ID: 906514810

View in Genome Browser
Species Human (GRCh38)
Location 1:46432619-46432641
Sequence CAGGCTCACCATGCTGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906514810_906514815 28 Left 906514810 1:46432619-46432641 CCTATGACAGCATGGTGAGCCTG No data
Right 906514815 1:46432670-46432692 GCACGCTTGTGCCACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906514810 Original CRISPR CAGGCTCACCATGCTGTCAT AGG (reversed) Intergenic
No off target data available for this crispr