ID: 906532165

View in Genome Browser
Species Human (GRCh38)
Location 1:46530194-46530216
Sequence TACTCCCCAGGGCCTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906532165_906532172 -7 Left 906532165 1:46530194-46530216 CCGCCCCCAGGCCCTGGGGAGTA No data
Right 906532172 1:46530210-46530232 GGGAGTACCCCTCCTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906532165 Original CRISPR TACTCCCCAGGGCCTGGGGG CGG (reversed) Intergenic
No off target data available for this crispr