ID: 906521799

View in Genome Browser
Species Human (GRCh38)
Location 1:46471194-46471216
Sequence TCAGGTTCTAAGGATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906521791_906521799 25 Left 906521791 1:46471146-46471168 CCCAAGGTGCTGTGATTACAGGC 0: 30
1: 4061
2: 238267
3: 323803
4: 357204
Right 906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG No data
906521789_906521799 28 Left 906521789 1:46471143-46471165 CCTCCCAAGGTGCTGTGATTACA 0: 40
1: 5615
2: 317131
3: 326997
4: 301975
Right 906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG No data
906521792_906521799 24 Left 906521792 1:46471147-46471169 CCAAGGTGCTGTGATTACAGGCA 0: 10
1: 1987
2: 103386
3: 303654
4: 350885
Right 906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG No data
906521794_906521799 -3 Left 906521794 1:46471174-46471196 CCACTGAGCCTGGCCTATGCTCA No data
Right 906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906521799 Original CRISPR TCAGGTTCTAAGGATGCTGT AGG Intergenic
No off target data available for this crispr