ID: 906528163

View in Genome Browser
Species Human (GRCh38)
Location 1:46508490-46508512
Sequence GGTTCTCTGGACCAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906528159_906528163 3 Left 906528159 1:46508464-46508486 CCTCTGGGCAGAACTCAGTGGAT 0: 1
1: 0
2: 0
3: 21
4: 202
Right 906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 215
906528157_906528163 8 Left 906528157 1:46508459-46508481 CCAGGCCTCTGGGCAGAACTCAG 0: 1
1: 0
2: 4
3: 39
4: 356
Right 906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 215
906528152_906528163 21 Left 906528152 1:46508446-46508468 CCTTTAGACCCTGCCAGGCCTCT 0: 1
1: 0
2: 0
3: 20
4: 223
Right 906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 215
906528155_906528163 13 Left 906528155 1:46508454-46508476 CCCTGCCAGGCCTCTGGGCAGAA 0: 1
1: 0
2: 4
3: 37
4: 438
Right 906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 215
906528156_906528163 12 Left 906528156 1:46508455-46508477 CCTGCCAGGCCTCTGGGCAGAAC 0: 1
1: 0
2: 3
3: 40
4: 298
Right 906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906528163 Original CRISPR GGTTCTCTGGACCAGTGTGG AGG Intronic
901719755 1:11187306-11187328 TTTTCTATGGACCAGGGTGGGGG + Intronic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
904662316 1:32094555-32094577 TGTTCTCTGGCTCAGAGTGGTGG + Intronic
904708204 1:32407943-32407965 GAGTCTCTGGAGCAGTGTGCAGG + Intergenic
906386003 1:45369040-45369062 AGTTCTCTGGGCCAGCCTGGTGG - Intronic
906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG + Intronic
906611556 1:47207368-47207390 GGACCTCTGGGGCAGTGTGGTGG + Intergenic
907464305 1:54624739-54624761 GTTTCCCTGGATCAGTGGGGAGG + Intronic
908071004 1:60460170-60460192 CGTTCTCTGGACCAATGTCTTGG - Intergenic
910769517 1:90816958-90816980 GGTAGTTTGGACCAGGGTGGTGG - Intergenic
912815853 1:112827445-112827467 TGTTCTCTCAACCACTGTGGGGG - Intergenic
913140558 1:115937335-115937357 GGTTCTCAGGAGTGGTGTGGTGG - Intergenic
913678954 1:121170257-121170279 GTTTTTCTGGCCAAGTGTGGTGG - Intronic
914030786 1:143957903-143957925 GTTTTTCTGGCCAAGTGTGGTGG - Intronic
914158663 1:145110059-145110081 GTTTTTCTGGCCAAGTGTGGTGG + Intronic
915170605 1:153974577-153974599 GGTTCTTTGGAGCCTTGTGGTGG - Exonic
915521401 1:156446885-156446907 GGTTTTCTGGCCAGGTGTGGTGG + Intergenic
915986651 1:160472669-160472691 GGTGATCTGGACCAGAGTAGCGG + Intergenic
917137587 1:171802589-171802611 GGTTCTCTGGTTCTGTGGGGTGG - Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
918956451 1:191214704-191214726 TTTTCTCTGGTCCAGTCTGGAGG + Intergenic
920466253 1:206188795-206188817 GTTTTTCTGGCCAAGTGTGGTGG - Intronic
923651059 1:235874421-235874443 GATTCTCTGGAGCAGCGCGGAGG + Intronic
1066656803 10:37704559-37704581 GCTTCTCTGGGCAACTGTGGAGG - Intergenic
1067061564 10:43080544-43080566 CGTTCTCTGGGCCAGTGGTGTGG + Intronic
1069756349 10:70776338-70776360 GGTTCTCAGGTCCTGTGGGGAGG - Intronic
1071085214 10:81862190-81862212 GGTTCCCTCGAACACTGTGGAGG - Intergenic
1071774798 10:88774150-88774172 GGTTCTATGTGCAAGTGTGGGGG - Intronic
1072511468 10:96130217-96130239 GGATCCCTGGACCTGTTTGGGGG - Intronic
1073134710 10:101214106-101214128 GGTTCTCTGGCCGTGTGCGGTGG - Intergenic
1073729438 10:106271503-106271525 GGGGATCTGGACCAGTATGGGGG - Intergenic
1077284763 11:1760748-1760770 GGGGCTCTGGCCCACTGTGGGGG - Intronic
1078456863 11:11482363-11482385 GGGTCTGTGGGCCAGGGTGGAGG - Intronic
1078507175 11:11960929-11960951 GGTTCTCTGGGCCTGTGGGGAGG - Intergenic
1078663195 11:13303736-13303758 GGCTTTATGGACCAGTCTGGAGG + Intronic
1079472526 11:20791708-20791730 GGTACTCTTCACCAGTCTGGAGG + Intronic
1080129552 11:28778360-28778382 GGTTTTCTGGAGCAGTCAGGTGG - Intergenic
1080711790 11:34755429-34755451 GGTGCTCTGCACCAGTCTGGGGG - Intergenic
1084050435 11:66595970-66595992 GGTGGCCTGGAGCAGTGTGGAGG - Intronic
1087684317 11:101245824-101245846 AGTTCTCTCAACCACTGTGGAGG - Intergenic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1088278939 11:108117594-108117616 GGGTCTCTGGCCAGGTGTGGTGG - Intergenic
1089409876 11:118231824-118231846 GGTAGTTTGGACCAGGGTGGTGG - Intronic
1092017020 12:5168058-5168080 GGTTCTCAGGACCACTGAGTGGG - Intergenic
1097254254 12:57660357-57660379 CTTTCTCTGGCCTAGTGTGGTGG + Intergenic
1098314734 12:69181360-69181382 GTGTTTCTGGCCCAGTGTGGTGG - Intergenic
1102051307 12:109864091-109864113 GGAGCTCTGGCCCTGTGTGGTGG - Intronic
1102134210 12:110559436-110559458 GGGTCTCGGGCCCAGCGTGGTGG + Intronic
1102587438 12:113933133-113933155 TGTTCTCTGTACCAGTCTCGAGG - Intronic
1104573363 12:129944836-129944858 GGTGTCCTGGACCAGGGTGGTGG - Intergenic
1104982563 12:132580801-132580823 TGCTCTCTGGACCCATGTGGAGG + Intronic
1105435625 13:20375758-20375780 GGTCCTCAGGAAGAGTGTGGTGG + Intergenic
1106608102 13:31250735-31250757 GGTTCTCTGTCCCAGGGAGGTGG - Intronic
1107533542 13:41307141-41307163 GGTTGTCTACACTAGTGTGGGGG - Intergenic
1107568117 13:41627636-41627658 GGTGCACTGTTCCAGTGTGGAGG - Intronic
1107715881 13:43199063-43199085 CGTTTTCTGGAGGAGTGTGGTGG + Intergenic
1108711673 13:53039169-53039191 GCTTCTCTGGAACATTTTGGTGG - Intronic
1112016942 13:95339005-95339027 GTTCCTCTGGAACAGAGTGGAGG - Intergenic
1113586270 13:111468204-111468226 GGTTCAGTGGGCCTGTGTGGTGG + Intergenic
1120611344 14:86645902-86645924 GGTTTTCTGTATCAGTGTAGAGG - Intergenic
1122836762 14:104434409-104434431 GGCCCTCTGGACTGGTGTGGGGG + Intergenic
1125135221 15:36333412-36333434 TTTTCTGTAGACCAGTGTGGGGG - Intergenic
1126093002 15:45068321-45068343 GGTTATCTGTGACAGTGTGGAGG + Intronic
1127398036 15:58558696-58558718 TTTTCCATGGACCAGTGTGGGGG - Intronic
1128678038 15:69626172-69626194 TGGGCTCTGGCCCAGTGTGGAGG + Intergenic
1129036300 15:72650607-72650629 GATTCCCTGGTCCAGTCTGGGGG + Intergenic
1129213589 15:74086617-74086639 GATTCCCTGGTCCAGTCTGGGGG - Intergenic
1129396813 15:75254468-75254490 GATTCCCTGGTCCAGTCTGGGGG + Intergenic
1129400423 15:75278745-75278767 GATTCCCTGGTCCAGTCTGGGGG + Intronic
1129730724 15:77930941-77930963 GATTCCCTGGTCCAGTCTGGGGG - Intergenic
1130976889 15:88783286-88783308 GGGTCTCTGGGCCATTTTGGAGG + Intergenic
1131277139 15:90991741-90991763 GGTGACCTGGACCAGGGTGGGGG - Intronic
1131808605 15:96148919-96148941 GGTTTTCTGGCCAGGTGTGGTGG - Intergenic
1132495986 16:263683-263705 GGTTTTCTGGAACAATATGGAGG - Exonic
1133162419 16:3920770-3920792 GGGTCCCTGGACCAGTCTAGGGG - Intergenic
1134159372 16:11873874-11873896 GGTTTTTTGGCCCAGTGTGGTGG - Intronic
1135134111 16:19875072-19875094 GGATCTCTGTAACAGTGAGGTGG - Intronic
1136269671 16:29141285-29141307 GGGCCTCTCGCCCAGTGTGGTGG + Intergenic
1136281745 16:29217560-29217582 GCTTCGCGGGACCCGTGTGGTGG - Intergenic
1137041792 16:35620044-35620066 TGTTCTCTCAACCACTGTGGTGG + Intergenic
1138169324 16:54834155-54834177 TGTTTGTTGGACCAGTGTGGTGG + Intergenic
1138339916 16:56281821-56281843 GATTCACTGGACCAGTGGGGGGG + Intronic
1138448278 16:57078066-57078088 GGTCCTCGGGAGCAGTGGGGGGG + Intronic
1139770747 16:69274364-69274386 GGAGCTCTGGCCCAGCGTGGTGG + Intronic
1141874031 16:86809279-86809301 GGTGCTCTGGCCCAGTGAGGAGG - Intergenic
1142086123 16:88183476-88183498 GCTTCGCGGGACCCGTGTGGTGG - Intergenic
1143345367 17:6245184-6245206 AGTTCTATGCACCAGTGAGGAGG + Intergenic
1143901589 17:10178511-10178533 GGTTTTCTGGAGCCCTGTGGTGG - Intronic
1144862146 17:18311811-18311833 GGGTCTCTGACCTAGTGTGGGGG + Intronic
1144884214 17:18447946-18447968 GGTTCTGAGAACCGGTGTGGGGG + Intergenic
1146763943 17:35501887-35501909 TGTTCTCTCAACCACTGTGGGGG - Intronic
1147443239 17:40460179-40460201 GGTCCTCTTTCCCAGTGTGGGGG + Intergenic
1147983495 17:44290086-44290108 TAATATCTGGACCAGTGTGGTGG + Intergenic
1149003479 17:51780436-51780458 GGATCTCAGAAACAGTGTGGTGG - Intronic
1150949226 17:69783716-69783738 CATTTTCTGGCCCAGTGTGGTGG - Intergenic
1151626206 17:75277478-75277500 GGTTCTCTGAACCAGAGAAGTGG + Exonic
1152647909 17:81478407-81478429 AGTTCTCTGGACCGGGCTGGCGG + Intergenic
1153052541 18:913674-913696 AGCTCTCTCGACCAGTGCGGTGG - Intergenic
1154373195 18:13785196-13785218 GGTTGTCTGGAGCTGGGTGGGGG + Intergenic
1155537561 18:26832900-26832922 GGCACTCTGGCCAAGTGTGGTGG - Intergenic
1159466962 18:68796200-68796222 GGTTGTCTGAACCAGAGTAGTGG + Intronic
1160414742 18:78700698-78700720 GTTTCTCTGGCCGGGTGTGGTGG - Intergenic
1160920918 19:1520202-1520224 GGGTCTCTGGAGCCCTGTGGTGG + Intergenic
1161337041 19:3720290-3720312 GGGTCTCTGGACTAGTGTTTTGG + Intronic
1161651860 19:5490635-5490657 GGGTCTCTGGGCCAGCCTGGAGG - Intergenic
1161654325 19:5504503-5504525 GGTTCTCTGGACAAAGGAGGAGG - Intergenic
1162124205 19:8490533-8490555 GGTTCTGAGGCCCAGGGTGGCGG + Intronic
1163991601 19:21003658-21003680 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1164217536 19:23162971-23162993 TGTTCTCTCAACCACTGTGGGGG + Intergenic
1167131333 19:47588015-47588037 GGTGGCCTGGACCAGTGTGGAGG - Intergenic
1168511838 19:56979723-56979745 GGTTCTGTGGTACAGGGTGGTGG + Intergenic
1168511915 19:56979955-56979977 GGTTCTGTGGTACAGGGTGGTGG + Intergenic
930169549 2:48237039-48237061 GGTTTTCTGGCCAAGTGCGGTGG + Intergenic
930240315 2:48929453-48929475 GTTTCTCTTGATGAGTGTGGTGG + Intergenic
931299030 2:60958594-60958616 GGTTTTCTGGCTGAGTGTGGTGG + Intronic
932347824 2:71007244-71007266 GGTTCTCTGTCCCAGGGTTGTGG + Intergenic
932477253 2:72013961-72013983 GGGTGCCTGGACCGGTGTGGTGG + Intergenic
935756296 2:106278590-106278612 TGTTCTCTGGAGCAGAGAGGTGG - Intergenic
937141899 2:119609184-119609206 TGTTCTCTGCACCTGTGTGTAGG - Intronic
937291784 2:120786183-120786205 GGTTCTGAGGAGCAGTGTGATGG + Intronic
941893457 2:170606027-170606049 GGTTATCTGGACCAGGGTTGTGG - Intronic
943441288 2:187931460-187931482 GTGGATCTGGACCAGTGTGGTGG + Intergenic
947837539 2:233186513-233186535 GGTTTTCTGGCCTGGTGTGGTGG + Intronic
1168785400 20:535066-535088 ATTTCTTCGGACCAGTGTGGTGG + Intronic
1168922117 20:1547712-1547734 GGATCTGTAGACCAGTTTGGGGG + Intronic
1170709260 20:18775353-18775375 GGTTCTCTACTCCACTGTGGTGG + Intergenic
1171101665 20:22389401-22389423 GGTTATCTGGACCAGGGGTGGGG + Intergenic
1173902635 20:46602044-46602066 ATTTCTCTGGTCAAGTGTGGTGG + Intronic
1174565856 20:51464021-51464043 AGTTATCTGGCCCAGTGGGGTGG - Intronic
1175286883 20:57842525-57842547 TGTTCTCTGCACAAATGTGGTGG + Intergenic
1175634313 20:60567922-60567944 GTTTCTCTGGACAAGTCTGAAGG + Intergenic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
1176871266 21:14084631-14084653 GGTTCTCTCCACCCGTGTGCGGG - Intergenic
1177223392 21:18222292-18222314 GGCTCTCTGCACTAATGTGGGGG + Intronic
1181646918 22:24236368-24236390 GGTGGCTTGGACCAGTGTGGTGG - Intronic
1182904233 22:33921785-33921807 AGTTCTAGGGACCAGGGTGGGGG + Intronic
1183121251 22:35731808-35731830 GGTGACCTGAACCAGTGTGGTGG + Intergenic
1183508755 22:38223159-38223181 GGGGCTCAGGACCAGTGGGGAGG + Intronic
1183552155 22:38495530-38495552 GCTTCTCTGGGCCAGTGCGGTGG - Intronic
949329798 3:2908890-2908912 GGTTCTCCTGGCCTGTGTGGTGG + Intronic
949454915 3:4228077-4228099 GGTGTGGTGGACCAGTGTGGTGG + Intronic
950947086 3:16960310-16960332 GGTAAGATGGACCAGTGTGGCGG - Intronic
952001173 3:28787368-28787390 GGTTCACTGGACCAGAGGTGGGG - Intergenic
952441083 3:33329993-33330015 GTTGATCTGGTCCAGTGTGGTGG + Intronic
953878954 3:46681770-46681792 GGTGCTCGGGACCAGGCTGGAGG - Intronic
954093831 3:48307059-48307081 GGTTGTGTTTACCAGTGTGGTGG - Intronic
954417076 3:50398519-50398541 GTGTCTCTGGACCTGTGTAGAGG + Intronic
954431484 3:50473056-50473078 GGGTGTCTGGACAAGCGTGGGGG + Intronic
955320724 3:57972388-57972410 GGCTCTCTGGGCCAGTGGCGTGG + Intergenic
955861075 3:63331193-63331215 GGTTGCCTGGATCAGTGTGTTGG - Intronic
959268292 3:104171612-104171634 GTCTCTCTGGGCCAGTCTGGGGG + Intergenic
959849794 3:111072256-111072278 CGTTCTCTGGAGCAGCGAGGCGG + Intronic
960803974 3:121564980-121565002 ACTTCTCTGGACCAGGGAGGGGG - Intergenic
961228087 3:125272212-125272234 GGTTGTCTGCACCATTGTGTTGG + Intronic
964363199 3:155920364-155920386 TGGTCTGTGGACCGGTGTGGTGG + Intronic
966876992 3:184328094-184328116 GGTTCCCTGGCCGGGTGTGGTGG + Intronic
969211637 4:5692313-5692335 GGTTATTAGGCCCAGTGTGGTGG - Intronic
970101997 4:12534466-12534488 GGCTCCCTGGGCAAGTGTGGAGG - Intergenic
971789727 4:31153993-31154015 GGTTCTTTGGACTAATGTGTGGG + Intergenic
973616964 4:52688399-52688421 GGATCTCTGGCCGGGTGTGGTGG - Intergenic
975467393 4:74723990-74724012 GGTTCTCTGGACCAGTCCTAGGG - Intergenic
979118861 4:116866539-116866561 GGCTCTCTGTAGCAGAGTGGGGG - Intergenic
980072807 4:128261291-128261313 TGTTCTCTCAACCACTGTGGTGG - Intergenic
982202472 4:152973891-152973913 GGTTCTCTGGAGCAGGGTGAAGG + Intronic
982444728 4:155477189-155477211 GGTTGCATGGACTAGTGTGGAGG + Intergenic
982932694 4:161428891-161428913 GGTACTCTGCTCCACTGTGGCGG - Intronic
985530008 5:428554-428576 GGTACTAGGGACCAGTTTGGTGG + Intronic
987289348 5:16493815-16493837 GGTGCTCAGGACCAGTGTGGTGG - Intronic
987930697 5:24396759-24396781 AGTTCTCTCAACCACTGTGGAGG + Intergenic
990528983 5:56655203-56655225 GGTTCTCAGGAACACTGAGGAGG - Intergenic
992305161 5:75429529-75429551 CCTGCCCTGGACCAGTGTGGTGG + Intronic
992519004 5:77529446-77529468 GTTTCTCTGTATCAGTTTGGGGG - Intronic
995990424 5:118231718-118231740 CCTTCTCTGGCCGAGTGTGGTGG - Intergenic
999786172 5:154892608-154892630 GGTTCACAGGAACAGTTTGGTGG - Intronic
1000738412 5:164934046-164934068 GGTGCTCTGTTCCAGAGTGGTGG + Intergenic
1001845890 5:174921220-174921242 GGTTCCCTGGTCCAGCCTGGGGG - Intergenic
1003445317 6:6178454-6178476 GGTTCTCTTCACCAGAGTAGGGG + Intronic
1006445944 6:34079873-34079895 GGGGCCCTGGGCCAGTGTGGAGG - Intronic
1007422996 6:41730739-41730761 GTATCTCTGGTGCAGTGTGGAGG + Intronic
1008123263 6:47641668-47641690 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1008780719 6:55101330-55101352 GGTGGTTTTGACCAGTGTGGTGG - Intergenic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1017223016 6:151988061-151988083 TTTTCCATGGACCAGTGTGGGGG + Intronic
1017816121 6:158017854-158017876 GCTTCTCTGGCACAGGGTGGGGG - Intronic
1017911971 6:158801093-158801115 GGTTCTGTTACCCAGTGTGGTGG - Intronic
1018242133 6:161788030-161788052 GGCTTTCTGGGCCACTGTGGCGG - Intronic
1018411954 6:163558684-163558706 GGTTCACTGGCCGGGTGTGGTGG - Intronic
1019202542 6:170330117-170330139 TGTTTTCTGGAACAGTGTGAGGG + Intronic
1019483280 7:1275942-1275964 AGTTCTCAGGAGCAGTGTGGCGG + Intergenic
1026234056 7:68510506-68510528 GTTTATCTGGAGCACTGTGGTGG + Intergenic
1027112983 7:75455582-75455604 GGTTTTCTGGCCCGGTGCGGTGG - Intronic
1027285230 7:76640193-76640215 GGTTTTCTGGCCCGGTGCGGTGG - Intergenic
1029404330 7:100365529-100365551 GTTTTACTGGCCCAGTGTGGTGG + Intronic
1031240164 7:119227850-119227872 GGTTCTCAGAACCACTGTGTTGG + Intergenic
1031409803 7:121427779-121427801 GCATCTTTGGCCCAGTGTGGTGG - Intergenic
1031667017 7:124496868-124496890 GTTTCTATTGGCCAGTGTGGTGG - Intergenic
1031968975 7:128049844-128049866 GGATCTCTGGGGCAGTGTGAAGG + Intronic
1035107685 7:156455882-156455904 GGAGCTGTGCACCAGTGTGGAGG - Intergenic
1035251932 7:157603430-157603452 GTTTCTGGGGACGAGTGTGGTGG - Intronic
1035626939 8:1077398-1077420 GGTTCTCAGGAGCAGAGGGGCGG + Intergenic
1037630269 8:20649441-20649463 GGTCCTCTGGACCAGGGCGGTGG + Intergenic
1038661512 8:29501509-29501531 GCTTCCCTGGACCACAGTGGAGG - Intergenic
1039877041 8:41595895-41595917 TGTTCTCTCAACCACTGTGGCGG + Intronic
1048936261 8:139359697-139359719 GGTTCTCTGACCCAATGGGGAGG - Intergenic
1049406132 8:142452581-142452603 GGATCTCGGGACAAGTGCGGAGG - Intronic
1049582822 8:143420553-143420575 TCTTCTCTGGAGCAGGGTGGGGG - Intronic
1049912107 9:279012-279034 GGTGCTTTGGACGAGGGTGGTGG + Intronic
1051646994 9:19279025-19279047 TGTATTCTGGTCCAGTGTGGTGG + Intronic
1056106308 9:83350049-83350071 TGTTCTCTGGAGCTGTGTGCTGG - Intronic
1057334923 9:94148149-94148171 GGTTCTGTTGTCCAGTGTGTAGG + Intergenic
1057744429 9:97740105-97740127 GGGTCTGAGGACCAGAGTGGTGG + Intergenic
1058761869 9:108142042-108142064 GATTCTCTGCAACAGTTTGGTGG + Intergenic
1059912288 9:119058415-119058437 AGATCTCTGGCCCAGTGCGGTGG + Intergenic
1061321655 9:129834881-129834903 CGTCCTCTGGACCACTGTGCTGG - Intronic
1061783185 9:133007816-133007838 GGTGCTCTGGGCCGGCGTGGAGG + Intergenic
1062045788 9:134423888-134423910 TGTTCTCTGGATCGGTCTGGTGG - Intronic
1062291886 9:135799110-135799132 GGAAGTCTGGGCCAGTGTGGTGG - Intergenic
1062645248 9:137544461-137544483 GGTGGTCTGGAGCAGAGTGGAGG - Intronic
1188627093 X:32298250-32298272 GGTGCTTTGGATCAGAGTGGAGG + Intronic
1189624822 X:42885461-42885483 GGTCATTAGGACCAGTGTGGCGG - Intergenic
1189907201 X:45773671-45773693 GGTGCTCGGCACTAGTGTGGGGG + Intergenic
1191206748 X:57842606-57842628 GGTGCTCTGTACCAGTGAGATGG - Intergenic
1192244388 X:69360657-69360679 GGAGCTTTGGACCAGGGTGGTGG + Intergenic
1194501930 X:94691991-94692013 GATTCTCTGGAGTAGTGAGGGGG + Intergenic
1195403280 X:104484716-104484738 GCTTCCCTGGACCACTTTGGAGG - Intergenic
1197521007 X:127495808-127495830 GATTCTCAGGGCCAGTGTGGTGG - Intergenic
1198813908 X:140566447-140566469 GTTTCCATGGACCAGGGTGGGGG + Intergenic
1199656954 X:150005806-150005828 GGATCCCTGGATCAGAGTGGTGG + Intergenic
1200296105 X:154922182-154922204 AGTTATTTAGACCAGTGTGGTGG - Intronic