ID: 906516312

View in Genome Browser
Species Human (GRCh38)
Location 1:46440810-46440832
Sequence GCCCAGCTGGACCTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906516301_906516312 16 Left 906516301 1:46440771-46440793 CCCTGAGTGGTCAGAGTTATGAA No data
Right 906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG No data
906516302_906516312 15 Left 906516302 1:46440772-46440794 CCTGAGTGGTCAGAGTTATGAAC No data
Right 906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG No data
906516300_906516312 27 Left 906516300 1:46440760-46440782 CCTGGGTAGTGCCCTGAGTGGTC No data
Right 906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906516312 Original CRISPR GCCCAGCTGGACCTGGGTGG GGG Intergenic
No off target data available for this crispr