371 AGGCAGAGAGGAGCCCAGCTGGG + Intergenic
1148133206 17:45274624-45274646 AGGGTGAGGGGACCAGAGCTGGG + Intronic
1149722900 17:58863806-58863828 AGTCAGAGAGGAGTTCAGCTGGG - Intronic
1150442401 17:65202157-65202179 AGGATGAGAGGACAACAGCCTGG + Intronic
1152008765 17:77697976-77697998 AGACTCAGAGGCCCACAGTTAGG + Intergenic
1152064653 17:78104082-78104104 TGGCTGTGAGGACCACTGCTGGG - Intronic
1154960889 18:21307674-21307696 TGTCTGTGAGGACCACAGTGAGG + Intronic
1155845101 18:30695674-30695696 AGACTGAGAGGTCCTCAGTTTGG + Intergenic
1155912577 18:31521536-31521558 AGTTTTATTGGACCACAGCTAGG - Intronic
1156585757 18:38429134-38429156 AGTCTGTGAGGTGCACAGCCGGG + Intergenic
1159204473 18:65232452-65232474 AATCTGAGACCACCTCAGCTTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162983421 19:14253998-14254020 AGTCAGCTGGGACCACAGCTTGG - Intergenic
1163570985 19:18082173-18082195 AGTATGAGGGTCCCACAGCTGGG - Exonic
1163795601 19:19336054-19336076 GGTTTGAAAGGGCCACAGCTTGG - Intronic
1164868121 19:31621879-31621901 AGTCTAAGATAACCTCAGCTGGG + Intergenic
1164906781 19:31974409-31974431 AATCTTTGAGGACCACAGCAGGG - Intergenic
1166252831 19:41583261-41583283 TGTCTGAGACCACCTCAGCTTGG + Intronic
1166303584 19:41925544-41925566 ACTCTGAGGGGACAAGAGCTTGG + Intronic
925747322 2:7054684-7054706 ACCATGAGAGGACCACAGCAAGG + Intronic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
928815428 2:35289663-35289685 AATCTGAGAGTGCCACAGCTAGG + Intergenic
930695295 2:54405736-54405758 AATCTTATAGGACCATAGCTGGG + Intergenic
931401058 2:61931954-61931976 AGTCTCAGAGGCACACAACTGGG - Intronic
932039523 2:68284510-68284532 AGTTTGAGAAAACCACAGTTGGG + Intronic
937071852 2:119069757-119069779 AGTCTGAGAGGGACAAAGGTAGG - Intergenic
939500259 2:142975276-142975298 AGTCAGAGAGGATTTCAGCTGGG + Intronic
940088257 2:149886207-149886229 AGTGTGAGTGGAACACAGCATGG - Intergenic
941770923 2:169344871-169344893 AGTTTGAGAGGAGCACACCAGGG - Intronic
942377886 2:175355781-175355803 AGTGTGAGAGGACCAGGCCTAGG + Intergenic
945028339 2:205640706-205640728 AGTCTTATAGAACAACAGCTGGG + Intergenic
947756835 2:232572264-232572286 ATTCTCATAGGCCCACAGCTCGG - Intronic
947911311 2:233802698-233802720 ACTCTGAGTGGACCACAGTGAGG - Intronic
948597130 2:239087362-239087384 AGTCTGCGAGCATCACTGCTCGG - Intronic
949021677 2:241744403-241744425 ACTCGGAGAGGCCCACAGCTCGG + Intronic
1170137854 20:13094849-13094871 AGTCTGAGGGGGCCATAGTTTGG - Intronic
1170652837 20:18258260-18258282 AGTTTGAGAGGGGCAGAGCTCGG + Intergenic
1171391204 20:24802748-24802770 GGTCTTAGAGGACCAGGGCTGGG - Intergenic
1172180019 20:32997184-32997206 AGTCTCAGAGGACCTCAGAAAGG - Intronic
1173441780 20:43083890-43083912 AGTCAGAAAAGACCACATCTTGG - Intronic
1173461011 20:43243397-43243419 TGTGTGAGAGGAGCAGAGCTTGG - Intergenic
1174132358 20:48354944-48354966 AGACTGGGAGGCTCACAGCTTGG - Intergenic
1174314606 20:49688472-49688494 TGTCTGAGCTGACCACAGCAAGG - Intronic
1174426590 20:50435916-50435938 AGGCTGAGAGGAGCAGAGCACGG + Intergenic
1178094275 21:29197402-29197424 ACGCTGAGAGGAGCTCAGCTGGG + Intronic
1178849518 21:36201295-36201317 AGTCAGTGAGCCCCACAGCTGGG + Intronic
1179436904 21:41368572-41368594 AGTTTGAGAGGACAGGAGCTGGG - Intronic
1181856860 22:25787972-25787994 AAGCTCAGAGGACCCCAGCTTGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184425048 22:44404295-44404317 AGGCTGCGAGGACCACTGTTTGG - Intergenic
1185112056 22:48905587-48905609 CGCCTGTGAGGACCACAGCCAGG + Intergenic
1185224044 22:49643097-49643119 AGCCTGAGTGGACGCCAGCTGGG + Intronic
951274445 3:20668563-20668585 AGTCTAGGAGGGCCTCAGCTGGG + Intergenic
953291014 3:41662781-41662803 TGTCTGAGAGGTCCACAGAAGGG - Intronic
953575130 3:44107200-44107222 TGTCTCAGAGGACCTCACCTGGG + Intergenic
954445774 3:50546088-50546110 AGTCTGGAAGGGCCAGAGCTGGG - Intergenic
955816116 3:62845211-62845233 AGTCTGAGAGAACAAGAACTTGG + Intronic
958614425 3:96473294-96473316 TTTCTGAGAGGAGCAGAGCTCGG + Intergenic
959910919 3:111762731-111762753 AGTCTGTGGGGATCAGAGCTGGG - Intronic
961939591 3:130623478-130623500 AGTCTGAGAGAATGAAAGCTAGG + Intronic
967093984 3:186161766-186161788 AGTCTTAGAGAACCACACTTAGG - Intronic
967099290 3:186202773-186202795 AGTCTCAGAAGACCAAAGTTGGG - Intronic
969663756 4:8545265-8545287 AGGCTCAGAGGACCTCAGCGAGG - Intergenic
971357397 4:25907434-25907456 GGTCTGCGAGGCCCACAGCATGG + Intronic
971835634 4:31759837-31759859 GGCCTGAGAGGTCCACAGCATGG - Intergenic
974214600 4:58828696-58828718 TGTCTGAGACGACCTCAGCCTGG + Intergenic
978443805 4:108762234-108762256 AGGCTGGGAAGAACACAGCTTGG + Intronic
981140355 4:141260243-141260265 AGTCTGTAAGAGCCACAGCTGGG + Intergenic
984514330 4:180719666-180719688 AGTCTGAGAGGTCCAAAGTAAGG + Intergenic
986241285 5:5961958-5961980 AGTCTGGGAGGGCCACGGCTGGG - Intergenic
986960324 5:13202857-13202879 AGTCAGGGAGGACCTCTGCTAGG - Intergenic
988711861 5:33787034-33787056 AGCCATAGAGGACCACATCTAGG - Intronic
989118189 5:37977157-37977179 AGTCTGAGAAGACCAAGGCACGG - Intergenic
990844647 5:60123066-60123088 CATCTGAGAGCACCTCAGCTTGG + Intronic
990939483 5:61187548-61187570 TGTCTGAGAGTACCTCAGCCTGG - Intergenic
993288194 5:86029536-86029558 AGTCTCCAAGGGCCACAGCTGGG - Intergenic
997511219 5:134455911-134455933 AGTGGGAGAGGACCAGAGCTGGG - Intergenic
997528198 5:134566876-134566898 AGGCTGAGAGCACCAGAGCTAGG + Intronic
998296527 5:140974995-140975017 AGGCTGAAATGAACACAGCTGGG + Intronic
998352352 5:141509721-141509743 AGGCTCAGAGTGCCACAGCTAGG - Intronic
998556157 5:143125586-143125608 AGACAGAGAGGAAAACAGCTAGG + Intronic
1001441465 5:171746858-171746880 AGTCTCAGATGAACTCAGCTTGG - Intergenic
1006441822 6:34058033-34058055 AGTCTGAGAGGACCGGGGCTGGG + Intronic
1006583673 6:35091520-35091542 TGGCTGAGATGACGACAGCTTGG + Intergenic
1008053309 6:46921907-46921929 AGACTGGGAGGATCATAGCTGGG - Exonic
1010248432 6:73683410-73683432 AGTCTGAGACCACCTCAGCCTGG + Intergenic
1011672665 6:89698103-89698125 AGTCTTAGATGACCACAGTGAGG - Intronic
1013327333 6:109060030-109060052 AGCCTGAAAGCACCAAAGCTAGG + Intronic
1016122465 6:140360678-140360700 AAACTGAGAGAACCACAGTTTGG - Intergenic
1018354555 6:162999297-162999319 ACTCAGTGAGGACCAGAGCTAGG - Intronic
1019300093 7:298485-298507 AGTCGAACAGAACCACAGCTAGG - Intergenic
1019958737 7:4438317-4438339 AGTGTCAGAGGAACACAGCCCGG + Intergenic
1020958708 7:14776035-14776057 CGTCTGAGACCACCTCAGCTTGG - Intronic
1021713380 7:23438740-23438762 AGTTTTAAAGGACCACAACTAGG - Intronic
1024117713 7:46209243-46209265 TTTCTGAGAGCACCACTGCTGGG + Intergenic
1024123739 7:46270832-46270854 TCTCCTAGAGGACCACAGCTGGG - Intergenic
1025122358 7:56315920-56315942 AATCTAAGATGACCTCAGCTGGG - Intergenic
1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG + Intronic
1029170706 7:98627485-98627507 GGTCTGAGGGGCCAACAGCTGGG - Intronic
1029480471 7:100809400-100809422 AGTTTAAGAGGATCCCAGCTGGG - Intronic
1030423842 7:109346090-109346112 AATCTGAAAAGACCACAGATAGG - Intergenic
1031298632 7:120037618-120037640 CATCTGAGACCACCACAGCTTGG + Intergenic
1032365298 7:131293213-131293235 AGTCTGGGATGATCTCAGCTGGG - Intronic
1033628920 7:143138613-143138635 AGTCAGAGAGGAGCACAGATGGG + Intronic
1036470206 8:9046132-9046154 TGGCTGAGAGGACCGCTGCTGGG + Intronic
1043183101 8:77109707-77109729 AGTCAGTGAGTAGCACAGCTAGG - Intergenic
1044371184 8:91412835-91412857 ATGCTGAAAGGACCACAGCATGG + Intergenic
1047233128 8:123014760-123014782 AGTCAGTGAGGGCCACAGATTGG - Exonic
1047803843 8:128338159-128338181 CTTCTAAGTGGACCACAGCTTGG + Intergenic
1048203285 8:132394747-132394769 AGTCAGACAGGACCCCAGATTGG + Intronic
1048732001 8:137452966-137452988 ATTCAGAGAGGGGCACAGCTAGG - Intergenic
1048769643 8:137882061-137882083 ACTCTGAGACCACCTCAGCTGGG - Intergenic
1057695553 9:97320535-97320557 AGCCTGGGAGGAGCAGAGCTGGG - Intronic
1058828775 9:108797205-108797227 CGTCTGACAAGACCAGAGCTAGG - Intergenic
1060902020 9:127267111-127267133 TGCCTTAGAGGACCTCAGCTAGG + Intronic
1062129659 9:134885620-134885642 AGTCTGTGAGGAGAACAGGTGGG + Intronic
1062404496 9:136388712-136388734 AGTCTGGGAGGAGGAGAGCTGGG - Intronic
1185629416 X:1505201-1505223 CGTCTCAGAGGACCTGAGCTGGG + Intronic
1188678721 X:32975598-32975620 CATCTGAGAGGACGACAGCTAGG + Intronic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1192131360 X:68554362-68554384 TATCTGACAGGACCAAAGCTAGG - Intergenic
1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG + Intergenic
1193937024 X:87635935-87635957 AGTCTTAGAGGATCTCAGCTGGG - Intronic
1196218084 X:113079028-113079050 CCTCTGATAGCACCACAGCTGGG - Intergenic
1197841346 X:130750556-130750578 AAACTGAGAGGATCACAGCAAGG - Intronic
1199346676 X:146748581-146748603 CATCTGAGATGACCACAGCCTGG + Intergenic
1199882487 X:151985673-151985695 AGTCAGAAAGGAACAGAGCTGGG + Intergenic
1201160167 Y:11159808-11159830 AGCCTGAGGGGACCCTAGCTGGG - Intergenic
1201364967 Y:13194381-13194403 AGACTGAAAGGACCAGAGGTGGG - Intergenic
1202370924 Y:24194931-24194953 AGTCTCAGAGGACAGCAGCAAGG + Intergenic
1202499860 Y:25475186-25475208 AGTCTCAGAGGACAGCAGCAAGG - Intergenic