ID: 906512931

View in Genome Browser
Species Human (GRCh38)
Location 1:46421613-46421635
Sequence GCTCTCTGAACAACAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906512926_906512931 16 Left 906512926 1:46421574-46421596 CCATTTCATATATAAGGAAACTG No data
Right 906512931 1:46421613-46421635 GCTCTCTGAACAACAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906512931 Original CRISPR GCTCTCTGAACAACAATGGA GGG Intergenic
No off target data available for this crispr