ID: 906528264

View in Genome Browser
Species Human (GRCh38)
Location 1:46508929-46508951
Sequence CCCTGAGCTGAGTCATCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906528264_906528274 15 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528274 1:46508967-46508989 GATTAAGGTCAGTCTGTGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 93
906528264_906528273 14 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528273 1:46508966-46508988 GGATTAAGGTCAGTCTGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 114
906528264_906528275 21 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528275 1:46508973-46508995 GGTCAGTCTGTGAGGGGTTCAGG 0: 1
1: 0
2: 1
3: 20
4: 176
906528264_906528272 13 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528272 1:46508965-46508987 AGGATTAAGGTCAGTCTGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 113
906528264_906528269 -7 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528269 1:46508945-46508967 CTCAGGGCTGAGTCAGGCCTAGG 0: 1
1: 1
2: 4
3: 60
4: 422
906528264_906528270 0 Left 906528264 1:46508929-46508951 CCCCAGGATGACTCAGCTCAGGG 0: 1
1: 0
2: 2
3: 40
4: 238
Right 906528270 1:46508952-46508974 CTGAGTCAGGCCTAGGATTAAGG 0: 1
1: 0
2: 1
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906528264 Original CRISPR CCCTGAGCTGAGTCATCCTG GGG (reversed) Intronic
900186889 1:1336906-1336928 GGCTGAGCTGAGTCATCCGTCGG - Intronic
901139973 1:7022350-7022372 CCCACGGCAGAGTCATCCTGTGG - Intronic
903126491 1:21251733-21251755 CCCAGAGCTGGTTCCTCCTGGGG - Intronic
904002183 1:27345165-27345187 CCTTGAGCTCAGCCATCCTGGGG + Exonic
904404578 1:30277577-30277599 CCCTGAGCTTAGTTTTCATGTGG - Intergenic
904431420 1:30466983-30467005 CTCTGAGCTCATTCATGCTGAGG - Intergenic
905174497 1:36127247-36127269 CCCTGACCCGAGACAGCCTGGGG - Intergenic
905794345 1:40807225-40807247 CCCTCAGCTGAGTTTCCCTGAGG - Intronic
906088399 1:43156226-43156248 CCCTGAAGTGATTCAGCCTGCGG - Exonic
906100597 1:43257902-43257924 CCCTGAGCTGAGGTAGGCTGGGG + Intronic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
907480614 1:54743378-54743400 CCCTGCCCTGAGCCATCATGTGG + Intergenic
908026005 1:59952210-59952232 CAGTAAGCTGAGTAATCCTGAGG + Intergenic
908961819 1:69707350-69707372 CCCTCTGCTGAGTCACCCTGAGG + Intronic
909227610 1:73045197-73045219 TTCTGAGCTGAGCCACCCTGTGG - Intergenic
909527285 1:76640240-76640262 CCTTGTTCTGAGTCATCTTGTGG - Intergenic
913553696 1:119941827-119941849 ACCTGAACTAAGTCATGCTGGGG + Intronic
914992054 1:152507353-152507375 CCCTGAGCTGATTAATCCTGTGG - Intergenic
915971482 1:160358251-160358273 CCAGGAGCTGTGTCATACTGAGG + Exonic
919456034 1:197819842-197819864 CCCAAAGCTGAGTCATGCTGTGG - Intergenic
919910498 1:202107747-202107769 CCCTGAGCTGAGTGGTCCCTGGG + Intergenic
923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG + Intronic
924105453 1:240644823-240644845 CCGTGTGCTGAGTCAGCCTCTGG + Intergenic
924772149 1:247087941-247087963 CCCTGAGCTGTGGGTTCCTGTGG - Intergenic
1064494050 10:15888779-15888801 CCATGAGTAGAGTCAGCCTGAGG + Intergenic
1067836369 10:49644140-49644162 CCCTGAGCTCCCTCATCCTCTGG - Intronic
1071262642 10:83934793-83934815 CCCAGAGCTCAGACCTCCTGTGG - Intergenic
1074264284 10:111885899-111885921 CCATGAGTTGAAGCATCCTGAGG - Intergenic
1074446445 10:113524987-113525009 CCCAGAGATGAGTCATCCTCAGG + Intergenic
1074946057 10:118281788-118281810 CCCTCAGCACACTCATCCTGGGG - Intergenic
1074965668 10:118488839-118488861 CCCTTTGCTGACTCATGCTGGGG - Intergenic
1077220085 11:1411900-1411922 CCCTGTGCTGCCCCATCCTGTGG + Intronic
1077932978 11:6752993-6753015 CCTTGAGGTGGGTAATCCTGAGG + Intergenic
1078140638 11:8690170-8690192 CCGTGAGCTGAAACAGCCTGAGG + Intronic
1078465325 11:11545989-11546011 CCAGGAGCTGAGACACCCTGGGG + Intronic
1080205387 11:29723378-29723400 GGCTGAGCTGAGTCATTCTTTGG + Intergenic
1080560012 11:33454487-33454509 CACTGAGCTCAGTGACCCTGAGG + Intergenic
1081343006 11:41950642-41950664 CTCTTAGCTGAGTCAAACTGAGG - Intergenic
1085404747 11:76255117-76255139 CCCTCAGCTTTGTCGTCCTGAGG - Intergenic
1085771153 11:79327047-79327069 CCCTGAACTGAGTGATACTCAGG + Intronic
1086845914 11:91749409-91749431 CCCTGTGCTGAGTCTACCTCTGG - Intergenic
1087461848 11:98456068-98456090 CCCTGAGCTGTGTGTGCCTGTGG + Intergenic
1089582739 11:119491651-119491673 CCCTGTGCCGAGTCCTCCTTCGG - Intergenic
1089715370 11:120353942-120353964 CCCTGTGCTGGGTGATGCTGGGG + Intronic
1090066473 11:123508224-123508246 CCTTGTGCTGAGTTACCCTGTGG + Intergenic
1092522979 12:9292459-9292481 CCCTGAGCTGAGTTCCCCTGTGG + Intergenic
1092544312 12:9439438-9439460 CCCTGAGCTGAGTTCCCCTGTGG - Intergenic
1093439755 12:19180370-19180392 CCATGAGGGGAGTCATCCTCAGG + Intronic
1094508635 12:31082629-31082651 CCCTGAGCTGAGTTCCCCTGTGG + Intronic
1096474367 12:51899164-51899186 TCCTGAGAAGAGTCATCCTGAGG + Intergenic
1097669546 12:62519294-62519316 GCCTCAGCTGAGTGATACTGGGG + Intronic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101827910 12:108234809-108234831 CCCTGAACTAAATAATCCTGAGG - Intronic
1102202513 12:111067459-111067481 TCCTGATTTGAATCATCCTGAGG + Intronic
1102452959 12:113055484-113055506 CCCAGAACTCAGTGATCCTGTGG + Intergenic
1102483052 12:113237148-113237170 CCCTGAGCTTAGAAACCCTGGGG + Intronic
1104785040 12:131443870-131443892 CCCTGGGCTGACTCCGCCTGTGG + Intergenic
1109030350 13:57181779-57181801 CCCTGATTGCAGTCATCCTGAGG + Intergenic
1112107135 13:96253117-96253139 TTCTCAGGTGAGTCATCCTGTGG + Intronic
1112335671 13:98513394-98513416 CCCTGTGTGGAGCCATCCTGTGG + Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114522399 14:23347608-23347630 CCCTGGCCTGTGTCTTCCTGGGG - Exonic
1114575506 14:23709139-23709161 CTGTGTGCTGAGTCAGCCTGTGG - Intergenic
1115051313 14:29067087-29067109 CCCTGGGCTCAGTCCTCCTTGGG + Intergenic
1116937841 14:50760382-50760404 CCTTGAGCTGAGTAATCTTGTGG - Intronic
1119829404 14:77687779-77687801 TCCTGTGCTGAGGCTTCCTGGGG + Intronic
1121728111 14:96167569-96167591 ACAAGAGCTGAGTCACCCTGTGG + Intergenic
1121831006 14:97052518-97052540 CCTTGAGCTCAGACATCCTTAGG + Intergenic
1121896526 14:97653227-97653249 CCCTCAGGTGTCTCATCCTGAGG + Intergenic
1122414146 14:101540789-101540811 CCCTGAGCTGAACCAGCCTGTGG - Intergenic
1122824487 14:104362977-104362999 CCTTGAAGTCAGTCATCCTGTGG - Intergenic
1124106033 15:26738800-26738822 CCCTGAGCTATCTCAGCCTGAGG + Intronic
1127131937 15:55875145-55875167 CCATGATCTGCGTCATCTTGTGG - Intronic
1128029420 15:64466541-64466563 CCCTGACCTGAGTCATAGTCTGG - Intronic
1131109323 15:89754951-89754973 CCCAGAGCAGAGACAGCCTGAGG - Intergenic
1131414628 15:92243419-92243441 TCCAGAGCTGAGCCATGCTGAGG + Intergenic
1133438123 16:5797499-5797521 CTCAGAGCTGAGTCACTCTGGGG - Intergenic
1133717955 16:8467299-8467321 CCCTGATCAGAGTCATCAGGGGG + Intergenic
1135060803 16:19269873-19269895 CTGTGAGCTCAGTCATACTGAGG + Intergenic
1136477580 16:30523078-30523100 CCTTGAGCTCAGTCTTTCTGTGG - Exonic
1137576156 16:49601717-49601739 CTCTGGGCTCAGTCAGCCTGTGG + Intronic
1137981186 16:53071515-53071537 CCCTCAGGTGAGCCCTCCTGGGG + Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1141826405 16:86483810-86483832 CCCAGAGCCAAGTCATGCTGGGG + Intergenic
1141930399 16:87198404-87198426 CCCTGGGCAGAAGCATCCTGTGG + Intronic
1142374018 16:89697648-89697670 CCGTGAGCTGAGTAGGCCTGGGG - Exonic
1144303303 17:13943969-13943991 CTCTGAGCCGAGTCAACCAGTGG - Intergenic
1145177482 17:20713533-20713555 CAGTGAGCTGAGGCAGCCTGGGG - Intergenic
1145960218 17:28882793-28882815 CTCTGAGCTGGGTCTTCCTGGGG + Intronic
1146157417 17:30535726-30535748 CCCTGAGCTGCCATATCCTGGGG + Intergenic
1147722734 17:42548675-42548697 CCCTGAGCTCAGCGATCCTCTGG + Intergenic
1147976471 17:44250800-44250822 CAGTGACCTGAGTCACCCTGTGG + Intronic
1148859251 17:50595510-50595532 TCCTGAGCTGAGACAGCTTGCGG - Intronic
1149335634 17:55633053-55633075 AGCTGAGATGAGTCATCCTTTGG - Intergenic
1151467395 17:74296034-74296056 CCCAGAGCTGTGTCATGCTCAGG - Intronic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1151911860 17:77088758-77088780 GGCTGCCCTGAGTCATCCTGCGG - Exonic
1152304089 17:79511161-79511183 ACCTGGGCTGTGTCCTCCTGAGG + Intronic
1153411925 18:4803020-4803042 CCCTGAGCTTGGCCATCCAGTGG + Intergenic
1153517120 18:5914196-5914218 CCCTGAGCTGACTCATCCACTGG - Intergenic
1157515122 18:48305365-48305387 CCCTGAGCAGAACCATCCTGGGG - Intronic
1158328688 18:56337875-56337897 CCATGAGCCGAAGCATCCTGAGG + Intergenic
1160045052 18:75379029-75379051 CCCTGAGCTCAGTGACCTTGCGG - Intergenic
1160128891 18:76206139-76206161 CCCTGGGCTGGCTCATCCTGAGG - Intergenic
1160243116 18:77136973-77136995 CCCGGAGCTGAGGGATGCTGGGG + Intergenic
1160439283 18:78876570-78876592 CCCTGAGCTGAGTGCACTTGAGG + Intergenic
1160659730 19:292280-292302 CCCTGAGCTGAGGGTGCCTGGGG + Intergenic
1160710342 19:548536-548558 GCCTCAGCTGGGCCATCCTGGGG - Exonic
1160958501 19:1706383-1706405 CCCTGCACAGACTCATCCTGGGG + Intergenic
1162068250 19:8138418-8138440 CCCTGAGCTGTGTCCTCCTCGGG - Exonic
1162746125 19:12799732-12799754 CCCTGAGCTGAATCTTCTTTGGG + Intronic
1163062335 19:14769518-14769540 CCCTGAGCTGAGGCTTCAAGAGG + Intronic
1163514239 19:17753541-17753563 CCCTGAGTTGATTCAGCCTCGGG - Intronic
1165402699 19:35612092-35612114 CCCTGTGCTGGGTGATGCTGGGG - Intergenic
1166396173 19:42442904-42442926 TCCTGACCTGAGTCATCCCCAGG - Exonic
1166872821 19:45881297-45881319 CCCTGTGCTGGGTGATGCTGGGG + Intergenic
1166920955 19:46228819-46228841 CCCTGAGAAGAGCCATCTTGGGG - Intergenic
1166987973 19:46673522-46673544 CACTGAGCTGGGTGATGCTGGGG - Intergenic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
927289961 2:21395539-21395561 CCCAGAGCTGCCTCTTCCTGGGG - Intergenic
929040965 2:37743976-37743998 CACTGAGCTGTGACATCATGGGG - Intergenic
929868735 2:45740192-45740214 CCCTGAACTGAGTAAACCAGTGG + Intronic
933056682 2:77679468-77679490 CCCTGGGCTGAGCCATATTGGGG - Intergenic
935145708 2:100393818-100393840 CCCTCAGCTGTGACCTCCTGTGG - Intronic
935617410 2:105101016-105101038 TCCTCAGCTGAGACTTCCTGGGG - Intergenic
936064353 2:109319359-109319381 TCCTGAGCTGTGTCTGCCTGTGG + Intronic
937821170 2:126312780-126312802 CCCTGAGCTGAGTGGGTCTGTGG - Intergenic
938082352 2:128376900-128376922 CCTGGTGCTGAGTCATCCGGAGG + Intergenic
938209610 2:129456893-129456915 CCCAGGGCTGGGTCATTCTGTGG - Intergenic
939979968 2:148768064-148768086 CACTGAGCAGGGTCATCCAGGGG - Intronic
940094074 2:149953602-149953624 CCCTGACCTCAGCCATCCTTGGG - Intergenic
947104434 2:226653866-226653888 CCCTGAGCTGAGAGAGCCAGAGG + Intergenic
948272236 2:236683499-236683521 CTCTGAGCAGTGTCATCCTGCGG - Intergenic
948877123 2:240835571-240835593 CCCAAAACTGGGTCATCCTGAGG + Intergenic
1169376310 20:5069230-5069252 CCTTGAGCTGAGTCCTCCTTCGG + Intronic
1169979987 20:11373650-11373672 CCCTGAGCTGAGACTTCAAGAGG + Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1170649259 20:18225024-18225046 CCCTGCCATGAGTCAGCCTGGGG - Intergenic
1170896060 20:20415479-20415501 CCCTGAATTGAGTAATCCAGGGG - Intronic
1175080375 20:56415075-56415097 CTCTGAGCTTAGTCTGCCTGGGG - Intronic
1175403032 20:58711323-58711345 CCCTGTGCTGAGGCCTCCTGTGG - Intronic
1176422344 21:6526363-6526385 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179697835 21:43134679-43134701 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179889443 21:44328166-44328188 TTCTGAGCTGGGCCATCCTGGGG + Intergenic
1180010893 21:45050554-45050576 CCATGGGCTGGGACATCCTGGGG - Intergenic
1182063147 22:27412215-27412237 CTTTGAGCTGTGTGATCCTGGGG - Intergenic
1182747597 22:32617504-32617526 CCTTGTTCTGAGTCATCCCGTGG + Intronic
1182896999 22:33867345-33867367 CTCTGCTCTGACTCATCCTGTGG + Intronic
1182972356 22:34590200-34590222 CCCTGACCTGGCTCACCCTGTGG - Intergenic
1183084578 22:35478629-35478651 CCTTGAGTTGGGACATCCTGGGG + Intergenic
1183344450 22:37299300-37299322 CCCTCAGGTGAGTAGTCCTGGGG + Exonic
1183603450 22:38853540-38853562 CTCTGAGCTCACTCATCCTTTGG + Intergenic
1183977331 22:41520200-41520222 CCCTGACCTGGCTCACCCTGTGG + Exonic
1184531956 22:45061881-45061903 CCCGGAGCTGGGGAATCCTGTGG + Intergenic
1184730464 22:46368660-46368682 CGCTGTGCTGAGTCCTCCCGCGG + Intronic
949381001 3:3445775-3445797 CCCTGAGCTAAGTCATCTCAGGG + Intergenic
950189911 3:10969538-10969560 CCATGAGCTGAGCCATGCTGTGG + Intergenic
950435969 3:12980306-12980328 CCCTGAGCCAAGTCAGCCTTTGG + Intronic
951420292 3:22475856-22475878 CTCTCAGCTGAGTCACCCTCTGG + Intergenic
951839932 3:27023528-27023550 CCATGAGCTGTCTCATCTTGAGG + Intergenic
954294330 3:49665854-49665876 CCCTGAGCTGACTTAGTCTGGGG - Intronic
954554094 3:51504766-51504788 TTCTGACCTGAGTCATCATGAGG - Intergenic
954652865 3:52175947-52175969 CCCTCTGATGAGTCATCCTTGGG + Intergenic
954662900 3:52235430-52235452 CCCAGAGCTCGGCCATCCTGCGG - Intronic
954791062 3:53133782-53133804 CCCTGAGCTGAGTCCTCCATGGG - Intergenic
954992524 3:54853791-54853813 GCCTGAGGTCAGTGATCCTGGGG - Intronic
959427566 3:106210769-106210791 TCCTGTACTGAGTCATTCTGGGG - Intergenic
960988348 3:123294983-123295005 CCCTGGGCTGGGGCACCCTGGGG - Intronic
961645182 3:128389076-128389098 CCCTGGGCCGAGGCAGCCTGCGG + Intronic
962189372 3:133294437-133294459 TCCTGAGATGAGTCATCATGAGG - Intronic
962311222 3:134328353-134328375 CCCACAGCTGAGTCATCCTTGGG + Intergenic
967984585 3:195085595-195085617 CCAAGAGCCCAGTCATCCTGCGG + Intronic
974144228 4:57926509-57926531 CCCGGGGATGAGTCATCATGGGG - Intergenic
974953954 4:68616172-68616194 CTCTGAGCTGAGTGAGGCTGAGG - Intronic
981005584 4:139871686-139871708 CCCTGAGCTGTGTCTTCCTCAGG + Intronic
981538415 4:145824138-145824160 CCCTGACCTGAGTGATCCTAAGG + Intronic
982254862 4:153441935-153441957 TTCTGAGCTTAGTGATCCTGAGG + Intergenic
983057976 4:163121903-163121925 TCCTGATTTGAGTCATCCAGAGG + Intronic
985477410 5:85950-85972 CTCTGAGCTCAGGCATCCTGTGG + Intergenic
985556674 5:561914-561936 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985556724 5:562086-562108 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985556749 5:562172-562194 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557154 5:563637-563659 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557193 5:563766-563788 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557218 5:563852-563874 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557230 5:563895-563917 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557319 5:564196-564218 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557331 5:564239-564261 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557356 5:564325-564347 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557382 5:564411-564433 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557408 5:564497-564519 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557434 5:564583-564605 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557447 5:564626-564648 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557459 5:564669-564691 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985557471 5:564712-564734 CCCTGAGCTGAGCCCCTCTGCGG - Intergenic
985992583 5:3575572-3575594 CCCTGAGCTGAGGCGTCCTCTGG + Intergenic
986173073 5:5329245-5329267 CCCTGAGCTATGAAATCCTGGGG - Intergenic
988686007 5:33526278-33526300 ACCTGAGCTCAGGCCTCCTGTGG + Exonic
993137463 5:83987968-83987990 ACCTGAGCTGAGGCATCCAACGG + Intronic
995696502 5:114883907-114883929 CTCTCAGCTGAGGCCTCCTGTGG + Intergenic
996868956 5:128164158-128164180 CCCAGATCTGATTCATTCTGGGG - Intronic
998695334 5:144631592-144631614 CCCTAAGCCCAGTAATCCTGTGG - Intergenic
999306929 5:150525564-150525586 CCCTGTCCTGAGCCAGCCTGGGG - Intronic
1000635706 5:163641479-163641501 ACCTGAACTGACTCATCCAGGGG - Intergenic
1002164435 5:177335799-177335821 CCCTGGAATGGGTCATCCTGAGG + Intronic
1002451059 5:179318740-179318762 CCCCCAGGGGAGTCATCCTGGGG - Intronic
1003063129 6:2877626-2877648 CCCTCTGCTGAGTCATGCAGGGG - Intergenic
1003391109 6:5713785-5713807 ACCTGGGCCGAATCATCCTGGGG - Intronic
1004507375 6:16257960-16257982 ACATGAGCTGAGTCACACTGGGG + Intronic
1004850865 6:19698089-19698111 CGCTGAGTTGAGTCATTCTGTGG + Intergenic
1006184041 6:32170409-32170431 CCAGGACGTGAGTCATCCTGGGG - Exonic
1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG + Intronic
1006949060 6:37806385-37806407 CTCTGAGCTGAGTGTTCCAGGGG - Intergenic
1007209453 6:40180586-40180608 CTCTGTGCTGAGTCTTCCCGTGG + Intergenic
1007352612 6:41284769-41284791 CCCTGAGTTGAGTCTTCCTAAGG - Intronic
1007517513 6:42425058-42425080 TCCTCAGCTGAGTTATCATGGGG + Intronic
1007692825 6:43713956-43713978 CTCTGAACTCAGTTATCCTGGGG - Intergenic
1007713381 6:43838829-43838851 CTCAGTGCTGAATCATCCTGTGG + Intergenic
1010947886 6:81999407-81999429 TCCTCAGGTGAGTCATTCTGCGG - Intergenic
1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG + Intronic
1015839892 6:137465980-137466002 CCTGGAGCTCAGTCATCCTGCGG + Intergenic
1018714920 6:166524820-166524842 CCACGAGCTGTGTCATCTTGGGG - Intronic
1018868802 6:167765869-167765891 CCCTGAGCAGAAGCTTCCTGAGG - Intergenic
1018920339 6:168168062-168168084 GGCTGGGCTGGGTCATCCTGGGG + Intergenic
1018941386 6:168310548-168310570 CCCTGAGCTGAGGCTACCGGAGG + Intronic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1019707468 7:2503346-2503368 CCCTCAGCTGACACATCGTGGGG + Intergenic
1019857276 7:3621710-3621732 ACCTTATCTGAGTCTTCCTGTGG + Intronic
1020013842 7:4820076-4820098 CCCTGAGCTGACTCTTCCTGTGG + Intronic
1020084598 7:5303615-5303637 CCCTGACCTGTGGCATCGTGTGG - Exonic
1022967800 7:35489532-35489554 CCCTTAGTTGAGTCTTCCTGTGG + Intergenic
1023292757 7:38685666-38685688 CCCTGAAGTGGTTCATCCTGTGG + Exonic
1025215764 7:57054742-57054764 CCGTGAGCCGAGTCAGCCTTTGG - Intergenic
1025626511 7:63227149-63227171 TCGTGAGCTGAGTCAGCCTTTGG - Intergenic
1028813875 7:95121714-95121736 CCTCCAGCTGAGTCATCCCGTGG + Intronic
1029538388 7:101169027-101169049 CCCAGAGCTGGGGAATCCTGGGG + Intergenic
1032262778 7:130350335-130350357 GCCTGTGATGAGTCCTCCTGGGG + Intronic
1033361847 7:140643556-140643578 CCCATTGCTGGGTCATCCTGTGG + Intronic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1034637317 7:152577506-152577528 CCCTGTGCTGAGTCTGCCTCTGG + Intergenic
1034753041 7:153588522-153588544 CCCTGTACAGAGTGATCCTGAGG + Intergenic
1034760739 7:153669494-153669516 CCTTGGGCTGAGTCATCATTGGG - Intergenic
1035321186 7:158030308-158030330 CGCAGAGCTGCCTCATCCTGCGG - Intronic
1035585616 8:770747-770769 CCCTGAGCTGTAAAATCCTGGGG + Intergenic
1036115186 8:5951677-5951699 CCCTGAACTGAAGCTTCCTGAGG - Intergenic
1036549668 8:9805237-9805259 TCCTGGGCTGTGGCATCCTGAGG - Intergenic
1038718189 8:30010324-30010346 CCCTGAGCTGTGTCAAGCTGTGG + Intergenic
1038750625 8:30292154-30292176 CCATGAGCAGAGGCAGCCTGAGG - Intergenic
1039874945 8:41577750-41577772 CCCTGAGCTGAGTCCTCTAACGG + Intronic
1041519809 8:58742915-58742937 CCCTGAGCTCAATCGTCTTGAGG + Intergenic
1043215069 8:77574913-77574935 CCCCAAGCTGAGTAATGCTGTGG - Intergenic
1046053155 8:109047444-109047466 CCATGAGCTGAGGCAGCCTGTGG + Intergenic
1046517896 8:115287039-115287061 TCCTGAGCTGGGTTTTCCTGTGG - Intergenic
1046525748 8:115380362-115380384 AGCTGAGCTGAATCATCCTTGGG - Intergenic
1047347092 8:124039054-124039076 CCCTGAGCTGCCCCAACCTGAGG + Intronic
1048528019 8:135222168-135222190 CCATGAGCTGAATCATCCATAGG + Intergenic
1048704999 8:137143721-137143743 CCATGAGTTGAATAATCCTGAGG + Intergenic
1049065690 8:140311991-140312013 TCCTGAGCTCTGTCATGCTGTGG - Intronic
1049814727 8:144592860-144592882 CCCTGTGCAGAGCCAGCCTGCGG - Intronic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1054456885 9:65436284-65436306 CACTGAGCTCAGTCAGCCTGGGG + Intergenic
1056134403 9:83617457-83617479 TGCTGAGCTGAATGATCCTGAGG - Intergenic
1056141306 9:83683043-83683065 TGCTGAGCTGAATGATCCTGAGG + Exonic
1056740177 9:89247659-89247681 CCTGCAGCTGAGTCATCCAGGGG + Intergenic
1056921383 9:90792360-90792382 GTCTGAGCTAAGTTATCCTGGGG - Intergenic
1057744681 9:97741566-97741588 CCCGGGGCTGAGTCCTCGTGGGG + Intergenic
1058753287 9:108060411-108060433 CCCAAAGGTCAGTCATCCTGAGG + Intergenic
1059656986 9:116366249-116366271 CCCTGACCTCACACATCCTGAGG - Intronic
1061266969 9:129511760-129511782 CCTAGAGCTGAGACATCCTGAGG - Intergenic
1061321597 9:129834512-129834534 CCCTGAGCTGTGTCGTCTCGGGG - Intronic
1062213605 9:135377568-135377590 CCCTGAGATGAGGCGTCCTGTGG + Intergenic
1186533899 X:10327805-10327827 GCCTGAGCTGTGACATCTTGGGG - Intergenic
1189657886 X:43266448-43266470 CCCCAAGCTCAGTAATCCTGTGG + Intergenic
1190094544 X:47468171-47468193 CCCTTATCTGAGTGATCCTGGGG - Intronic
1190789347 X:53684450-53684472 CGCTGAGCTGTGTCATCGCGAGG - Intronic
1192428352 X:71096455-71096477 CCCTGAGGGGAGGCATCGTGAGG + Exonic
1197829521 X:130626948-130626970 TCCTGAGCTGATTCATTCTGAGG + Intronic
1197867719 X:131036477-131036499 CCCTGAGGTGAAGTATCCTGGGG - Intergenic
1198959599 X:142170243-142170265 CCCTGAGCTAAGGCAGCTTGGGG - Intergenic
1199765909 X:150941608-150941630 CCCTGACCTTGGCCATCCTGTGG - Intergenic