ID: 906536699

View in Genome Browser
Species Human (GRCh38)
Location 1:46554775-46554797
Sequence CCCCATGAATAGTGGTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906536699_906536710 7 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536710 1:46554805-46554827 TGGGAGGGCAGTCGGCCAGGAGG No data
906536699_906536713 14 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536713 1:46554812-46554834 GCAGTCGGCCAGGAGGGAGGAGG No data
906536699_906536709 4 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536709 1:46554802-46554824 GTGTGGGAGGGCAGTCGGCCAGG No data
906536699_906536711 8 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536711 1:46554806-46554828 GGGAGGGCAGTCGGCCAGGAGGG No data
906536699_906536712 11 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536712 1:46554809-46554831 AGGGCAGTCGGCCAGGAGGGAGG No data
906536699_906536707 -8 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536707 1:46554790-46554812 TCATGGGGCTGGGTGTGGGAGGG No data
906536699_906536706 -9 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536706 1:46554789-46554811 TTCATGGGGCTGGGTGTGGGAGG No data
906536699_906536708 -1 Left 906536699 1:46554775-46554797 CCAAGGCACCACTATTCATGGGG No data
Right 906536708 1:46554797-46554819 GCTGGGTGTGGGAGGGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906536699 Original CRISPR CCCCATGAATAGTGGTGCCT TGG (reversed) Intergenic
No off target data available for this crispr