ID: 906539328

View in Genome Browser
Species Human (GRCh38)
Location 1:46572964-46572986
Sequence GCCAACAAAACAATAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906539328_906539330 22 Left 906539328 1:46572964-46572986 CCATTCATTATTGTTTTGTTGGC 0: 1
1: 1
2: 2
3: 38
4: 334
Right 906539330 1:46573009-46573031 GTTACTAGTGCCATGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906539328 Original CRISPR GCCAACAAAACAATAATGAA TGG (reversed) Intronic
905844896 1:41221057-41221079 GCCAAAAGAACAATACTAAATGG + Intronic
906364217 1:45191801-45191823 TCCAATAAAACAAAAAGGAAAGG - Intronic
906539328 1:46572964-46572986 GCCAACAAAACAATAATGAATGG - Intronic
906672497 1:47666636-47666658 TCCAACAAAACCCAAATGAATGG + Intergenic
908274225 1:62453068-62453090 GCCAAATGAACAATAAGGAAAGG - Intergenic
908434057 1:64087515-64087537 GCCATCAAAACAGAAATAAATGG - Intronic
908556395 1:65260931-65260953 AGCAAAAAAACAAAAATGAAAGG - Intronic
909027629 1:70501447-70501469 CTCAAAAAAACAATAAAGAAAGG + Intergenic
909541105 1:76792368-76792390 GCCATAAAAACAATGCTGAATGG - Intergenic
909817481 1:80014649-80014671 ATCACCAAAACAATGATGAAGGG + Intergenic
909926953 1:81448703-81448725 ACAAACAAAAAAACAATGAAAGG + Intronic
910005626 1:82393175-82393197 GCTAACAAAACAGCAATGAAGGG - Intergenic
910089035 1:83440298-83440320 GCCCATAAAATAAGAATGAATGG + Intergenic
910122099 1:83801436-83801458 AACAACAAAAAAAGAATGAAAGG + Intergenic
910313183 1:85851351-85851373 GCCACCAAAACATTAACCAACGG - Intronic
910581558 1:88832108-88832130 GCCAACAAAATTAGACTGAAAGG - Intronic
911213629 1:95168164-95168186 TCCAAGAAATCTATAATGAATGG - Intronic
911976582 1:104504675-104504697 GCCAACAAGACAAAAATAATTGG - Intergenic
912028578 1:105209319-105209341 GCCAGCAAAACAATAATAGTGGG + Intergenic
912091666 1:106083828-106083850 GCCAACAACACTATAATTCATGG + Intergenic
912901876 1:113659953-113659975 GCCAAAAACAGAATTATGAAGGG + Intronic
913102670 1:115583857-115583879 GCCAACAGAACAAAACTGAATGG - Intergenic
914264672 1:146028113-146028135 TACAACAAAAAAATAATGAAGGG - Intergenic
914945316 1:152060356-152060378 GCCAAGAACTCAATAATGATGGG - Intergenic
915814546 1:158952537-158952559 GCCAAAATAACAAAGATGAATGG - Intronic
916580145 1:166099807-166099829 GACAACAACACAATAATGGTAGG + Intronic
916687891 1:167164096-167164118 ACCAACAAAAGAATAATGTAAGG - Intergenic
917560331 1:176145799-176145821 GGCAGCAAAACATTAAAGAAAGG + Intronic
917627506 1:176861259-176861281 GTTAACTAAAAAATAATGAACGG + Exonic
919287067 1:195577616-195577638 GTACACAAAACAATAATGAATGG - Intergenic
920297218 1:204966253-204966275 CCCAGCAAAGCAATAATGATGGG - Intronic
920346214 1:205307236-205307258 GCCAATAAAACCATAAACAAAGG - Intronic
920778355 1:208963364-208963386 GCAAACAAAACAATCATTAAAGG - Intergenic
920886141 1:209930227-209930249 CCCAACAAAATAATAATTCAAGG - Intergenic
921519571 1:216143075-216143097 AGCAACAAAAAAATGATGAAGGG - Intronic
921829993 1:219717227-219717249 GACAATAAAACCAAAATGAAGGG + Intronic
1063194230 10:3726249-3726271 TCCAAAAAAAAAAAAATGAAAGG - Intergenic
1063241413 10:4173945-4173967 GCAAAAGAAACAATTATGAAGGG - Intergenic
1063739178 10:8797967-8797989 GACAACAAAGCGAGAATGAAAGG + Intergenic
1064523105 10:16224269-16224291 CACAACAAAACAATAGGGAAAGG - Intergenic
1065863841 10:29895924-29895946 GAAAAAAAAACAACAATGAAGGG + Intergenic
1066452786 10:35546580-35546602 GCCAATAAAACTATAGTCAAGGG - Intronic
1066773201 10:38863879-38863901 TCCAACAGAATAATATTGAATGG + Intergenic
1067947449 10:50698950-50698972 TCCAACAAAACAAAAAGGAAAGG + Intergenic
1068028042 10:51673216-51673238 GCCAACAAATAAAATATGAAAGG + Intronic
1068071486 10:52202038-52202060 GGCAAGAAAAAAAAAATGAAAGG - Intronic
1068172665 10:53416292-53416314 GCAAACAAAAACATAAAGAAAGG - Intergenic
1069437219 10:68395896-68395918 TCTAACAGAACAAGAATGAATGG + Intronic
1070355094 10:75632008-75632030 GCCAACAAAATAATAGGGAAAGG - Intronic
1070882762 10:79863937-79863959 TCCAACAAAACAAAAAGGAAAGG + Intergenic
1071649327 10:87380239-87380261 TCCAACAAAACAAAAAGGAAAGG + Intergenic
1072416915 10:95255600-95255622 CTCAACAAAACAGGAATGAAAGG + Intronic
1072815304 10:98502426-98502448 GCAAACAAAAAAATAAAGAGGGG + Intronic
1072868430 10:99089188-99089210 GCAACCAAAACAAAAATAAATGG - Intronic
1073164364 10:101431507-101431529 GTCAAGAAAACAATCATGTATGG - Intronic
1074037166 10:109751794-109751816 GACAACAAAACAATAATAGTAGG - Intergenic
1074075236 10:110117208-110117230 ACCAACAAAGCAAAAATTAAAGG - Intronic
1077964695 11:7116894-7116916 GTCAACAAAAAAATTATCAAAGG - Intergenic
1079179500 11:18176865-18176887 GCCTACAAAATAGTCATGAATGG - Intronic
1079403139 11:20122467-20122489 GTCAAAAAAATAATAAAGAAGGG + Intergenic
1079587264 11:22141429-22141451 TTCAACAACACAATAATGATAGG - Intergenic
1080761958 11:35259485-35259507 GCCAACAAATCCTTAATGATTGG - Exonic
1081700615 11:45150266-45150288 GCCAAGAAAGCTATAAAGAAGGG - Intronic
1082682753 11:56197673-56197695 GCCAATAAATAAATAAGGAATGG + Intergenic
1082972123 11:59034692-59034714 GCCAGAAAAACAAAAATTAAGGG - Intronic
1086591386 11:88518961-88518983 GGCCACAAAACAAAAATGTATGG - Intronic
1087769734 11:102195298-102195320 TCAAACAATACAATCATGAATGG - Intronic
1088406329 11:109483398-109483420 GACAACATAAAAATAATAAAGGG + Intergenic
1089910598 11:122096181-122096203 ACTAACAAAAAAAAAATGAATGG - Intergenic
1090132880 11:124163142-124163164 TCCAACAGGACAATAAAGAATGG - Intergenic
1090895293 11:130966911-130966933 ACCAACAAAACACTACTGAAAGG - Intergenic
1090944535 11:131418201-131418223 GTCAACAAAGCAATTTTGAATGG + Intronic
1091147504 11:133292442-133292464 AACAACAAAATAATATTGAAGGG - Intronic
1091951685 12:4598068-4598090 ACAAACAAAAAAAGAATGAATGG + Intronic
1092663131 12:10761451-10761473 GACAACAATACAATAATAGAAGG - Intergenic
1093128482 12:15359316-15359338 ATCAATAAAACAATAATGAAAGG - Intronic
1093160689 12:15742793-15742815 GCCAATAATACCATATTGAATGG + Intronic
1095121951 12:38430043-38430065 AGAAACAAAATAATAATGAAGGG + Intergenic
1095701461 12:45195075-45195097 GCCAGTAAAAAAATAATGAATGG + Intergenic
1096035135 12:48460299-48460321 CCAAACAAAACTATAAAGAAAGG + Intergenic
1096430127 12:51536104-51536126 GCCAAGAATATAGTAATGAAAGG - Intergenic
1096918837 12:55062145-55062167 GCCAAAGAAACAAGAAAGAAGGG - Intergenic
1097019552 12:56010178-56010200 GTCAACAGACCAATAAAGAAAGG - Intronic
1100599684 12:96102666-96102688 GCAAACCAAACACTAATTAATGG + Intergenic
1102498908 12:113337872-113337894 GCCAACAATGGAATAATTAATGG - Intronic
1102674836 12:114650347-114650369 GCCAACTAAACACTAATTCAAGG + Intergenic
1102996503 12:117355481-117355503 GCAAATTAAACAATATTGAATGG + Intronic
1104162942 12:126198203-126198225 GTCAAAACAACAACAATGAATGG - Intergenic
1107520613 13:41176980-41177002 GTCAAGAGAACAATAAGGAAGGG - Intergenic
1107570374 13:41651160-41651182 GCCAACAAAAAAAAAAGCAATGG + Intronic
1108147471 13:47494703-47494725 GCTAACAAATCAATAATGACAGG + Intergenic
1108368548 13:49743576-49743598 GCCAAAAAAAAAAAAAAGAAAGG + Intronic
1108417633 13:50215157-50215179 GACAACAGCACAATAGTGAAGGG + Intronic
1111409562 13:87856643-87856665 AACAACAAAACAATAAAGAGAGG + Intergenic
1113572296 13:111366967-111366989 GCCAGCAACCCAAGAATGAAAGG + Intergenic
1114035694 14:18625127-18625149 GACAATAAGACAATAATGAGTGG - Intergenic
1114122943 14:19689895-19689917 GACAATAAGACAATAATGAGTGG + Intergenic
1115116926 14:29891681-29891703 GCAAACAAAACAATCTAGAAAGG - Intronic
1115487148 14:33922159-33922181 GCCAACAGAGCAAGAATGAGTGG - Intergenic
1116687348 14:48056816-48056838 ACCTATAAAACATTAATGAAAGG + Intergenic
1118241507 14:64063731-64063753 ACCACCAACACAATATTGAAAGG - Intronic
1120546199 14:85814275-85814297 GCCAACCAAACACAAATAAATGG - Intergenic
1120777980 14:88458573-88458595 GGCAATAAAAAAATGATGAAGGG - Intronic
1120804683 14:88734303-88734325 GCTAACAAATGAATAATGAGTGG + Intronic
1123704318 15:22940051-22940073 CCCAACAATACAATACTGCAAGG + Intronic
1126482972 15:49147367-49147389 GCCAAGAAACCAAAAATAAATGG - Intronic
1126642668 15:50843338-50843360 GCCAACATCACCATACTGAATGG + Intergenic
1127310952 15:57752056-57752078 ACAAACAAAAAAAGAATGAAAGG + Intronic
1129774517 15:78227341-78227363 GCCTACAAATCAATAATAAAAGG + Intronic
1130561093 15:84959789-84959811 ACAAACAAAACAAAAAGGAATGG - Intergenic
1130910301 15:88266139-88266161 ATCAACAAATCAATAATTAAGGG + Intergenic
1132061281 15:98694295-98694317 GCCAGGAACACAAGAATGAATGG - Intronic
1135495326 16:22946676-22946698 CCTAACAAAACAATGATGCATGG + Intergenic
1135889075 16:26341193-26341215 GCCAAGAAAACAGAAAAGAAAGG - Intergenic
1137463603 16:48688196-48688218 GGCAACAAAATTATAATCAAAGG - Intergenic
1138505499 16:57476367-57476389 GGCATCAAAACACTAAGGAATGG + Intronic
1140554605 16:75907505-75907527 ACCAACAAAACAAGACAGAAAGG + Intergenic
1140995538 16:80255602-80255624 ACCCACAAAACAATGAGGAAAGG - Intergenic
1143398849 17:6627246-6627268 GCAAAGGAAACAATAAGGAAAGG - Intronic
1145850000 17:28083972-28083994 TACCACAAAACAATTATGAAAGG + Intronic
1147188111 17:38723709-38723731 GCAAACAAAACAAAAGAGAAAGG + Intronic
1149180077 17:53925447-53925469 ACAAACAAAACAAAAATAAAAGG + Intergenic
1149605722 17:57923770-57923792 ATCAACAAAACAATACTGACTGG + Intronic
1150601485 17:66654699-66654721 GCCAACAGAACAGTAATCACAGG - Intronic
1153319397 18:3757491-3757513 CCCAACAAAACAATAGTAAACGG + Intronic
1153554535 18:6297259-6297281 GAGAACAAAACAAGAATAAACGG + Intronic
1153712697 18:7815823-7815845 GACAGCAAATCAATAAAGAAAGG + Intronic
1153919015 18:9772106-9772128 GCCAACAAATCAATCCTGCAAGG - Intronic
1154084224 18:11286436-11286458 GCAAACAAAACAAGAATCAATGG - Intergenic
1155082642 18:22426106-22426128 ACAAACAAAACTATGATGAAAGG - Intergenic
1155459235 18:26058054-26058076 TCCAATACATCAATAATGAAAGG - Intronic
1156546293 18:37967002-37967024 GCCCTGAAAAAAATAATGAAGGG + Intergenic
1157549959 18:48574608-48574630 GCCAACAACACCATGCTGAAAGG - Intronic
1158757311 18:60341465-60341487 ACCAACATAATAATAATGGAAGG - Intergenic
1159252226 18:65893910-65893932 GCCAACCAATAAATATTGAAGGG + Intergenic
1159403047 18:67961823-67961845 GCCAACAAGACAGTCAGGAAAGG - Intergenic
1159939983 18:74399546-74399568 GCAAACAAAACAAATGTGAAGGG + Intergenic
1160062997 18:75549292-75549314 GCCAAAGAAAGAATAGTGAATGG - Intergenic
1161122649 19:2538095-2538117 CAAAACAAAACAACAATGAATGG + Intronic
1161762464 19:6184185-6184207 GCCAACAAACCAATAATAAAGGG - Intronic
1163769425 19:19181910-19181932 GCCAACAAAAACAAAAAGAAGGG + Intronic
1164450068 19:28353556-28353578 GAAAACAATACAATAATCAAAGG + Intergenic
1164621968 19:29701924-29701946 GCCAACATCACAATAAAGCAAGG - Intronic
1166868711 19:45857457-45857479 GCCAAAAAAACAATAATCTGAGG + Intronic
1168046233 19:53796249-53796271 TCAAACAAAACAAAAATAAAAGG - Intronic
925102374 2:1258391-1258413 GGCAATAAAACAATAAGTAAAGG - Intronic
927442136 2:23126581-23126603 TCCAAGAAAACAATAACAAATGG - Intergenic
927965759 2:27266992-27267014 GCCTACCAGACAATAAGGAAGGG - Intronic
928454579 2:31407594-31407616 GCCATCACAAGAAGAATGAAAGG + Intronic
928973416 2:37056715-37056737 GGCAACAAAAAAAGAATGATTGG + Intronic
929634424 2:43502868-43502890 TCCTACAAAACAAAAATGAAGGG + Intronic
929956397 2:46461675-46461697 GGCAAGAAATCAATAATGATAGG + Intronic
930258708 2:49120272-49120294 GACAAAAAAACAAAAAGGAAAGG + Intronic
932185136 2:69688144-69688166 TTCAACAAATAAATAATGAAAGG - Intronic
933294480 2:80473362-80473384 GAAAACAAAACTATCATGAAGGG + Intronic
933528483 2:83475051-83475073 ACAAACAAAACTATAGTGAATGG - Intergenic
935107872 2:100062377-100062399 CCCAACAAAACAATAATAATTGG - Intronic
935372424 2:102361305-102361327 GCCAAAGAAACAAGTATGAATGG - Intronic
935659785 2:105456295-105456317 GCCAACAACACACTTAGGAAAGG - Intergenic
935825846 2:106948395-106948417 GCCAATGAAACAATATTAAAAGG - Intergenic
936653974 2:114462930-114462952 GCTTACAAAACAAAAATGATAGG - Intronic
936899990 2:117471915-117471937 GACAACAAAACAATACTAATGGG - Intergenic
937271077 2:120653327-120653349 CCCAACAAAACAATTGTCAATGG + Intergenic
939141850 2:138363432-138363454 GCCAAATAAACAATAATGAAAGG + Intergenic
940467437 2:154049141-154049163 GTCAGCAAAAGAGTAATGAATGG - Intronic
941292945 2:163698509-163698531 CCCTACAAAACAAGGATGAAGGG + Intronic
941419390 2:165263493-165263515 GCAAACAAAAAAATAAAGTAGGG - Intronic
942514035 2:176733036-176733058 GGCATCAAACCATTAATGAATGG - Intergenic
942951269 2:181724721-181724743 GCCAATAAATAAATAATAAAAGG + Intergenic
943587179 2:189755130-189755152 GACAACATAACAAAAAAGAATGG + Intronic
944675158 2:202029267-202029289 GACAAGAAATCAATAGTGAAAGG + Intergenic
944954759 2:204795902-204795924 ACCAACAAGACAAAAATGACAGG - Intronic
946775278 2:223132402-223132424 CCCAACAAATGAATACTGAATGG + Intronic
947075219 2:226335633-226335655 GCCTACAAAATAATAATACATGG - Intergenic
948651485 2:239448290-239448312 GACAACAAAACAATTATCAGGGG - Intergenic
1170094093 20:12626190-12626212 GTCAACAAAACAACAGTGAGTGG - Intergenic
1170522630 20:17203383-17203405 TCCAACTAAACAGTAATGAATGG + Intergenic
1170898528 20:20437721-20437743 GCCAAGAAAAGGAGAATGAAGGG - Intronic
1172741992 20:37176190-37176212 GCCAATAAAACAATTTTGGAAGG + Intronic
1173197375 20:40926770-40926792 GCCAACAATCCAATAAAAAATGG + Intergenic
1173273952 20:41562268-41562290 GTCAACTAACCAATAATGGAAGG + Intronic
1173449726 20:43152206-43152228 GCCAAGAAAAAAAAAATGGAAGG + Intronic
1174625028 20:51906841-51906863 TCAAACACAACAATACTGAAAGG + Intergenic
1174804941 20:53596789-53596811 GCCAGCAAAAAAACAAAGAATGG + Intronic
1175031588 20:55960224-55960246 GCCAAGATAAGAATGATGAATGG + Intergenic
1175432632 20:58917196-58917218 TCCAACAAAATAGTAATGAATGG + Intergenic
1177914446 21:27071044-27071066 GGCAACAAAACATTGCTGAAGGG + Intergenic
1178227769 21:30742771-30742793 ATCAACAAATCAATAATGGAAGG - Intergenic
1178234574 21:30825912-30825934 GCAAACAAAAAATTAATAAATGG + Intergenic
1178323418 21:31623573-31623595 ACCCACAAAACTGTAATGAAGGG + Intergenic
1178636502 21:34308459-34308481 GCCAAGAAGACAATGATGACTGG + Intergenic
1179208176 21:39303189-39303211 ACCACCAAAAGAATAATAAAAGG + Intronic
1180459816 22:15552181-15552203 GACAATAAGACAATAATGAGTGG - Intergenic
1182080140 22:27522990-27523012 TCTAACAAAACAAAAATCAAAGG - Intergenic
1182366996 22:29785949-29785971 GCAAACAAAAGAAAAATGCAAGG - Intergenic
949261901 3:2112424-2112446 GCAAGCATAACAATAATGACTGG + Intronic
949904392 3:8846429-8846451 GGCAACAAAACAAAAGAGAAGGG + Intronic
950231347 3:11278716-11278738 GCTAGAAAAACAATGATGAATGG + Intronic
950498740 3:13350585-13350607 TCCAACCAAACAACGATGAAGGG + Intronic
952975219 3:38688154-38688176 CCCCACAATACAACAATGAAAGG + Intergenic
953206228 3:40832176-40832198 CCCAACAAAACAACAGTAAAGGG - Intergenic
953280464 3:41549193-41549215 CCCAACAAAACAGAAATCAAAGG + Intronic
953539867 3:43808197-43808219 GCAAACAAAACCATAAAGTAGGG + Intergenic
954099973 3:48363868-48363890 GACATCAAAATAATAATAAAAGG + Intergenic
956084393 3:65594917-65594939 GCCAACATCAGAATAATGCATGG + Intronic
957461507 3:80527057-80527079 GCTAACAGAACTATAAAGAAAGG + Intergenic
957507868 3:81148675-81148697 GCATATAAAACAATATTGAAGGG - Intergenic
957582849 3:82098002-82098024 GCCAACAAAGTAATCCTGAAAGG - Intergenic
957809499 3:85201561-85201583 GCAAAGAAATCATTAATGAAAGG - Intronic
958186498 3:90127015-90127037 GCAAAGAAAACAAGATTGAAGGG - Intergenic
958666705 3:97148894-97148916 TCCAGCAAAACATTAATGAAAGG - Intronic
962617100 3:137137505-137137527 GTAAACATAACAATCATGAAGGG - Intergenic
963190638 3:142468541-142468563 TACATCAAAACATTAATGAATGG + Intronic
963562565 3:146884275-146884297 GCAAACAAAAAAATAAACAAAGG - Intergenic
963617706 3:147563488-147563510 GCCAATATACCAATAGTGAAAGG - Intergenic
964640460 3:158904731-158904753 GCCAACAAACCAATAGGAAAAGG - Intergenic
965377777 3:167947513-167947535 AACTACAAAACACTAATGAAAGG + Intergenic
966115006 3:176451019-176451041 GCCAAAAAAAAAATGATAAAGGG - Intergenic
967252063 3:187550237-187550259 TCCAACAAAGCATTATTGAAAGG - Intergenic
968912406 4:3482987-3483009 GCCAAGAAAAGCATCATGAAAGG + Intronic
969105025 4:4800714-4800736 CCCAGCAAAAAAGTAATGAATGG + Intergenic
970109228 4:12618693-12618715 GCCAAGAATACAACAAAGAATGG - Intergenic
970243451 4:14033344-14033366 GCCAAGAACACAATAGAGAAAGG - Intergenic
970357186 4:15267539-15267561 ACCAAAAAAGCAATAAGGAAAGG - Intergenic
971003147 4:22345095-22345117 GCCAAAAACACAAGAATAAAAGG + Intronic
971213222 4:24639979-24640001 GCCAATAACACAATAATCACTGG - Intergenic
971948281 4:33309690-33309712 TGAAAAAAAACAATAATGAATGG - Intergenic
972722657 4:41716144-41716166 GCCAAAAAAAAAAAAATGTAGGG + Intergenic
973012924 4:45099479-45099501 GCCAAAAAAATGAAAATGAATGG - Intergenic
973014459 4:45120091-45120113 TTCAACAAAACAATCAAGAAGGG - Intergenic
973100377 4:46260774-46260796 GCCAACAAATAAATATTAAAAGG - Intronic
974430145 4:61786175-61786197 GCCATCAAACCAACATTGAATGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976533203 4:86179963-86179985 GGCAACAAAACAAAAAAAAATGG + Intronic
976556681 4:86458644-86458666 GCAAACAAAAACATAAAGAAGGG + Intronic
976668864 4:87629545-87629567 GCTAAGAAAAAAATAATGTAGGG + Intergenic
976950861 4:90828491-90828513 ATGAACAAAACAAGAATGAATGG + Intronic
977066502 4:92322957-92322979 GACAAAAAAATAATAATAAAGGG - Intronic
977081422 4:92533609-92533631 GACAACAAAAAAATAAAGAAAGG - Intronic
977899819 4:102407079-102407101 GCCAACAGCACAATAAAAAATGG + Intronic
978111792 4:104973550-104973572 ACTCCCAAAACAATAATGAAAGG + Intergenic
978698357 4:111611223-111611245 AACAACAAAAGAATAATTAAAGG + Intergenic
978836000 4:113150287-113150309 GCAAACAAAAGAATAATGCTTGG + Intronic
978987090 4:115026662-115026684 GCCAAAAAAAGAAAAATGATGGG - Intronic
979203574 4:118008232-118008254 ACCATCAAAACAATGAAGAATGG + Intergenic
979370697 4:119882404-119882426 GAGAACAACACAATTATGAAAGG - Intergenic
980804409 4:137793178-137793200 GCAAATAAAAGAAAAATGAAAGG + Intergenic
981977143 4:150744649-150744671 CCCAACTAAAATATAATGAAAGG - Intronic
982957176 4:161785445-161785467 AGCAACTAAATAATAATGAAAGG + Intronic
982977273 4:162079913-162079935 TTCAGGAAAACAATAATGAAGGG + Intronic
983523799 4:168739100-168739122 GGCAATAAAAAAATAACGAAAGG - Intronic
983640901 4:169943139-169943161 AACAACAAAATAATAATGTAAGG - Intergenic
983956110 4:173700560-173700582 GCAAACAAAACAATAATGAAAGG + Intergenic
984040125 4:174722161-174722183 ACCAACAAAATAAGAATGACAGG - Intronic
984450863 4:179899402-179899424 GCAACAAAAACAATGATGAAAGG - Intergenic
984501152 4:180560416-180560438 GCCAACCAAAGAACATTGAAAGG + Intergenic
984774071 4:183465461-183465483 GAAAAAAAAAGAATAATGAAGGG + Intergenic
987783726 5:22471415-22471437 GTAAACAAAACAATGATGAATGG - Intronic
989308978 5:39991421-39991443 GCCATAAAATAAATAATGAAAGG + Intergenic
990791925 5:59491345-59491367 GCCAAGAAAACAAGAAAGAAGGG - Intronic
991283655 5:64944414-64944436 GCCAAGTAAACAATAATTCAAGG - Intronic
994430186 5:99648878-99648900 TCCAACAAAACTATAAGGGAAGG - Intergenic
994508126 5:100667404-100667426 TACAGCAAAACAATAATGGAGGG + Intergenic
995191308 5:109321749-109321771 ACAAACTAAACAATAATGAAAGG - Intergenic
996168383 5:120256029-120256051 GCCTACAAAAGAAGAATGATAGG - Intergenic
996964884 5:129296202-129296224 GACAACAGAACATTACTGAAAGG + Intergenic
998293879 5:140946018-140946040 GCAAAGAAAACAAGAGTGAAGGG + Intronic
998304496 5:141060346-141060368 GCCAAAAAAAAAAAAATGCAAGG + Intergenic
999042698 5:148432799-148432821 ACCAACAAAACAAGTATAAAAGG + Intronic
999806576 5:155086949-155086971 GCCATTAAAATAATAATGAACGG - Intergenic
1002084231 5:176761359-176761381 TCCAACAAATCAATAAGTAAAGG + Intergenic
1002683650 5:180989836-180989858 GCCAACAAAACAGAAATAAGGGG + Intronic
1004869310 6:19888719-19888741 GAAAACAAAACAACAATAAAGGG - Intergenic
1005567580 6:27112420-27112442 GCCAAGAAAACAAGACTGACCGG - Intergenic
1006850039 6:37091842-37091864 ACAAACAAAACAAAAATAAAAGG + Intergenic
1007141492 6:39579429-39579451 GCTACCAAATCAATAAGGAAAGG - Intronic
1008327204 6:50197041-50197063 GCCAACAAAACAAAGATGAGAGG + Intergenic
1009010882 6:57840952-57840974 GCCAAAAAAACAAAATTCAAAGG + Intergenic
1010158892 6:72828398-72828420 CCCTACAAAACACTAATGAAAGG - Intronic
1010796890 6:80127104-80127126 GACCATAAAACAATAAGGAAGGG - Intronic
1011460687 6:87600002-87600024 GCCAACAAAAAAAGAAAGCAAGG - Intronic
1011587130 6:88938676-88938698 GCAAACACATCAACAATGAAGGG - Intronic
1012036156 6:94142645-94142667 GCTAACAAAATCAGAATGAATGG + Intergenic
1012580090 6:100857254-100857276 TCCTACAAATCAATAAGGAAAGG - Intronic
1012757000 6:103244587-103244609 ATCAACAAAAAAATAGTGAAGGG + Intergenic
1012777273 6:103513148-103513170 TGCTACAATACAATAATGAATGG + Intergenic
1013744061 6:113323573-113323595 GCCAAAAAAATAATAAGGAAGGG - Intergenic
1014917189 6:127165398-127165420 GCCAACAGCAAAATCATGAAGGG + Intronic
1015099936 6:129465227-129465249 GCAATCAAAACCATAATGATGGG + Exonic
1015454631 6:133412612-133412634 GGCCACAAAACAAAAACGAATGG - Intronic
1015740580 6:136449323-136449345 GAAAACAAAACAAAAATGTAAGG + Intronic
1016111133 6:140225519-140225541 TCCAGCAAAAGAAAAATGAAAGG + Intergenic
1016762375 6:147751781-147751803 TCCAAAAAAAGAATAAAGAAAGG - Intergenic
1016866090 6:148768484-148768506 GCAAAGAAAAGAATAATAAATGG - Intronic
1020801512 7:12738347-12738369 GCCATTAAAAAAATCATGAAGGG - Intergenic
1020989392 7:15178489-15178511 GACAACAAAACAACAAAAAAAGG - Intergenic
1021226541 7:18034615-18034637 GCCACAAAAACAAAAATAAACGG - Intergenic
1021298663 7:18942101-18942123 CCCAATAAAAGACTAATGAATGG - Intronic
1021362048 7:19727442-19727464 GCTAAAAATCCAATAATGAACGG + Intronic
1022534635 7:31088797-31088819 GAAAACAAAAGAATAATGAAGGG - Intronic
1022853777 7:34295444-34295466 GCCAAGAAAAGAAGTATGAAGGG + Intergenic
1023054685 7:36282312-36282334 TTCAACAAATCATTAATGAAAGG + Intronic
1023487212 7:40699904-40699926 GCCAACAATGAAATAATTAATGG - Intronic
1023567696 7:41539842-41539864 GTCAAAAAATCAATAATTAATGG + Intergenic
1023718542 7:43069273-43069295 GAAAACAAAACAAAAATGACTGG + Intergenic
1024050133 7:45614910-45614932 GACCACAAAACAATAATAATAGG + Intronic
1027113497 7:75459827-75459849 GACAACAATACCATAAAGAAGGG + Intronic
1027285747 7:76644421-76644443 GACAACAATACCATAAAGAAGGG + Intergenic
1027305888 7:76896729-76896751 GCCCATAAAATAAGAATGAATGG + Intergenic
1027413595 7:77949017-77949039 GGCAACAAAATATTAATGATAGG + Intronic
1027706879 7:81546243-81546265 GCCAAAAAAATAAAAATAAATGG - Intergenic
1027933116 7:84565663-84565685 ACAAACAAAACAAGAAAGAAAGG + Intergenic
1028174063 7:87632750-87632772 GCCACCAAAACCAAAATCAAAGG - Intronic
1028530106 7:91829300-91829322 GCCCACAAAACTATAAGTAATGG - Intronic
1029586935 7:101479756-101479778 GCAAACAAACAAATAATAAAAGG - Intronic
1030401789 7:109060504-109060526 GGAAAGAAAACAATAAAGAAAGG - Intergenic
1033240518 7:139675537-139675559 GGCAGCAAAACAAGAATGCATGG + Intronic
1033623258 7:143081936-143081958 GCCAACATAATAATACTGAACGG + Intergenic
1034054678 7:148021898-148021920 GACAACAAAACAAAAGGGAAAGG - Intronic
1038049600 8:23796385-23796407 GCTAACAAAACAAAACAGAATGG + Intergenic
1038358234 8:26850284-26850306 GACAAAAAAACAATAATCAAGGG + Intronic
1039688526 8:39835954-39835976 ACCAACAAAAAAATAGTGCAAGG - Intronic
1039746101 8:40429269-40429291 GACTACAAAACACTACTGAAAGG - Intergenic
1041732897 8:61080562-61080584 TACATCAAAACCATAATGAATGG + Intronic
1041864962 8:62561720-62561742 GCCAACCACAAAATAATGATGGG + Intronic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1043175050 8:77014748-77014770 GCAAACAAAACTATCATGACAGG - Intergenic
1043832879 8:85011271-85011293 AGCAACATAGCAATAATGAATGG - Intergenic
1044138877 8:88622700-88622722 GACCACAAAAAAATAATAAAAGG + Intergenic
1044512520 8:93098780-93098802 GCCATCCAAACAACAAAGAATGG + Intergenic
1044673874 8:94710360-94710382 AACAACAAAAAAAAAATGAAGGG + Intergenic
1045681953 8:104670781-104670803 TTCACCAAAACAATAATTAAAGG + Intronic
1046346478 8:112934869-112934891 GAAAAGGAAACAATAATGAAGGG - Intronic
1046769812 8:118107702-118107724 TCCAAAAAACCAATAATAAATGG + Intronic
1047383819 8:124389736-124389758 TGCAACAAAACAAAAATAAATGG - Intergenic
1047691650 8:127361059-127361081 GCCAACATAACAAAACTGGAAGG - Intergenic
1048074793 8:131057546-131057568 TCCACCAAAACAATCATGGAAGG + Intergenic
1048398137 8:134034662-134034684 GCCAACAATAGAATAAATAAAGG + Intergenic
1049234070 8:141501348-141501370 GACATTAAAAGAATAATGAAGGG + Intergenic
1050954715 9:11640337-11640359 TCCTACAAAACAATAATATAAGG - Intergenic
1050965360 9:11795074-11795096 GGCAACAACACTCTAATGAAAGG + Intergenic
1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG + Intronic
1051461038 9:17316044-17316066 GACAATTAAACAATAATGATGGG - Intronic
1052502883 9:29315657-29315679 TCCAACAAAAAAAAAAGGAAGGG - Intergenic
1053729401 9:41037581-41037603 AACAACAAAAAAATACTGAAGGG - Intergenic
1054699107 9:68394482-68394504 AACAACAAAAAAATACTGAAGGG + Intronic
1055157272 9:73079698-73079720 GGCAACAAAAGAATAATGTTTGG - Intronic
1055308826 9:74957100-74957122 TACAACAAAACAACAAAGAAGGG + Intergenic
1055482538 9:76724092-76724114 GCCAGCATATCATTAATGAAGGG + Intronic
1056130165 9:83576759-83576781 GGCAAGAAAAAAATAATAAAGGG + Intergenic
1056241490 9:84652100-84652122 GCAAGGAAAACAATAATGAGAGG - Intergenic
1058302689 9:103396218-103396240 GACAACAACACAATAATAATGGG - Intergenic
1059995922 9:119909096-119909118 TTCAATAAAACAATAATGCAAGG + Intergenic
1062719279 9:138027461-138027483 GACAAAAAAATAATAATGAGTGG - Intronic
1188058431 X:25569382-25569404 GACAACAAAACAATAATAGTGGG - Intergenic
1189173703 X:38933487-38933509 TCCAAAAAAAAAATAATGCAAGG + Intergenic
1189896465 X:45661735-45661757 GCCAACAAAGAAAAAAAGAAAGG - Intergenic
1189951384 X:46234705-46234727 TTCAAAAAAAAAATAATGAATGG + Intergenic
1190469576 X:50764769-50764791 GCCAAGAAAAGCATAATAAAAGG - Intronic
1191811556 X:65194778-65194800 GGCAACAATACAATAATAACTGG - Intergenic
1192691036 X:73364783-73364805 GACAACAACACAATAATAGAGGG - Intergenic
1194138731 X:90180937-90180959 GGAAGTAAAACAATAATGAATGG - Intergenic
1194301436 X:92191596-92191618 GTCAATAACCCAATAATGAACGG - Intronic
1196796945 X:119509652-119509674 GCCACAAAAACAAAAATAAATGG - Intergenic
1196800592 X:119539755-119539777 GCCAAGAAAGCGAAAATGAAGGG - Exonic
1197492982 X:127141356-127141378 TGCAACAATACAATAATGGATGG + Intergenic
1197589281 X:128388661-128388683 GCCAACAAAACCATAAAGTGGGG + Intergenic
1197890243 X:131263011-131263033 GCCAACAAGGCAGAAATGAATGG + Intergenic
1197893499 X:131288207-131288229 CCCAACACAACAATAATGTTAGG - Intronic
1198612441 X:138417164-138417186 GCAAACAAAAAAATAACAAATGG - Intergenic
1198991907 X:142524292-142524314 GCAAATAAAACAATAATGAGAGG + Intergenic
1199298318 X:146184272-146184294 GCCTATAAAACAATAACGCATGG - Intergenic
1199307947 X:146289746-146289768 GACAACAAAAAAATGATGAAGGG - Intergenic
1200834838 Y:7723430-7723452 TCCAACAGAACAATTATGAAAGG + Intergenic
1201727542 Y:17170398-17170420 GCAAACAAAACAATGATAAAAGG - Intergenic
1202054311 Y:20814075-20814097 CCCAAGAAAACAATAATCAAAGG + Intergenic