ID: 906511268

View in Genome Browser
Species Human (GRCh38)
Location 1:46411630-46411652
Sequence GGAACTGCAGCACGAGATCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906511260_906511268 14 Left 906511260 1:46411593-46411615 CCACACTCCTTCTGCCCAGTTCG 0: 1
1: 0
2: 0
3: 13
4: 189
Right 906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
906511264_906511268 0 Left 906511264 1:46411607-46411629 CCCAGTTCGGCTGGAAAACTCTG 0: 1
1: 0
2: 1
3: 8
4: 73
Right 906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
906511259_906511268 30 Left 906511259 1:46411577-46411599 CCATCATGGCTGGTGACCACACT 0: 1
1: 0
2: 5
3: 7
4: 194
Right 906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
906511263_906511268 7 Left 906511263 1:46411600-46411622 CCTTCTGCCCAGTTCGGCTGGAA 0: 1
1: 0
2: 1
3: 6
4: 107
Right 906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG 0: 1
1: 0
2: 0
3: 2
4: 71
906511265_906511268 -1 Left 906511265 1:46411608-46411630 CCAGTTCGGCTGGAAAACTCTGG 0: 1
1: 0
2: 2
3: 5
4: 67
Right 906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906511268 Original CRISPR GGAACTGCAGCACGAGATCG AGG Exonic
900764795 1:4497499-4497521 TGAATTGCAGCACGAGAGCCAGG - Intergenic
905626274 1:39492117-39492139 GGACGTGCAGCGCGAGATCCTGG + Exonic
905670622 1:39788338-39788360 GGACGTGCAGCGCGAGATCCTGG - Exonic
906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG + Exonic
911355599 1:96815247-96815269 GAAACTGCAGCAAGAGAGCATGG - Intronic
923341003 1:233007038-233007060 GGAATTGCAGCAGGAGAGTGTGG - Intronic
1067924031 10:50489583-50489605 GGAACTGCAGAACAAGTTCGTGG - Intronic
1071820524 10:89275426-89275448 GGAACTGCAGCTCGTGGTTGTGG + Intronic
1079819076 11:25102290-25102312 GGAGCTGAAGTACGAGATGGGGG - Intergenic
1084172948 11:67409433-67409455 GGACCTGCAGCGGGAGATCAAGG + Exonic
1090436579 11:126692138-126692160 GGAACTGCTGCATCAGATGGTGG - Intronic
1105714181 13:23045672-23045694 GGAACTGGAGCAAGAGAGAGTGG + Intergenic
1111402983 13:87765425-87765447 GGATATGCAGAACTAGATCGTGG - Intergenic
1112808307 13:103187317-103187339 GGAACAGCAGCAAGAGAGAGCGG - Intergenic
1118764352 14:68899955-68899977 GGAACAGCAGCAGGAGATGTGGG + Intronic
1118812281 14:69284158-69284180 GGAACTGCAGCAGGTGTTTGGGG - Intronic
1124439279 15:29675037-29675059 AGAGCTGCAGCAGGAGGTCGGGG - Intergenic
1127852141 15:62923191-62923213 GGAACTGCTCCATGAGACCGAGG - Intergenic
1127930600 15:63594745-63594767 GGTACTGCAGCTCCAAATCGTGG - Intergenic
1132501063 16:284877-284899 GGACCTGCAGGACGAGGACGTGG + Exonic
1133316860 16:4890261-4890283 GGAACTGCAGCACGTGGTCATGG + Exonic
1134677249 16:16099337-16099359 GGAACTGCAGCAGGTGGTGGTGG + Intronic
1142848172 17:2692027-2692049 GGCCCTGCAGCACGAGAAGGAGG - Exonic
1146007604 17:29170512-29170534 GAAACTGCAGCCCGGGATAGGGG - Intronic
1147948487 17:44093685-44093707 GCAACTGCAGCAGGAGCTCCTGG - Exonic
1150224175 17:63513978-63514000 GGAACTGGAGCACCAGACTGAGG - Intronic
1151284345 17:73099170-73099192 GGAACTGCAGGACAAGAGGGTGG + Intergenic
1151584318 17:74999595-74999617 GGAACAGGTGCAGGAGATCGAGG + Exonic
1159948706 18:74463066-74463088 GGAGCTGCAGCCCAAGAACGTGG + Intergenic
1163084937 19:14972754-14972776 GGAAGCGCAGCACGTGCTCGAGG + Exonic
1166970358 19:46563081-46563103 TGAACAGCAGCAAGAGATCATGG - Intronic
1167019852 19:46865205-46865227 GGGACTGGAGCAGGAGATGGCGG + Intergenic
1167290071 19:48619632-48619654 CGAAGTGCAGCGCGAGATCAGGG - Intronic
926378942 2:12264719-12264741 GGAACAGGAGCAAGAGAGCGAGG + Intergenic
930052629 2:47228428-47228450 GGAACTGCAGTAGGGGATCTGGG + Intergenic
934502587 2:94871888-94871910 GGAGCTGCAGCGTGAGATGGAGG + Exonic
934771978 2:96912972-96912994 GGAGCTGCGGCAGGAGCTCGAGG + Intronic
935946340 2:108289827-108289849 GGAGATGCAGCAAGAGATTGAGG - Intronic
936961498 2:118079583-118079605 GGAACTGAAGCACGGAATGGAGG + Intergenic
948247292 2:236497225-236497247 GGAGCTGAAGAACGAGATGGTGG - Exonic
948567910 2:238898103-238898125 GGAACTGCAGCTGGCGAACGCGG + Intronic
1170609052 20:17896539-17896561 CCAACTGCAGCACGTGATCTGGG + Intergenic
1176410454 21:6447003-6447025 GGAACTGGATCATGAGATCACGG - Intergenic
1177160568 21:17543717-17543739 AGAACTACAGCAGGAGATAGAGG + Intronic
1179685947 21:43055325-43055347 GGAACTGGATCATGAGATCACGG - Intronic
1183184446 22:36284154-36284176 GAAACTGCAGCGCGAGCTGGAGG - Exonic
949564327 3:5230911-5230933 GGGACTGCTGCACTAGATCCAGG + Intergenic
949893675 3:8753114-8753136 GGAAGCGCTGCACGAGTTCGTGG + Exonic
950467595 3:13164280-13164302 GGAACAGCAGCAAGAGACCCCGG - Intergenic
951139741 3:19147039-19147061 GGAAGTGCATCACGAGAAAGGGG + Intergenic
960594654 3:119397263-119397285 GGAACTGCATCATGAGAAAGAGG + Intronic
961488252 3:127232550-127232572 GGAAATGCAGGATGAGATTGAGG - Intergenic
982045750 4:151443978-151444000 GGATCTGCAGCAGGAAATAGGGG - Intronic
989667606 5:43874423-43874445 GAAACTGCAGCCACAGATCGGGG + Intergenic
990266992 5:54087376-54087398 GGAGCTGCAGCCCAAGATCTCGG - Intronic
999272285 5:150303419-150303441 GGAACTGCAGAACGAGGAGGAGG - Intronic
1001484057 5:172107007-172107029 GGAACTGCAGCAGGACGTGGCGG - Intronic
1006405247 6:33841308-33841330 GGAACTGCAGCTCCAGCTGGCGG - Intergenic
1008317877 6:50069302-50069324 GGAACTACAGTTCGAGATCTGGG - Intergenic
1021111045 7:16694950-16694972 GGAACTGCAGAAGGAGCTCCAGG + Exonic
1024627167 7:51217906-51217928 CGAACTGCCGCAAGAGATAGTGG + Intronic
1036124623 8:6051715-6051737 GGAACTGCTGCTCAAGAGCGAGG - Intergenic
1039910467 8:41822845-41822867 GGAAGCACAGCACGAGAGCGGGG + Intronic
1041582009 8:59471727-59471749 GGAACTGGAGCACGACACAGTGG - Intergenic
1043784998 8:84387740-84387762 GGAACTGCAGAAGGAGATTCTGG - Intronic
1047979033 8:130160710-130160732 TGAACTGCAGAACGAGAACATGG + Intronic
1048698585 8:137057547-137057569 GGAACTGCAGCTCCAGCTCAAGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1055004405 9:71489033-71489055 GGCACTGCAGCAGGGGATGGGGG - Intergenic
1062516524 9:136939744-136939766 GGAACTGCACCGGGAGCTCGGGG - Intronic
1062589302 9:137266336-137266358 GGAGCAGCAGCAGGAGGTCGGGG - Exonic
1187169024 X:16832649-16832671 GGAACTGCAACAGCAGCTCGTGG + Exonic
1197188679 X:123620212-123620234 TCAACTGCAGCACAAAATCGTGG - Intronic
1197980857 X:132217492-132217514 GGAACTGCAGCCCGAGCAGGGGG + Exonic