ID: 906521990

View in Genome Browser
Species Human (GRCh38)
Location 1:46472798-46472820
Sequence TTGCCTGTCCTTTCCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906521988_906521990 27 Left 906521988 1:46472748-46472770 CCTTAAATTCTAGCTGGCACCTG No data
Right 906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG No data
906521989_906521990 8 Left 906521989 1:46472767-46472789 CCTGAATAGCTTTGTAGCAATTT No data
Right 906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906521990 Original CRISPR TTGCCTGTCCTTTCCAGATC TGG Intergenic
No off target data available for this crispr