ID: 906536597

View in Genome Browser
Species Human (GRCh38)
Location 1:46554307-46554329
Sequence CCTCCACCCCTCCCAAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906536587_906536597 9 Left 906536587 1:46554275-46554297 CCAAGGCACCAGGGCTCCATCGC No data
Right 906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG No data
906536582_906536597 27 Left 906536582 1:46554257-46554279 CCATGCTGAGAGGGAGGCCCAAG No data
Right 906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG No data
906536588_906536597 1 Left 906536588 1:46554283-46554305 CCAGGGCTCCATCGCCCCACCAA No data
Right 906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG No data
906536586_906536597 10 Left 906536586 1:46554274-46554296 CCCAAGGCACCAGGGCTCCATCG No data
Right 906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG No data
906536589_906536597 -7 Left 906536589 1:46554291-46554313 CCATCGCCCCACCAACCCTCCAC No data
Right 906536597 1:46554307-46554329 CCTCCACCCCTCCCAAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906536597 Original CRISPR CCTCCACCCCTCCCAAGGAT TGG Intergenic
No off target data available for this crispr