ID: 906513687

View in Genome Browser
Species Human (GRCh38)
Location 1:46425600-46425622
Sequence CAAGCTATACAGGTCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906513679_906513687 28 Left 906513679 1:46425549-46425571 CCCATTGTGGTTTCAGGCTTCTT No data
Right 906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG No data
906513682_906513687 -6 Left 906513682 1:46425583-46425605 CCTTGCTGTCTCCCCAACAAGCT No data
Right 906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG No data
906513680_906513687 27 Left 906513680 1:46425550-46425572 CCATTGTGGTTTCAGGCTTCTTG No data
Right 906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906513687 Original CRISPR CAAGCTATACAGGTCTGTCC TGG Intergenic