ID: 906513680

View in Genome Browser
Species Human (GRCh38)
Location 1:46425550-46425572
Sequence CAAGAAGCCTGAAACCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906513680_906513683 17 Left 906513680 1:46425550-46425572 CCATTGTGGTTTCAGGCTTCTTG No data
Right 906513683 1:46425590-46425612 GTCTCCCCAACAAGCTATACAGG No data
906513680_906513688 28 Left 906513680 1:46425550-46425572 CCATTGTGGTTTCAGGCTTCTTG No data
Right 906513688 1:46425601-46425623 AAGCTATACAGGTCTGTCCTGGG No data
906513680_906513687 27 Left 906513680 1:46425550-46425572 CCATTGTGGTTTCAGGCTTCTTG No data
Right 906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906513680 Original CRISPR CAAGAAGCCTGAAACCACAA TGG (reversed) Intergenic