ID: 906528642

View in Genome Browser
Species Human (GRCh38)
Location 1:46510952-46510974
Sequence GCTTCTTCCGGAACTTGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906528642_906528651 26 Left 906528642 1:46510952-46510974 CCGGGCCAAGTTCCGGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906528651 1:46511001-46511023 CAGAAGCAGAAGGAGGCTGAGGG 0: 1
1: 0
2: 4
3: 68
4: 735
906528642_906528648 19 Left 906528642 1:46510952-46510974 CCGGGCCAAGTTCCGGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906528648 1:46510994-46511016 ACAGCTCCAGAAGCAGAAGGAGG 0: 1
1: 0
2: 13
3: 44
4: 443
906528642_906528645 -5 Left 906528642 1:46510952-46510974 CCGGGCCAAGTTCCGGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906528645 1:46510970-46510992 GAAGCAGCGTAGCCTGCAGAAGG 0: 1
1: 0
2: 11
3: 14
4: 153
906528642_906528647 16 Left 906528642 1:46510952-46510974 CCGGGCCAAGTTCCGGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906528647 1:46510991-46511013 GGAACAGCTCCAGAAGCAGAAGG 0: 1
1: 0
2: 2
3: 46
4: 363
906528642_906528650 25 Left 906528642 1:46510952-46510974 CCGGGCCAAGTTCCGGAAGAAGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 906528650 1:46511000-46511022 CCAGAAGCAGAAGGAGGCTGAGG 0: 1
1: 0
2: 9
3: 89
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906528642 Original CRISPR GCTTCTTCCGGAACTTGGCC CGG (reversed) Exonic