ID: 906530728

View in Genome Browser
Species Human (GRCh38)
Location 1:46522510-46522532
Sequence CTCCCCGGCCTGGAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906530728_906530736 11 Left 906530728 1:46522510-46522532 CCAGCTCCTTCCAGGCCGGGGAG No data
Right 906530736 1:46522544-46522566 CTCACCCATGTCTCCCGCTGCGG No data
906530728_906530737 12 Left 906530728 1:46522510-46522532 CCAGCTCCTTCCAGGCCGGGGAG No data
Right 906530737 1:46522545-46522567 TCACCCATGTCTCCCGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906530728 Original CRISPR CTCCCCGGCCTGGAAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr