ID: 906529194

View in Genome Browser
Species Human (GRCh38)
Location 1:46513457-46513479
Sequence CCTCATTCCCAAGATTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906529194 Original CRISPR CCTCATTCCCAAGATTGAGG AGG Exonic
900601325 1:3504027-3504049 TCTCATTCCCCAGATGGAGGTGG + Intronic
901537258 1:9890676-9890698 CCTCATACCCAGGAGTGAGGGGG - Intronic
904285361 1:29450217-29450239 CCACATGCCCCAGATGGAGGAGG - Intergenic
905444327 1:38015535-38015557 CCTTCTTTCCAAGATTGTGGTGG + Intronic
906529194 1:46513457-46513479 CCTCATTCCCAAGATTGAGGAGG + Exonic
908830747 1:68176039-68176061 CTTCGTTCCCATGAATGAGGAGG + Intronic
912549101 1:110473041-110473063 CCTCATTTACAGGATTGTGGTGG + Intergenic
912629313 1:111233372-111233394 CCTCAGTCCCAATTTAGAGGTGG + Intronic
921795444 1:219338278-219338300 CCTCATTCCCAAGTTTTATAAGG - Intergenic
923846181 1:237735292-237735314 CTTCATTGCAAAGATTGAGAGGG + Intronic
1063328743 10:5133583-5133605 CTTCATTCCCAAGATTTACCTGG + Intronic
1067575097 10:47403940-47403962 CCTCCTTCCCCAGAGTGCGGGGG + Intergenic
1067724653 10:48760894-48760916 CCTCATCCCCATCATAGAGGCGG - Intronic
1070635562 10:78124268-78124290 CCTCACACCCAAGATCAAGGTGG + Intergenic
1072990153 10:100185536-100185558 CTCCATCCACAAGATTGAGGAGG - Exonic
1073799116 10:107022084-107022106 CCTCATTTCCAGGATGGAGGAGG + Intronic
1075202092 10:120412858-120412880 CCCCAGTCCTAAGATTGAAGTGG + Intergenic
1075359060 10:121813340-121813362 CCTCTTACCCAAGGTTGAGATGG - Intronic
1075903560 10:126062433-126062455 CATCATCCCCATGATGGAGGGGG - Intronic
1076249314 10:128972690-128972712 CCTCTTTCCCAACACCGAGGAGG - Intergenic
1077009365 11:373350-373372 CCTCATTCCCAAGAGGCTGGTGG - Intronic
1078797142 11:14603453-14603475 CCTCATTGCCCATTTTGAGGAGG - Intronic
1079022405 11:16920079-16920101 CCTCCTTCACAAGGTTGATGGGG + Intronic
1082690982 11:56304415-56304437 GCTAATTCCCATGATTGAGTAGG - Intergenic
1083501857 11:63116017-63116039 CCTACTTCCCAAGCTTGAGGTGG + Intronic
1087377812 11:97366560-97366582 ACTCCATCCCAAGCTTGAGGTGG + Intergenic
1089652713 11:119924978-119925000 CCTCATTCCCAAGATAGAGTCGG + Intergenic
1089703430 11:120259647-120259669 CCTCACTCCTAAGAAGGAGGTGG + Intronic
1092155660 12:6280070-6280092 CCTCATTCCCCACATTGCTGTGG - Intergenic
1094659522 12:32453750-32453772 TCTCATTCTTTAGATTGAGGAGG + Intronic
1100286938 12:93175465-93175487 CCTCACTCCTAAGATTCTGGTGG + Intergenic
1105445719 13:20454843-20454865 CCTTATTCCCAATGTTAAGGAGG - Intronic
1108416840 13:50206196-50206218 CCTCTTTCCCAAGATTGGCCAGG + Intronic
1110351186 13:74509815-74509837 CCTCACTGCCAACATAGAGGAGG + Intergenic
1113893406 13:113748433-113748455 CCTCAGTCCCTCGCTTGAGGGGG - Intergenic
1117296917 14:54388931-54388953 CCTCATTCTCTATATTCAGGGGG - Intergenic
1120732780 14:88021732-88021754 CCTCATTCCCACCATTGGTGGGG - Intergenic
1121091202 14:91184017-91184039 TCTCATTCCCCAGAGTCAGGTGG + Intronic
1125284120 15:38073566-38073588 CCTTTTTCCCAGGAGTGAGGAGG - Intergenic
1125457946 15:39879718-39879740 CCTTATTCCCAACTTCGAGGTGG - Intronic
1127910293 15:63410995-63411017 CCTCTTTCTCCAGATAGAGGAGG - Intergenic
1128783912 15:70380694-70380716 CCACATTCACAATCTTGAGGAGG - Intergenic
1129335975 15:74852425-74852447 CCTCATCCCTAAGCTTGAGTTGG + Intronic
1130145969 15:81273851-81273873 CCTCACTCCCAGGATGGATGAGG - Intronic
1130160845 15:81398424-81398446 CATCCTTCCCAACAATGAGGAGG + Intergenic
1130575831 15:85092553-85092575 CCTAAATGCCAGGATTGAGGTGG - Intronic
1132115552 15:99133007-99133029 CCTCATTGTCTAGATAGAGGAGG - Exonic
1133516766 16:6517050-6517072 TCTCATTCCAAATATAGAGGTGG + Intronic
1136268471 16:29134182-29134204 CCCAACTCCCAAGATTCAGGGGG - Intergenic
1136455221 16:30376424-30376446 CCTCATTCTTCACATTGAGGCGG - Exonic
1140079648 16:71733056-71733078 CCTCATTGCCAGGACTGAGGGGG + Exonic
1144737659 17:17564033-17564055 GCTCCTTCCCAAGACTCAGGAGG - Intronic
1152462708 17:80449838-80449860 CCCCATTCCCCAGGTTGAAGAGG + Intergenic
1152533012 17:80931485-80931507 CCTCACCCAGAAGATTGAGGTGG + Intronic
1153860976 18:9205522-9205544 CCTGGTTACCAAAATTGAGGGGG + Intronic
1160120074 18:76122228-76122250 CCTCATTTCTAAGATAGAGAAGG + Intergenic
1162315321 19:9935320-9935342 TCTCACTCCCAAGATGGAGGAGG + Intronic
1163281750 19:16322741-16322763 CTGCATTTCGAAGATTGAGGAGG + Intergenic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1164210445 19:23093531-23093553 CCCCACCCCCAAGAATGAGGGGG - Intronic
1166125021 19:40709950-40709972 CCTCATGCGGAAGATGGAGGTGG - Intronic
1166292241 19:41870548-41870570 CCTCACTACCATGCTTGAGGTGG - Intronic
926053818 2:9762001-9762023 CTTCCTTGCCAAGATAGAGGTGG - Intergenic
931575794 2:63717143-63717165 CTTCATTTCCAAGAGTCAGGTGG - Intronic
935328948 2:101962299-101962321 CCTCTTTCCCAAGGTGGGGGTGG + Intergenic
935461965 2:103347343-103347365 CCTCATTGCCCCGACTGAGGAGG - Intergenic
937138572 2:119577290-119577312 CCCAATTCCCATGATGGAGGTGG - Intronic
942698523 2:178675936-178675958 GGTCATTCCCAAGAAAGAGGAGG - Exonic
944931392 2:204523806-204523828 CCTCTTTCCCCAGCTTGAGATGG - Intergenic
948961880 2:241345387-241345409 CCTGATCCCCATTATTGAGGGGG + Intronic
1171155034 20:22864229-22864251 CATCATGCCCAAGATAGTGGTGG - Intergenic
1177225964 21:18256630-18256652 CTTCATTCTCAAGGCTGAGGAGG - Exonic
1180170634 21:46056492-46056514 CCTCAGTCCTAACTTTGAGGAGG + Intergenic
1183439853 22:37817012-37817034 CCTCTTTCCCTAGATTAAGATGG + Exonic
950210599 3:11120310-11120332 CCTCATAGCCAAGAATGTGGTGG + Intergenic
957114806 3:76011428-76011450 CCTCACCCCCAAAATTGAAGTGG + Intronic
960135177 3:114097419-114097441 CCTCATGCCCAAGAATGAACAGG + Intergenic
960894597 3:122489400-122489422 CCTAAGTCCCAAGGTTGAGGTGG - Intronic
964482980 3:157160430-157160452 CCTTATACCCAAAATAGAGGTGG + Intronic
966749778 3:183310831-183310853 CCCCATACCAAAGAGTGAGGAGG + Intronic
968676865 4:1886981-1887003 CAACATTCCCAATATTGTGGTGG + Intronic
969332966 4:6490634-6490656 CCACATCCCCTAGAGTGAGGTGG + Intronic
973702007 4:53546730-53546752 CCTCCTTCCCCAGTTTGAAGAGG - Intronic
982910133 4:161130609-161130631 GATCATTCACCAGATTGAGGAGG + Intergenic
989583759 5:43058120-43058142 CCACATTGCCAAGACTGTGGGGG + Intergenic
990070911 5:51781806-51781828 AGTCCTTCCTAAGATTGAGGGGG - Intergenic
992031228 5:72723428-72723450 CCTCCTTTCCATGATTGAGTAGG - Intergenic
992198405 5:74361885-74361907 CATCCTTCCCAAGAGTCAGGTGG + Intergenic
996711796 5:126550944-126550966 TCTCATTCCCTAGCTTGAGACGG - Intronic
997824049 5:137090704-137090726 CCACAATCCCAAGCTTCAGGAGG + Intronic
999075132 5:148788462-148788484 CCTCATTCCCAGGACAGATGAGG + Intergenic
999974147 5:156894127-156894149 CTTCATTACCAAGCCTGAGGTGG - Intergenic
1000002241 5:157150099-157150121 CCTCATGCACAAAATTAAGGAGG + Intronic
1002121212 5:177006280-177006302 GGTCCTTCCCAAGGTTGAGGTGG - Exonic
1002496948 5:179622362-179622384 CCATTTTCTCAAGATTGAGGAGG + Intronic
1006457621 6:34141002-34141024 CCTGATTCCTAAGCTTGTGGAGG - Intronic
1006668791 6:35716847-35716869 GCTCAATCCCAAGGTTGATGTGG - Intronic
1009226555 6:61025140-61025162 TATCATTCCCAATATTGAAGGGG + Intergenic
1013356505 6:109350149-109350171 CCTAATTCCCAGGATTGGGGTGG + Intergenic
1018466541 6:164051701-164051723 GCTCTTTCCCAAGGTTGATGAGG + Intergenic
1027451179 7:78333559-78333581 CCTCATTCCATTGATTTAGGTGG - Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030938296 7:115614133-115614155 CCTCATCTCCAGGATTCAGGTGG + Intergenic
1032787877 7:135215227-135215249 CTTCATTCCCAAGATCTTGGAGG - Intergenic
1037566125 8:20119874-20119896 CCTCATTCAACAGATTTAGGAGG - Intergenic
1042449304 8:68925863-68925885 CCTCATTCTTGAAATTGAGGTGG - Intergenic
1047243196 8:123113145-123113167 CTTCATTCCCTACAGTGAGGGGG - Intronic
1053875390 9:42540170-42540192 ACTCATTCAGAAGATTGAAGAGG - Intergenic
1054236310 9:62561554-62561576 ACTCATTCAGAAGATTGAAGAGG + Intergenic
1056728332 9:89142181-89142203 AGTCATTCCTAAGATTTAGGGGG - Intronic
1057141179 9:92727649-92727671 CCCCATCACCAAGATGGAGGTGG - Intronic
1058107576 9:100990299-100990321 CCTCATCCACAAAATAGAGGTGG - Intergenic
1058300418 9:103364635-103364657 GCTCATTACCAATATTCAGGGGG - Intergenic
1061200391 9:129134948-129134970 CCCCATTTCCCAGTTTGAGGAGG - Intronic
1189212850 X:39299393-39299415 CCTCATTTCCAAGCTTTTGGTGG + Intergenic
1193902551 X:87200139-87200161 CCTCATCCCCCAGAAGGAGGTGG - Intergenic
1196493652 X:116297812-116297834 CCTCATTCCCAAGAAAAAAGGGG - Intergenic
1198189669 X:134289380-134289402 ACTCTTCCCCAAAATTGAGGAGG - Intergenic
1200073961 X:153542193-153542215 CCTCGTTCCCCAGAAGGAGGAGG + Intronic