ID: 906532825

View in Genome Browser
Species Human (GRCh38)
Location 1:46533221-46533243
Sequence GGCCGCGGCGGGCCCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906532825_906532837 7 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532837 1:46533251-46533273 GCCCACGGGGCGCGAGGCCCCGG No data
906532825_906532844 26 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532844 1:46533270-46533292 CCGGCGGCTACACACGCAGCAGG No data
906532825_906532836 1 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532836 1:46533245-46533267 CCGAGCGCCCACGGGGCGCGAGG No data
906532825_906532831 -8 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532831 1:46533236-46533258 CCGCGGCCGCCGAGCGCCCACGG No data
906532825_906532832 -7 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532832 1:46533237-46533259 CGCGGCCGCCGAGCGCCCACGGG No data
906532825_906532833 -6 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532833 1:46533238-46533260 GCGGCCGCCGAGCGCCCACGGGG No data
906532825_906532840 10 Left 906532825 1:46533221-46533243 CCTGGCCCGGGCCCGCCGCGGCC No data
Right 906532840 1:46533254-46533276 CACGGGGCGCGAGGCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906532825 Original CRISPR GGCCGCGGCGGGCCCGGGCC AGG (reversed) Intergenic
No off target data available for this crispr