ID: 906525333

View in Genome Browser
Species Human (GRCh38)
Location 1:46490262-46490284
Sequence AGGACGAAGGCCTTGGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906525327_906525333 2 Left 906525327 1:46490237-46490259 CCGTGGGTAGAAACGCGCCGAGG No data
Right 906525333 1:46490262-46490284 AGGACGAAGGCCTTGGCCCGCGG No data
906525324_906525333 28 Left 906525324 1:46490211-46490233 CCGAGGCAGAGAGAGCGGAGGGC No data
Right 906525333 1:46490262-46490284 AGGACGAAGGCCTTGGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906525333 Original CRISPR AGGACGAAGGCCTTGGCCCG CGG Intergenic
No off target data available for this crispr