ID: 906535787

View in Genome Browser
Species Human (GRCh38)
Location 1:46550342-46550364
Sequence CTGAGGACAAGCACCCAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906535787_906535789 2 Left 906535787 1:46550342-46550364 CCGGACTGGGTGCTTGTCCTCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906535789 1:46550367-46550389 TGTTCCTCCCCACCCAGACCTGG 0: 1
1: 0
2: 5
3: 32
4: 495
906535787_906535791 4 Left 906535787 1:46550342-46550364 CCGGACTGGGTGCTTGTCCTCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906535791 1:46550369-46550391 TTCCTCCCCACCCAGACCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 338
906535787_906535795 10 Left 906535787 1:46550342-46550364 CCGGACTGGGTGCTTGTCCTCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906535795 1:46550375-46550397 CCCACCCAGACCTGGGGAGCAGG 0: 1
1: 0
2: 3
3: 55
4: 451
906535787_906535790 3 Left 906535787 1:46550342-46550364 CCGGACTGGGTGCTTGTCCTCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906535790 1:46550368-46550390 GTTCCTCCCCACCCAGACCTGGG 0: 1
1: 0
2: 2
3: 35
4: 322
906535787_906535799 18 Left 906535787 1:46550342-46550364 CCGGACTGGGTGCTTGTCCTCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 906535799 1:46550383-46550405 GACCTGGGGAGCAGGAGCAGTGG 0: 1
1: 0
2: 7
3: 81
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906535787 Original CRISPR CTGAGGACAAGCACCCAGTC CGG (reversed) Intronic
900084928 1:888275-888297 CTGAGCCCAAGCACCCTGTGGGG - Intergenic
900918490 1:5655764-5655786 CTGAGCCCAAGCACCCTGTGGGG - Intergenic
902581364 1:17409758-17409780 GTGAGGACAGCCACCCAGCCTGG + Intronic
902758232 1:18563631-18563653 GTGAGAACATGCACCCACTCTGG - Intergenic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905203684 1:36330580-36330602 CAGAAGGCAACCACCCAGTCAGG - Intergenic
905321020 1:37117443-37117465 CTGAGGACACACACCCACGCAGG + Intergenic
905677007 1:39833544-39833566 CTGAGGCCCATCAGCCAGTCTGG - Intergenic
906013973 1:42556427-42556449 CAGAGGAAACGAACCCAGTCAGG - Intronic
906111026 1:43321974-43321996 CAGAGGACAGGCAAGCAGTCTGG - Intronic
906535787 1:46550342-46550364 CTGAGGACAAGCACCCAGTCCGG - Intronic
906942120 1:50264676-50264698 CAGATGACAAGCAAACAGTCTGG + Intergenic
907221215 1:52908041-52908063 CTGAGGACAGGCAGCCAGCGAGG + Intronic
907311969 1:53543959-53543981 CTGAGGAGAAGCACGCTGTGAGG + Intronic
908771219 1:67598233-67598255 CTGAGGACAAGCAGACGCTCTGG + Intergenic
911580126 1:99624654-99624676 GTGAGGATCAGCACCCAGTGGGG - Intergenic
917510090 1:175662524-175662546 CTGATGCCTAGCACCCAGCCAGG - Intronic
918161068 1:181900232-181900254 CTGACAACATGCACCCAGTGTGG - Intergenic
919418581 1:197342006-197342028 TTGAGGAAAAGCAAACAGTCTGG + Intronic
920186526 1:204162718-204162740 CAGGGGACAGGCACCCAGCCAGG + Intronic
920274298 1:204792601-204792623 CTGAGGTCATGCAGCCAGTGTGG - Intergenic
920654433 1:207865184-207865206 CTGAAGACAGGGACCCACTCTGG + Intergenic
921175044 1:212586095-212586117 CTGAGGACAGACTCACAGTCTGG - Intronic
921900856 1:220449146-220449168 CTGAGAGTAAGCAGCCAGTCTGG - Intergenic
922583593 1:226717500-226717522 CTGAGGACCAGGCCCCACTCTGG - Intronic
1064566209 10:16641577-16641599 ATTAGGACAAGCACACAGCCAGG + Intronic
1067662995 10:48250349-48250371 CTGAGGGCAGGTACCCAGTGAGG - Intronic
1067710740 10:48649330-48649352 GTGAGGACAACCACAGAGTCAGG + Intronic
1067878616 10:50025092-50025114 ATGGGGACAAGCGTCCAGTCAGG + Intergenic
1074014568 10:109521049-109521071 CTGAGGAAAATGACCCAGTAAGG + Intergenic
1074040219 10:109780839-109780861 GAGAGTACAAGGACCCAGTCAGG + Intergenic
1076098367 10:127753027-127753049 CTGAGGACAACCAGCCTCTCAGG - Intergenic
1076199466 10:128546903-128546925 CTGAGGACAGGCACTGAGCCAGG - Intergenic
1077989859 11:7396042-7396064 CTGAGGACAAGCAATCACTAAGG - Intronic
1079990547 11:27241988-27242010 CTTAAAACAAACACCCAGTCAGG - Intergenic
1080724329 11:34880474-34880496 CTGAGGATTAGCTCCCAGCCTGG + Intronic
1081653309 11:44839940-44839962 CTGAGGACAGCCACCCACCCTGG - Intronic
1085576711 11:77611569-77611591 ATGAGGACAAGCATCCATTGAGG - Intronic
1086074996 11:82841167-82841189 CTGGGGACATGCTCCCAGTCAGG + Intronic
1088359095 11:108972600-108972622 CTGAGGACGACCACCCAATAGGG - Intergenic
1089368840 11:117939135-117939157 ATGAGGACACGCACAGAGTCAGG - Intergenic
1091202778 11:133794954-133794976 CTGAGGTCAAGCACGGTGTCCGG - Intergenic
1092228450 12:6764162-6764184 CTGAGGCCCAGCCCACAGTCCGG + Intronic
1096621261 12:52867126-52867148 CTGAGGACAACCATCCCTTCTGG + Intergenic
1098909982 12:76199076-76199098 CAGTGGACAAGAACCCTGTCAGG + Intergenic
1100632343 12:96400728-96400750 CTGCGGACAGGCACTCATTCCGG - Intergenic
1101221983 12:102651067-102651089 CTGAAGACGAGCAACCAGTGAGG + Intergenic
1101779216 12:107820802-107820824 CTGAGGACCTGCACCGACTCTGG - Intergenic
1102429212 12:112868560-112868582 CTGAGCCCAAGCACCCTGCCCGG + Exonic
1102433584 12:112902549-112902571 CTGAGGACAGGCCCCCTGACTGG + Intergenic
1103862293 12:124024927-124024949 CTGAGGACATGCTCCCAGGGGGG + Intronic
1110158778 13:72351080-72351102 CTGAGGAAAAGCAGTGAGTCAGG - Intergenic
1111042650 13:82770335-82770357 TTGAAGAAAAGGACCCAGTCTGG - Intergenic
1111285933 13:86091777-86091799 CTGAGAACAACCACCTTGTCAGG + Intergenic
1114991696 14:28296602-28296624 CTGAGCAGAACCTCCCAGTCAGG - Intergenic
1115443895 14:33467161-33467183 CTGAGGGCATGCACACAGGCGGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1119904901 14:78292854-78292876 CCTAGGACAAGCACCCTGGCTGG - Intronic
1120821572 14:88916109-88916131 CAGAGGAGAAGCAGCCACTCTGG - Intergenic
1121086939 14:91153856-91153878 CTGAGGACATGCACCCAAGGTGG + Intronic
1121645204 14:95513813-95513835 ATGAAGACAAGCATCCTGTCCGG + Intergenic
1125768839 15:42152068-42152090 CAGAGGACAGCCACCCAGGCAGG - Intronic
1129767913 15:78182006-78182028 CTGTGGACAGGCATCCAGTGGGG - Exonic
1131076507 15:89498671-89498693 CTGAGGCTAAGCACCTAATCAGG + Intergenic
1133119144 16:3595620-3595642 CGCAGGACAAGCACCCGGACAGG - Exonic
1134422981 16:14111894-14111916 CTGAGCACAAGCACACACCCAGG - Intronic
1137667880 16:50262233-50262255 CTGAGGAGAAGTACCCAGCAGGG - Intronic
1137803563 16:51283371-51283393 CTGAGGGCAGGCACCAGGTCTGG + Intergenic
1141703117 16:85651416-85651438 CTGAGGACAAACAGGGAGTCCGG - Intronic
1143174412 17:4948139-4948161 TCCAGGGCAAGCACCCAGTCAGG + Intronic
1143281421 17:5757582-5757604 CTGAGGACAAGCATCTTGTGGGG + Intergenic
1143634082 17:8154487-8154509 CCCAGGACATGCACCCAGCCTGG + Intronic
1145262582 17:21363770-21363792 CTGAGGACAGGCACCCTGTGTGG + Intergenic
1145907367 17:28523907-28523929 GTGAGGACCAGCATCCAGTGGGG - Intronic
1146398821 17:32487971-32487993 CTGAGGAGGAGCCCCCGGTCTGG - Exonic
1147813272 17:43189076-43189098 CTCAAGACAAGCCCCCAGACTGG + Exonic
1148890004 17:50800434-50800456 CTGAGGCCAAGGACACAGGCAGG + Intergenic
1152260195 17:79262654-79262676 CTGTGGACAAGCCCACAGGCAGG + Intronic
1153242671 18:3044916-3044938 TTGAGGATAAGCAACAAGTCTGG + Intergenic
1156168936 18:34458494-34458516 CTGAAGCCAAGAACCCTGTCTGG - Intergenic
1159942015 18:74415376-74415398 GTGAGGAGATGCACCCAGCCCGG - Intergenic
1161968468 19:7561887-7561909 GTGGGGACAAGCACCTAGTGGGG - Intergenic
1164523709 19:28998356-28998378 CGAAGGACAAGCATCCAGGCAGG + Intergenic
1166075204 19:40410217-40410239 GTGAGGACAAGCCCAGAGTCGGG - Intronic
1166284378 19:41814840-41814862 CCAGTGACAAGCACCCAGTCTGG + Intergenic
1167218087 19:48178388-48178410 CTGGGGAGAATCACCCAGTTGGG + Intronic
1168445197 19:56405619-56405641 CAGAGGACAAGCAGCCAGCGTGG - Intronic
932562773 2:72887529-72887551 CTAAGGACAAGCACGGAGCCGGG - Exonic
934718108 2:96554809-96554831 CTGAGGACAAGTACCAGGGCTGG + Intergenic
942749860 2:179275481-179275503 CTGAGGAGAAACAGCCAGTGAGG + Intergenic
942793851 2:179793024-179793046 TTGAGGAAAAGCATCCATTCTGG + Intronic
943747836 2:191480451-191480473 ATGAGAACAAGCAGCCAGCCAGG - Intergenic
1169387402 20:5162779-5162801 CTGAGAAAGAGCAGCCAGTCAGG + Intronic
1169391618 20:5195633-5195655 CTGAGGACATCCACCCATACAGG - Exonic
1171484778 20:25478802-25478824 CAGAGGAAAACCACCCAGTCGGG + Intronic
1171774578 20:29353256-29353278 CTGAGCCCAAGCACCCTGTGGGG + Intergenic
1171816597 20:29790882-29790904 CTGAGCTCAAGCACCCTGTGGGG + Intergenic
1174644995 20:52078136-52078158 CTGAGGTCAAGCAACTTGTCAGG - Intronic
1176416498 21:6478516-6478538 CAGAGGAGAAGCACACAGACAGG - Intergenic
1179631883 21:42683885-42683907 AGGAGGAGAAGCACCCAGTGGGG + Intronic
1179691998 21:43086851-43086873 CAGAGGAGAAGCACACAGACAGG - Intergenic
1180002917 21:45003155-45003177 CTGAGGACAAGGAGACAGCCTGG - Intergenic
1180124388 21:45779024-45779046 CTGAGGATAAGAACCAAGTGAGG - Intronic
1180320061 22:11311490-11311512 CTGAGCCCAAGCACCCTGTGGGG + Intergenic
1180611624 22:17101883-17101905 CTGCGGACAGGCTCCCAGTGGGG + Intronic
1181530181 22:23512937-23512959 CTGGGGACAAGGGCCCAGCCGGG + Intergenic
1182520323 22:30881261-30881283 CTGAGGACAATCAACCTGACAGG + Intronic
1182675974 22:32040344-32040366 CTGGGGAGAAGCTCCCAGGCTGG + Intergenic
1184034204 22:41910865-41910887 CTGAGGAACAGAACCCAGACGGG + Intronic
1184550842 22:45203405-45203427 CTGAGGACAGGGCCCCAGGCTGG + Intronic
1184963158 22:47946361-47946383 CAGAGGGCCAGCACCCAGCCAGG - Intergenic
950682032 3:14592179-14592201 CTGAGCTCAAGGACCCAGCCTGG - Intergenic
952867574 3:37864045-37864067 CTGAGGGCACACACCCAGCCAGG - Intronic
953042741 3:39269319-39269341 CTGAGCCCAAGCACCCAGTAAGG - Intronic
957022125 3:75138625-75138647 CTGGGGAAAAATACCCAGTCTGG + Intergenic
957977648 3:87468239-87468261 TTGAGGGCAAGCACTGAGTCTGG + Intergenic
961006874 3:123411416-123411438 CCGAGGACAGGCCCCCAGCCCGG - Intronic
968815815 4:2821120-2821142 CAGAGGTCCAGCACCCAGCCAGG - Intronic
969250575 4:5965662-5965684 GTGAGAACAGGCACCAAGTCAGG + Intronic
973775260 4:54235845-54235867 CACAGGGCAAGCAACCAGTCAGG + Intronic
974061176 4:57037569-57037591 CTGAGGACAAGCACTCAGGGAGG + Intronic
977660418 4:99579107-99579129 CTGTGTCCAAGCACCAAGTCAGG - Intronic
977965136 4:103137240-103137262 ATGAGGTAAAGCACCCAGTATGG + Intronic
978109262 4:104943045-104943067 CTGGGGACATGCAACCAGTCTGG + Intergenic
978303624 4:107297576-107297598 CTGTAGAGAAGCACACAGTCTGG + Intergenic
982158548 4:152544371-152544393 CTGGGGTCAAGCACTGAGTCTGG - Intergenic
986169406 5:5303537-5303559 GTCAGGATAAGCACCCAGTGAGG - Intronic
986362170 5:6989548-6989570 CTGAGGGCATTCACCCAGTGAGG + Intergenic
987123950 5:14793588-14793610 CAAAGGACAAGCAGCCAGGCCGG + Intronic
987694624 5:21311803-21311825 CTCAGGAAAAACACCAAGTCTGG + Intergenic
995153738 5:108884604-108884626 GTGAGCACAAGGACCCAGTTGGG - Intronic
997737928 5:136228193-136228215 CTGAGGCCACTGACCCAGTCTGG + Intronic
1000987280 5:167874839-167874861 TTGAGGAGGAGCAGCCAGTCCGG - Intronic
1002573689 5:180159626-180159648 CTGCGGACAAGCTCGCAGTGGGG + Intronic
1003028534 6:2580019-2580041 ATTAGGACAAGGAGCCAGTCTGG - Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1005556277 6:26988136-26988158 CTCAGGAAAAACACCAAGTCTGG - Intergenic
1006056397 6:31387971-31387993 CTGAGGAGGAGCAGCCAGTTGGG - Intergenic
1007052427 6:38846015-38846037 CAGAGGACAAGATGCCAGTCTGG - Intronic
1008178014 6:48291966-48291988 TTGAGGAGAAGCTCACAGTCTGG + Intergenic
1011779239 6:90768415-90768437 CTGTAGACAAGGACCCACTCAGG - Intergenic
1012846331 6:104394122-104394144 CTGAGTAGGAGCAGCCAGTCAGG + Intergenic
1018007102 6:159632406-159632428 CTTAGGTCAAGCACGCAGGCAGG - Intergenic
1018033465 6:159862760-159862782 CTGAGGCCCAGGACCCATTCAGG + Intergenic
1018227669 6:161644794-161644816 TTGAGGACATGCACCCAGGCAGG + Intronic
1022498494 7:30867986-30868008 CTGAGGTCACTCACCCAGTCAGG + Intronic
1022628921 7:32066998-32067020 CTGAGGACCAGCACCCTCCCTGG + Intronic
1034579599 7:152031140-152031162 CCAAGGACCAGCACCCAGTCAGG - Intronic
1034877393 7:154737619-154737641 CTGTGGACAAACAACCAGTAGGG + Intronic
1035269604 7:157711668-157711690 CTGAGGACAAGCCCCCGGGGTGG + Intronic
1036406015 8:8455833-8455855 CTGAGGACAGGCACCCAGGGTGG - Intergenic
1037993769 8:23338705-23338727 CTGAGGACCACCACCCTGCCCGG - Intronic
1040383193 8:46893013-46893035 CACTGGACAAGCACCCACTCAGG - Intergenic
1044780381 8:95737650-95737672 CTGAGTAAAAGAAGCCAGTCAGG - Intergenic
1045427070 8:102077790-102077812 CCGAGGAGCAGCAGCCAGTCAGG - Intronic
1046655276 8:116887302-116887324 CTGAGGCCAAGTACCCATTGAGG + Intergenic
1049845727 8:144800014-144800036 CTGAGGAGAAACTCCCAGGCGGG + Intronic
1051388791 9:16540881-16540903 CTGAGGAAAAGCACTAAATCAGG + Intronic
1053101772 9:35377344-35377366 CTGAGAACTAGCAACCAGGCTGG + Intronic
1054768274 9:69060918-69060940 CAGGGGACAAGCAAGCAGTCAGG + Intronic
1056531499 9:87492271-87492293 CTGAGGAAAAGGACACAGTCCGG - Intergenic
1056936596 9:90919506-90919528 CAAAGGACGAGCACCCAGGCTGG - Intergenic
1060912561 9:127362561-127362583 CCGTGGAGAAGCTCCCAGTCTGG + Intronic
1061145306 9:128794239-128794261 CTGAGGAGCAGCACCCAGGGTGG - Intronic
1062022381 9:134325796-134325818 CAGAGGACAAGCTCCTCGTCCGG - Intronic
1062712511 9:137984310-137984332 CTGGGGACAAGCACCCTGTGTGG - Intronic
1203368283 Un_KI270442v1:277242-277264 CTGAGCCCAAGCACCCTGTGGGG + Intergenic
1195753991 X:108182931-108182953 CTGAGGACAGGCATCCAGAAAGG + Intronic
1195756543 X:108204466-108204488 CAGAGGACAAACCCCCACTCTGG - Intronic
1201070415 Y:10143066-10143088 CTGAGCACAAGAACCCTGTGGGG - Intergenic
1201913365 Y:19156308-19156330 ATGAGGAACTGCACCCAGTCAGG - Intergenic