ID: 906513679 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:46425549-46425571 |
| Sequence | AAGAAGCCTGAAACCACAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906513679_906513688 | 29 | Left | 906513679 | 1:46425549-46425571 | CCCATTGTGGTTTCAGGCTTCTT | No data | ||
| Right | 906513688 | 1:46425601-46425623 | AAGCTATACAGGTCTGTCCTGGG | No data | ||||
| 906513679_906513683 | 18 | Left | 906513679 | 1:46425549-46425571 | CCCATTGTGGTTTCAGGCTTCTT | No data | ||
| Right | 906513683 | 1:46425590-46425612 | GTCTCCCCAACAAGCTATACAGG | No data | ||||
| 906513679_906513687 | 28 | Left | 906513679 | 1:46425549-46425571 | CCCATTGTGGTTTCAGGCTTCTT | No data | ||
| Right | 906513687 | 1:46425600-46425622 | CAAGCTATACAGGTCTGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906513679 | Original CRISPR | AAGAAGCCTGAAACCACAAT GGG (reversed) | Intergenic | ||