ID: 906517004

View in Genome Browser
Species Human (GRCh38)
Location 1:46445540-46445562
Sequence CATGGTATTCATGAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906517004_906517011 14 Left 906517004 1:46445540-46445562 CCTTCCTTCTCATGAATACCATG No data
Right 906517011 1:46445577-46445599 CCTCCTTCTGGAACCCCACCAGG No data
906517004_906517008 2 Left 906517004 1:46445540-46445562 CCTTCCTTCTCATGAATACCATG No data
Right 906517008 1:46445565-46445587 CACCTTATGTCTCCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906517004 Original CRISPR CATGGTATTCATGAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr