ID: 906516936

View in Genome Browser
Species Human (GRCh38)
Location 1:46445116-46445138
Sequence TTCATCACCCATGCTATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906516936_906516943 7 Left 906516936 1:46445116-46445138 CCCAGAATAGCATGGGTGATGAA No data
Right 906516943 1:46445146-46445168 AGGCAAGGGGCCTGTGAAGCAGG No data
906516936_906516939 -8 Left 906516936 1:46445116-46445138 CCCAGAATAGCATGGGTGATGAA No data
Right 906516939 1:46445131-46445153 GTGATGAACAGAGCCAGGCAAGG No data
906516936_906516941 -6 Left 906516936 1:46445116-46445138 CCCAGAATAGCATGGGTGATGAA No data
Right 906516941 1:46445133-46445155 GATGAACAGAGCCAGGCAAGGGG No data
906516936_906516940 -7 Left 906516936 1:46445116-46445138 CCCAGAATAGCATGGGTGATGAA No data
Right 906516940 1:46445132-46445154 TGATGAACAGAGCCAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906516936 Original CRISPR TTCATCACCCATGCTATTCT GGG (reversed) Intergenic
No off target data available for this crispr