ID: 906545738

View in Genome Browser
Species Human (GRCh38)
Location 1:46618024-46618046
Sequence CCTGCTTGGGAGTGGAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1482
Summary {0: 1, 1: 0, 2: 15, 3: 168, 4: 1298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906545738 Original CRISPR CCTGCTTGGGAGTGGAGGGC GGG Intergenic
900008527 1:83310-83332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900036758 1:417393-417415 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900058387 1:653140-653162 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900123854 1:1060844-1060866 CCTCCGTGGGCTTGGAGGGCGGG + Intergenic
900155862 1:1203062-1203084 GCTGCCGGGGAGTGGCGGGCAGG - Intergenic
900345984 1:2210467-2210489 CCTGCTTTGGGGAGGAGGCCAGG + Intronic
900560755 1:3304904-3304926 CCTGGGTGGCAGCGGAGGGCAGG - Intronic
900569745 1:3352394-3352416 CCGGCTTCGGAGGGGAGGGAGGG - Intronic
900626318 1:3610316-3610338 CCTGCTGGGGAGTGCTGGACGGG + Intronic
900700865 1:4047917-4047939 CCTGCATGGGGGTGGGGGGTTGG + Intergenic
900707946 1:4092141-4092163 CCTGGTGGGGTGTGCAGGGCTGG - Intergenic
900891651 1:5454034-5454056 CATGGTTGGGGGTGGAGGGAAGG + Intergenic
901004026 1:6163035-6163057 CCACCTTGGGAGAGTAGGGCTGG + Intronic
901639671 1:10686902-10686924 CCTGCCGGGCAGTGGAGAGCCGG + Intronic
901640889 1:10692480-10692502 TCTCTGTGGGAGTGGAGGGCAGG + Intronic
901931122 1:12596506-12596528 CCTGCTTCGGAAGGGAGGGGCGG - Intronic
902199579 1:14823457-14823479 CCTACTTGGGAGTGGGGGTGGGG - Intronic
902328934 1:15720991-15721013 CCTGCTAGGGTATGGAGGGAAGG + Intronic
902709808 1:18230927-18230949 CCTGCTTGGAGGAGGGGGGCAGG - Intronic
902799563 1:18820871-18820893 CGTGCTTGGAAGTGCTGGGCAGG - Intergenic
903204326 1:21769375-21769397 CTTACTTGGGGGTGGAGGGTGGG + Intronic
903210720 1:21816651-21816673 CCTAATTGGGTGTGGTGGGCAGG - Intronic
903372172 1:22843494-22843516 CCTACTTGAGGGTGGAGGGTGGG - Intronic
903470541 1:23583979-23584001 CCTACTTGGGAGGCTAGGGCAGG + Intronic
903694572 1:25197384-25197406 CCTGCCTGAGTGTTGAGGGCAGG + Intergenic
903988497 1:27247476-27247498 CCTACTTGAGGGTGGAGGGTGGG - Intronic
904232998 1:29092700-29092722 CCTACTTGAGGGTGGAGGGTGGG - Intronic
904269528 1:29340622-29340644 CCTGCTTGAGGGTGGAGGCTGGG - Intergenic
904363530 1:29994994-29995016 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
904374697 1:30073111-30073133 GCTGCTTTGGAGGGGAGGTCAGG + Intergenic
904627743 1:31816477-31816499 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
904816610 1:33207098-33207120 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
905172734 1:36118677-36118699 GCTGGTTGGGGGTGGGGGGCGGG - Intronic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
905349085 1:37332063-37332085 GCTGCATGGGAGTGGAGAGAAGG - Intergenic
905480629 1:38259483-38259505 GCTGCTTGGGAGTGAGGGGCAGG + Intergenic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
905875879 1:41431877-41431899 CCTGCCGGGGTCTGGAGGGCAGG + Intergenic
905896461 1:41549022-41549044 CCTGTTGGGGGGTGGGGGGCAGG - Intronic
906050990 1:42872064-42872086 CCTGCTTGACAGTAGAGGGTGGG - Intergenic
906146884 1:43565686-43565708 CCCGGTTGGGGGTGGAGGGGAGG + Intronic
906429318 1:45742210-45742232 CCTACTTGAGAGTGGAGGGTAGG + Intronic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906549763 1:46654688-46654710 CCTGTCAGGGGGTGGAGGGCTGG - Intronic
906836789 1:49092023-49092045 CCTACTTGAGGGTGGAGGGTGGG + Intronic
906997543 1:50813059-50813081 CCTCCTTGAGAGTGGCGGGTGGG + Intronic
907744934 1:57203627-57203649 CCTGCTTGAAAGTGGAGAACAGG + Intronic
909102006 1:71359446-71359468 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
909568617 1:77083374-77083396 ACTACTTGGGGGTGGAGGGTGGG - Intergenic
909698051 1:78489696-78489718 CCTGTTAGGGGGTGGGGGGCAGG + Intronic
909759563 1:79271100-79271122 CCGGGTTGGGAGTGTAGGGGCGG + Intergenic
910139754 1:84014064-84014086 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
910166350 1:84331885-84331907 CCTACTTGAGGGTGGAGGGTGGG - Intronic
910313296 1:85853120-85853142 CCTACTTGAGAGTGAAGGGTGGG - Intronic
910592241 1:88938533-88938555 CCTCCTTGAGGGTGGAGGGTGGG - Intronic
910731626 1:90403966-90403988 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
911514117 1:98846255-98846277 CCTGCTTGGGAGTGCAAGGAGGG - Intergenic
911900484 1:103497143-103497165 CCTACTTGAGAGTGGAGGGTAGG + Intergenic
912459571 1:109821876-109821898 TCTGCTAGGGAGGGGAGGCCTGG - Intergenic
912556759 1:110521858-110521880 CCTGCTTGGTCTTGGAGGACAGG + Intergenic
912574881 1:110659919-110659941 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
913020399 1:114783847-114783869 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
913027860 1:114863965-114863987 CCTGTTGGGGGGTGGGGGGCAGG + Intronic
913073131 1:115318795-115318817 CATGTTTGGGAGTGGGGAGCAGG - Intronic
913074220 1:115327811-115327833 CCTGCTTGGGAGGTGGGGGCAGG + Intronic
913283130 1:117204363-117204385 CCAGCTAGGAAGTGGAGAGCTGG + Intronic
913627970 1:120679262-120679284 CCTGTTTGGGGTTGGGGGGCGGG + Intergenic
914412155 1:147440184-147440206 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
915289995 1:154877187-154877209 CCTGGGTGGGAGTGGTGGGCAGG - Intergenic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915367618 1:155324511-155324533 CCTGCTAGGGCCTGTAGGGCGGG - Intronic
915601055 1:156923649-156923671 CCGGGCTGGGAGTGGAGAGCAGG + Intronic
915709144 1:157877375-157877397 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
915946645 1:160157336-160157358 CCTACTTGAGGGTGGAGGGTGGG - Intronic
916017855 1:160766071-160766093 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
916124174 1:161554529-161554551 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
916576633 1:166072731-166072753 CCTTCTTAGAATTGGAGGGCAGG + Intronic
916789617 1:168113818-168113840 CCTACTTGAGAGTGGAGGGTGGG + Intronic
916883253 1:169043246-169043268 CCTACTTGTGGGTGGAGGGTAGG + Intergenic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
918100605 1:181369952-181369974 CCTACTTGAGAGTGGAGCGTGGG - Intergenic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918655860 1:187025254-187025276 CCTGCTTGAGGGTGAAGGGTGGG + Intergenic
918858705 1:189793724-189793746 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
919643469 1:200067618-200067640 TCTGCTTGGGGCTGGAGGGTGGG + Intronic
919701835 1:200638958-200638980 CCTGCATAGGAGTGGAGTGCGGG + Intronic
919701840 1:200638994-200639016 CCTGCATGTGAGTGGAGTGTGGG + Intronic
919701847 1:200639026-200639048 CCTGCGTGGGAGTGGACTGTGGG + Intronic
919721378 1:200840379-200840401 GCTGCTTGGGAGGCTAGGGCAGG - Intronic
920198168 1:204243180-204243202 CTCGCTAGGGAGTGGAGGGACGG + Intronic
920229284 1:204459937-204459959 CCTGCCTGGGAGTTGGGGGCAGG + Exonic
920337152 1:205252582-205252604 CCTGCTTGGAAATGGAGGTTTGG - Intronic
920596896 1:207280897-207280919 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
920687960 1:208124210-208124232 CCTACTTGAGGGTGGAGGGAGGG + Intronic
920816367 1:209336926-209336948 CCTACTTGTGGGTGGAGGGAGGG + Intergenic
920925129 1:210334081-210334103 ACACCTTGGGAGTGGAGGGCTGG + Intronic
920951928 1:210580488-210580510 CCTGCTGGGGGGTGGGGGGTGGG - Intronic
921260297 1:213380318-213380340 CCTACTGGAGAATGGAGGGCGGG + Intergenic
921336194 1:214088997-214089019 TCTGCTTGAGGGTGGAGGGTGGG - Intergenic
922000175 1:221469286-221469308 CCTGAATGAGAGTTGAGGGCAGG + Intergenic
922601150 1:226854898-226854920 CCTGTTGGGGTTTGGAGGGCTGG + Intergenic
923220045 1:231884631-231884653 CCTACTTGAGATTGGAGGGTGGG + Intronic
923715161 1:236418970-236418992 CATGACTGGGAGGGGAGGGCAGG - Intronic
923822035 1:237455410-237455432 CCTACTTGAGGGTGGAGGGTGGG + Intronic
924128965 1:240885739-240885761 TCTACTTGAGAGTGGAGGGTGGG + Intronic
924212966 1:241789725-241789747 CCTACTTGAGGGTGGAGGGTGGG + Intronic
924269350 1:242316763-242316785 TCTGCTTGAGAGTGGAGGGTGGG - Intronic
924388846 1:243528472-243528494 CCTACTTGAGGGTGGAGGGCAGG - Intronic
924463208 1:244277692-244277714 CCCCCTTGAGAGTGGAGGGTGGG - Intergenic
924508171 1:244705478-244705500 ACTGCCAGGGAGTGGAGGGTGGG - Intronic
924587470 1:245372517-245372539 CCTACTTGGGGGTGGAGGGTGGG - Intronic
924864912 1:247968492-247968514 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1062962115 10:1580267-1580289 CCTGCTTGATGGTGGAGGGCAGG - Intronic
1063008159 10:1994689-1994711 CCTGAATGGGAGTGAGGGGCAGG + Intergenic
1063448038 10:6132455-6132477 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
1063699984 10:8374989-8375011 CCTACTTGAGGGTGGAGGCCAGG - Intergenic
1063811615 10:9715717-9715739 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
1064366572 10:14714021-14714043 CCTACTTGAGAGTGGAGGGTGGG + Intronic
1064437109 10:15320124-15320146 CCTACTTGAGAGTGGAGGGTGGG - Intronic
1064525758 10:16254909-16254931 CATACTTGAGAGTGGAGGGTGGG + Intergenic
1064621317 10:17220402-17220424 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1064843255 10:19620316-19620338 CCTACTTGAGAGTGGAGGGTGGG - Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065201760 10:23319154-23319176 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1065368365 10:24956288-24956310 CCTACTTGAGGGTGGAGGGCGGG - Intergenic
1065445834 10:25797619-25797641 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1065496953 10:26339282-26339304 CCTACTTGAGCGTGGAGGGTGGG + Intergenic
1065636738 10:27742565-27742587 ACTGCCGGTGAGTGGAGGGCAGG - Intronic
1065658043 10:27973486-27973508 CCTACTTGAGATTGGAGGGTGGG - Intronic
1065839039 10:29685069-29685091 CCTACTTGAGAGTGGAGGCTTGG - Intronic
1065916396 10:30357672-30357694 CCAGCCTGGGAGTGCAGAGCAGG + Intronic
1066169631 10:32827637-32827659 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
1066525702 10:36276742-36276764 CCTGTTGGGGGGTGGAGGGTAGG + Intergenic
1066715551 10:38282004-38282026 TCTACTTGAGAGTGGAGGGTGGG + Intergenic
1066965005 10:42255265-42255287 CTTGTTGGGGGGTGGAGGGCTGG - Intergenic
1067066470 10:43106737-43106759 CCTGCTGGTGGCTGGAGGGCAGG - Intronic
1067087899 10:43252489-43252511 CCTGCCTGGGAAGGAAGGGCAGG + Intronic
1067248771 10:44569990-44570012 CCAGCCTGGGAGTGAAGGGCGGG - Intergenic
1067479154 10:46584231-46584253 CCTTCCTGGGGGTGGTGGGCTGG - Intronic
1067615585 10:47757570-47757592 CCTTCCTGGGGGTGGTGGGCTGG + Intergenic
1067788828 10:49272524-49272546 GCTGCTTGGGTGTGGAGCTCTGG + Intergenic
1067915362 10:50392024-50392046 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1068071369 10:52200208-52200230 CCTGTTTGATAGTGGAGGGTGGG - Intronic
1068712070 10:60146450-60146472 CCTACTTGGGGGTGGAGGGTGGG - Intronic
1068987814 10:63123244-63123266 CCTGCCTGAGGGTGGAGGGTAGG - Intergenic
1069054599 10:63831659-63831681 CCTACCTGTGAGTGGAGGGAGGG + Intergenic
1069253659 10:66304374-66304396 CATGCTTGGGACTGAAGGACAGG - Intronic
1069964377 10:72101978-72102000 CCTCCTTGAGGGTGGAGGGAGGG + Intronic
1070007722 10:72441398-72441420 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1071770166 10:88720361-88720383 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1072095184 10:92171426-92171448 TCTGGTTGGGGGTGGAGGGTGGG - Intronic
1072737554 10:97889273-97889295 CCAGCTGGGAAGTGGAGGGTGGG + Intronic
1072764110 10:98082159-98082181 CCTGCTAGAGAGGAGAGGGCAGG - Intergenic
1073832298 10:107399149-107399171 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1074462503 10:113651244-113651266 CTTGCTTGGAGGTGGAGGGAGGG - Intronic
1074705641 10:116127524-116127546 CCTTCTTGGGTGTGGAGTACAGG + Intronic
1074845709 10:117395557-117395579 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1075543430 10:123335301-123335323 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1075828208 10:125378875-125378897 CCTTCTTGAGAGTGGAGGGTGGG - Intergenic
1075843223 10:125522372-125522394 ACTGCTTGGGGGTCGGGGGCGGG + Intergenic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076369146 10:129940686-129940708 CCTGCTAGGAAGTAGGGGGCTGG + Intronic
1076600115 10:131651896-131651918 CCTGCTGGCAAGGGGAGGGCAGG + Intergenic
1077305074 11:1865278-1865300 CCTGGCTGGGCATGGAGGGCAGG + Intronic
1077355037 11:2112185-2112207 CGTGGTTGGGAGTGGGGGGTGGG + Intergenic
1077470995 11:2760518-2760540 CCAGCTTGGGAGAGGAGGAAGGG - Intronic
1077474153 11:2778538-2778560 CCTGGTGGGGAGTGGGGGCCTGG - Intronic
1077528340 11:3082541-3082563 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
1077671585 11:4162623-4162645 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1077928945 11:6710392-6710414 CCTACCTGAGAGTGGAGGGTGGG - Intergenic
1078087754 11:8244241-8244263 CCAGCTTGGGAGTGGGCTGCTGG + Intronic
1078198518 11:9157481-9157503 CCTGCTTGAGAGTGGAGAGTGGG - Intronic
1078235518 11:9481274-9481296 GCTGTTTGGGAGGCGAGGGCAGG + Intronic
1078444981 11:11397257-11397279 CCTGCTTGAGAGAGAAGGGGAGG + Intronic
1078479383 11:11662749-11662771 CCTGCTGTGATGTGGAGGGCTGG + Intergenic
1078690550 11:13575750-13575772 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
1078694284 11:13614427-13614449 CCTGCTTGAGGTTGGAGGGTAGG - Intergenic
1079105359 11:17568736-17568758 CCTGCCTGTCAGTGGAGTGCAGG + Intronic
1079495074 11:21033385-21033407 CCTACTTGGAGGTGGAGGGTGGG - Intronic
1079680276 11:23287758-23287780 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1079727096 11:23890811-23890833 CCTGTGTGGGGTTGGAGGGCTGG + Intergenic
1079945608 11:26737002-26737024 CCTACTTGAGGGTGGAGGGCAGG + Intergenic
1079967242 11:26994375-26994397 CCTGCTGGGGACTGGGGGCCAGG + Exonic
1080083434 11:28249876-28249898 CCTACTTGAGGGTGGAGGGTAGG - Intronic
1080351929 11:31395029-31395051 CCTACTTGAGAGTGGAGGGTGGG - Intronic
1080406723 11:31986624-31986646 GCTGTTTGGGGGTGGAGGGAAGG - Intronic
1080497270 11:32832076-32832098 CATACTTGAGTGTGGAGGGCTGG + Intronic
1080789440 11:35508686-35508708 CCTACTTGCAGGTGGAGGGCGGG - Intronic
1080906403 11:36550107-36550129 CCTGCTGGGGACTGGGGAGCTGG + Intronic
1081402601 11:42660528-42660550 TCTGCTTGAGGGTGGAGGGTAGG + Intergenic
1081756942 11:45551438-45551460 CCTGCTTAGGAGCTGTGGGCTGG - Intergenic
1082101750 11:48178569-48178591 CCTGCTTGAGGGTGAAGGGTAGG + Intergenic
1082702716 11:56453086-56453108 CCTCCTTGAGAATGGAGGGTGGG + Intergenic
1082723654 11:56709560-56709582 CCTGTCAGGGAGTGGTGGGCTGG - Intergenic
1082981454 11:59127226-59127248 CCTACTTGAGGGTGGAGGGTGGG + Exonic
1083257614 11:61506216-61506238 ACTGCTTGGGGGTGGGGGGAGGG + Intergenic
1083424173 11:62574512-62574534 CCTGCTTCGGGCCGGAGGGCCGG - Exonic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083630071 11:64090837-64090859 GCTCCCTGGGAGTGCAGGGCTGG - Intronic
1083677767 11:64336552-64336574 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1084841485 11:71854530-71854552 CCTACCTGGGGGTGGAGGGTGGG + Intergenic
1084927097 11:72522552-72522574 CCTGCTAGGGTCTGGGGGGCAGG + Intergenic
1084961148 11:72717359-72717381 CCTGCTTGGCATTGGAGAGATGG - Intronic
1085017278 11:73183078-73183100 CCTGCTTGGAGGTGGGGTGCTGG - Intergenic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085614608 11:77986830-77986852 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1085693651 11:78686027-78686049 CCTGCCTTGGAGAGGAGGGCAGG - Intronic
1085787595 11:79468755-79468777 CCTACTTGAGGGTGGAGGGAGGG + Intergenic
1085790055 11:79489455-79489477 CCTACTTGAGGGTGGAGGGAGGG - Intergenic
1086303377 11:85453928-85453950 CCTGCTTAAGGGTGGAGGGTGGG - Intronic
1086526402 11:87732237-87732259 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1086627216 11:88971430-88971452 CCTACTTGAGAGTGGAGAGTGGG - Intronic
1086645554 11:89215363-89215385 CCTGTTTGGGGGTGGGGGGCTGG + Intronic
1087231492 11:95671136-95671158 CCTGCTTACGGGTGGAGGGTAGG - Intergenic
1087873305 11:103326220-103326242 CGTTCTTGGGAGTAGAGGGAGGG + Intronic
1088238438 11:107749844-107749866 CCTACTTAAGAGTGGAGGGTGGG - Intergenic
1088370611 11:109084539-109084561 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1088410163 11:109525365-109525387 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1088839776 11:113615448-113615470 CCAGTTTGGGAGTTGAGGGAAGG + Intergenic
1089322147 11:117633703-117633725 CCTCCTTGGGATTGAAGGGTAGG + Intronic
1089481413 11:118808153-118808175 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1089884898 11:121810772-121810794 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1089887756 11:121844882-121844904 CACTCTTGGGAGTGGAGGGAGGG - Intergenic
1089905267 11:122031717-122031739 CCTGCTTGAGTGGGGAGGGTGGG + Intergenic
1089934790 11:122352885-122352907 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1090096623 11:123748371-123748393 CCTACTTGAGGGTGGAGGGAGGG - Intergenic
1090102347 11:123812668-123812690 CCTACTTGAGATTGGAGGGTGGG - Intergenic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090538029 11:127667395-127667417 TCTGCTTGAGGGTGGAGGGTGGG + Intergenic
1090554818 11:127862924-127862946 CCTGCTGGGGGGTTGGGGGCTGG - Intergenic
1090572778 11:128066262-128066284 CCTACCTGAGAGTGGAGGGTGGG + Intergenic
1090597181 11:128332778-128332800 GCTACTTGAGAGTGGAGGGTGGG + Intergenic
1090602015 11:128382473-128382495 CCTACTTGGGAGGGTAAGGCAGG - Intergenic
1090727691 11:129542504-129542526 CCTACTTGTGGGTGGAGGGTGGG - Intergenic
1090941433 11:131391342-131391364 CAAGCTTGGCAGTGGAGAGCTGG - Intronic
1091256051 11:134187072-134187094 GCTGGCTGGGAGTGGAGGGCTGG - Intronic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1092008899 12:5092986-5093008 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
1092293540 12:7180284-7180306 GCTACTTGGGAGTCTAGGGCAGG + Intergenic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092581006 12:9841304-9841326 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1092768759 12:11877741-11877763 CCTGCTTGGGAGTCAAGAACCGG - Intronic
1092974271 12:13729210-13729232 CCAGCATGGGAGTGGCGGGGAGG + Intronic
1093019638 12:14191455-14191477 CCTGCTTGAGTTTGGAGGGAGGG + Intergenic
1093256420 12:16873557-16873579 CCTGTTGGGGAGTGGGGGCCTGG - Intergenic
1093327736 12:17800101-17800123 CCTACTTGAGAGTGGAGGGTAGG + Intergenic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093586349 12:20841725-20841747 CCTACTTGAGGGTGGAGGGTAGG - Intronic
1093597138 12:20975739-20975761 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1093655880 12:21693993-21694015 CCTACTTGGTGGTGGAGGGTAGG + Intronic
1093678170 12:21968197-21968219 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1093747036 12:22753851-22753873 TCTACTTGAGAGTGGAGGGTGGG + Intergenic
1093947343 12:25124770-25124792 CCTACTTAGGAGTAGAGGGTGGG - Intronic
1094226011 12:28046967-28046989 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1094257109 12:28444671-28444693 TCTACTTGAGAGTGGAGGGTAGG + Intronic
1094759326 12:33512317-33512339 TCTACTTGGGGGTGGAGGGTGGG - Intergenic
1094760500 12:33526701-33526723 CCTGTCTGGTGGTGGAGGGCTGG + Intergenic
1095519542 12:43046284-43046306 CCTACTTGAGAGTAGAGGGCAGG + Intergenic
1095575098 12:43727675-43727697 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1095614302 12:44170287-44170309 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
1095842907 12:46714020-46714042 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1096256391 12:50064572-50064594 CAAGCCTGGAAGTGGAGGGCTGG + Intronic
1096517265 12:52163895-52163917 CCTGCTGGGGAAGGGAGGCCAGG + Intergenic
1096677752 12:53234643-53234665 CAAGCTGGGGAGTGGAGGGTGGG - Intergenic
1096678845 12:53241745-53241767 CCGGCCTGGAAGGGGAGGGCTGG + Intergenic
1096884710 12:54705457-54705479 CCTACTTGAGAGTGAAGGGTGGG - Intergenic
1096894253 12:54804460-54804482 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1096953572 12:55502186-55502208 CCTGCTTGAGGGTGGAGGATGGG + Intergenic
1097135100 12:56846315-56846337 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1097168196 12:57096820-57096842 GCAGCTTGGGAGTGGAGGCTGGG - Intronic
1097292884 12:57934064-57934086 TCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1097302284 12:58031867-58031889 CCTACTTGACAGTGGAGGGTGGG - Intergenic
1097431379 12:59512079-59512101 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1097820153 12:64120498-64120520 CCTTAATGGGGGTGGAGGGCAGG + Intronic
1098308760 12:69127164-69127186 TCTTCTTGGGGGTGGAGGGTGGG - Intergenic
1098399754 12:70061916-70061938 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1099238236 12:80107939-80107961 CCTATTTGAGAGTGGAGGGTGGG + Intergenic
1099372031 12:81846094-81846116 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1099637019 12:85226678-85226700 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1100251584 12:92830321-92830343 CCTGCTTGAGGGTGGAAGGTGGG - Intronic
1100381905 12:94070244-94070266 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1100658856 12:96675931-96675953 CCTGTTTTGGGGTGGGGGGCAGG + Intronic
1100921337 12:99491537-99491559 CCTACTTGTGGGTGGAGGGTGGG - Intronic
1102111550 12:110369109-110369131 GCTACTTGGGAGGGTAGGGCAGG - Intergenic
1102588559 12:113940409-113940431 CCTGCTCAGGAGTGGAGGAGGGG - Intronic
1103032966 12:117632687-117632709 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1103907103 12:124333336-124333358 CCTGGTTTAGAGTGGAGGGAGGG - Intronic
1104298034 12:127536385-127536407 CCTACCTGAGGGTGGAGGGCAGG + Intergenic
1104399760 12:128465695-128465717 CCTGCTTGGGTGTGGTGTGAGGG + Intronic
1104406462 12:128521452-128521474 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1104537374 12:129630854-129630876 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1104547305 12:129723895-129723917 ACATCTTGGTAGTGGAGGGCAGG - Intronic
1104626679 12:130362224-130362246 CCTACTTGGGGGTGGAAGGTGGG - Intronic
1104737723 12:131148359-131148381 CCTACTTGAGAGTGGAGGGAGGG - Intergenic
1104807532 12:131599058-131599080 CCAGGAGGGGAGTGGAGGGCTGG - Intergenic
1105817674 13:24051627-24051649 CCTGTTTGGGGATGGAGGGGTGG + Intronic
1105925864 13:25007405-25007427 CCTGTTGGGAGGTGGAGGGCAGG - Intergenic
1105976197 13:25475169-25475191 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1106181259 13:27371663-27371685 CCTTCTTGGGTGGGGAGGACTGG - Intergenic
1106426900 13:29639928-29639950 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1106749847 13:32751029-32751051 CCTTCTTGAGGGTGGAGGGTAGG - Intronic
1107169324 13:37321232-37321254 CCTACTTGAGAGTGGAGAGAGGG + Intergenic
1107176142 13:37400994-37401016 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1107232587 13:38128278-38128300 CCTACTTGAGAGTGGAGTGTGGG - Intergenic
1107412609 13:40172096-40172118 CCTACTAGGGGGTGGAGGGTGGG - Intergenic
1108141774 13:47431030-47431052 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1108248467 13:48541239-48541261 CCTGTTTGGGGGTGGGGGTCTGG + Intergenic
1108412793 13:50166943-50166965 CCTGTTAGGGGGTGGGGGGCTGG + Intronic
1108467881 13:50736344-50736366 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1108542029 13:51453522-51453544 CCTGGTTAGGAGAAGAGGGCAGG + Intronic
1108705447 13:52981416-52981438 TCTCTTTGGGAGTGGAGGGGCGG - Intergenic
1108885148 13:55171119-55171141 CCTACTTGAGAGTAGAGGGTTGG + Intergenic
1108982570 13:56537334-56537356 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1109158286 13:58939338-58939360 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1109254945 13:60068646-60068668 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1109655927 13:65389737-65389759 TCTGCTTGGAAGTGGAGGGGTGG + Intergenic
1109760455 13:66820831-66820853 CCTGTTTGAGGGTGGAGGGTGGG + Intronic
1109771763 13:66983862-66983884 CCTGCCTGAGGGTGGAGGGTGGG - Intronic
1109899916 13:68753917-68753939 CCTGCTGGGGGGTGCGGGGCTGG + Intergenic
1109915559 13:68981094-68981116 CCTACTTGAGTGTGGAGGGTGGG + Intergenic
1110020700 13:70466740-70466762 CCTACTTGAGGGTGGAGGGGAGG - Intergenic
1110050888 13:70897715-70897737 CCTACTTGAGAATGGAGGGTAGG - Intergenic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1110431929 13:75434484-75434506 ACTACTTGAGGGTGGAGGGCGGG + Intronic
1110523321 13:76506233-76506255 CCTACTTGAGGGTGGAGGGAGGG + Intergenic
1110743165 13:79020987-79021009 CCTACCTGAGAGTGGAGGGTGGG + Intergenic
1111000656 13:82175484-82175506 CCTACTTGAGGGTGGAGGGATGG + Intergenic
1111101410 13:83593175-83593197 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1111194576 13:84857282-84857304 CCTGTCTGGGGGTGGGGGGCTGG - Intergenic
1111449909 13:88401513-88401535 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1112227398 13:97553285-97553307 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1112446199 13:99466434-99466456 CCTACTTGAGGGTGGAGGGTTGG - Intergenic
1112580941 13:100675482-100675504 CCTGGATGGGAGTGGAGGTTTGG - Intergenic
1112748877 13:102559973-102559995 CCTGTTGGGGAGTGGGGTGCTGG + Intergenic
1112866393 13:103906265-103906287 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1112908623 13:104454797-104454819 CCTGTTGGAGGGTGGAGGGCAGG + Intergenic
1112912576 13:104506291-104506313 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1113247796 13:108417966-108417988 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1113437964 13:110307615-110307637 CCTGCTTGGGAGTAGAAAGGGGG + Intronic
1113919428 13:113898819-113898841 TCTGGTCGGGAGTGGGGGGCAGG - Intergenic
1114153207 14:20069055-20069077 CCTGCTTGATAGTGTAGGGTGGG + Intergenic
1114202745 14:20538297-20538319 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1114374349 14:22127869-22127891 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114760272 14:25306549-25306571 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1114901196 14:27061170-27061192 CCTGTTGAGGGGTGGAGGGCTGG - Intergenic
1114902534 14:27082427-27082449 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1115000769 14:28417747-28417769 CCTGTTGGAGAGTGGGGGGCAGG - Intergenic
1115005099 14:28472896-28472918 CCTACTTGAGAGTGGAGGCTGGG - Intergenic
1115035436 14:28851206-28851228 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1115283259 14:31688813-31688835 CCTACTTGAGGGTGGAGGGCGGG - Intronic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1115947368 14:38677147-38677169 CCTGACAGGGGGTGGAGGGCTGG + Intergenic
1115958685 14:38810346-38810368 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1116182578 14:41553873-41553895 CCTACTTGAGTGTGGAGGGTGGG + Intergenic
1116332170 14:43611278-43611300 CCTGCTAGGCACTGGAGGGGTGG + Intergenic
1116493701 14:45536261-45536283 AGTGCCTGGGAGTGCAGGGCAGG - Intergenic
1116553713 14:46275676-46275698 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1116558687 14:46347583-46347605 CCTGCTTGAGGGTGGAGAGAGGG + Intergenic
1116588101 14:46735830-46735852 CCTGCTTGAGCATGGAGGGTGGG - Intergenic
1116931667 14:50696892-50696914 TCTCCTTGAGAGTGGAGGGTGGG - Intergenic
1117527135 14:56620130-56620152 CCTACTTGAGAGTGGAGGCTGGG + Intronic
1117547340 14:56804422-56804444 ACTGCTGCGGGGTGGAGGGCAGG - Intronic
1117640681 14:57795949-57795971 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1117648405 14:57877157-57877179 CCTGCTTGAGAGTGGACGGTGGG - Intronic
1117686018 14:58254053-58254075 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1117838634 14:59833683-59833705 CCTACTTGAGGGTGGAGGGCGGG - Intronic
1118598822 14:67457120-67457142 CCTACTTGAGGGTGGAGGGTAGG + Intronic
1118946384 14:70391536-70391558 CCAGCTTGGGAGAGGTGGGTTGG - Intronic
1119261341 14:73239866-73239888 CCTGCAGGGGAGTCGGGGGCGGG + Intronic
1119356663 14:74012885-74012907 CCAGCTTGTGACTTGAGGGCTGG - Intronic
1119382638 14:74239075-74239097 CCTGCATAGGAGTTGAGGGAAGG + Intergenic
1119439527 14:74619017-74619039 CCTGGCTGGGGGTGGAGGGGTGG + Intergenic
1119489866 14:75022156-75022178 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1119543926 14:75458319-75458341 CCTACTTGAGGGTGGAGGGTAGG - Intronic
1119557113 14:75561758-75561780 CCTACTCGAGGGTGGAGGGCAGG - Intergenic
1119738941 14:77001335-77001357 CGGGCCTGGGGGTGGAGGGCTGG - Intergenic
1119851353 14:77868866-77868888 CCTGCTTGGCTTTGGAGGGAGGG - Intronic
1120404461 14:84077769-84077791 TGGGCTGGGGAGTGGAGGGCTGG - Intergenic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1121144343 14:91570799-91570821 GCTACTTGGGAGACGAGGGCAGG - Intergenic
1121163794 14:91771926-91771948 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1121315756 14:92960174-92960196 CCGGCTGGGGAGTAGAGGGAGGG + Intronic
1121437584 14:93929277-93929299 TGCGCATGGGAGTGGAGGGCAGG + Exonic
1121565543 14:94906826-94906848 ACTGCTTGGCAGGGGTGGGCGGG + Intergenic
1121642269 14:95493652-95493674 CCTGCCTGGGAGAAGAGGGGTGG + Intergenic
1121798026 14:96751875-96751897 CCTACTTGGGGGTGGAGGGTGGG + Intergenic
1121887919 14:97561724-97561746 GCTGGCTGGGAGTGGAGGGTGGG - Intergenic
1121942489 14:98085451-98085473 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1122036428 14:98952449-98952471 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1122958761 14:105085012-105085034 CCTGCTTGCCAGTGGAGGGTTGG - Intergenic
1123140848 14:106076538-106076560 ACTGCTGGAGAGTGGAGGGAGGG + Intergenic
1123158638 14:106255421-106255443 ACTGCTGGAGAGTGGAGGGAGGG + Intergenic
1123162924 14:106297239-106297261 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
1123217856 14:106828788-106828810 CCTACTTGAGTGTGGAGGGTGGG + Intergenic
1123574953 15:21656818-21656840 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1123611568 15:22099307-22099329 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1123630158 15:22255638-22255660 CCTCATTGGGAGTGGAGGTGGGG - Intergenic
1123979263 15:25584597-25584619 CCTAGTTGAGAGTGGAGGGAGGG - Intergenic
1124122620 15:26903108-26903130 CCTTCTTGAGGGTGGAGGGTGGG - Intronic
1124202521 15:27690622-27690644 TCTGCCTGGGAGTGGAAGACAGG + Intergenic
1124244883 15:28060196-28060218 CCTGCCTGGAACTGGAGGCCAGG + Intronic
1124798342 15:32804658-32804680 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1124999496 15:34755231-34755253 CCTGCTTGGGTCTGGCGGTCAGG - Intergenic
1125156432 15:36591999-36592021 CCTGCATGGCACTGGATGGCTGG - Intronic
1125200339 15:37096806-37096828 CCTTCTTGGGAGGTCAGGGCTGG - Intronic
1125426227 15:39552397-39552419 CCTGCTTGGCAGAGGAGGAGAGG - Intergenic
1125529173 15:40400575-40400597 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125780751 15:42264853-42264875 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1125873785 15:43126146-43126168 CCTACTTGAGGGTGGAGGGTAGG + Intronic
1126227128 15:46284049-46284071 CCTACTTGAGGGTAGAGGGCCGG - Intergenic
1126237253 15:46400475-46400497 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1126467912 15:48977249-48977271 CCTGCCTGAGGGTGGAGGGTGGG - Intergenic
1126483221 15:49150747-49150769 CCTGCTTGAGAGAGAAGGGTGGG + Intronic
1126839704 15:52705348-52705370 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1126993340 15:54409528-54409550 CCTCCTTGAGGGTGGAGGGTGGG - Intronic
1127003519 15:54538838-54538860 CCTACTTAAGAGTGGAGGGCGGG + Intronic
1127361861 15:58251463-58251485 CCTGCTTCAGAGGAGAGGGCAGG - Intronic
1128408033 15:67363708-67363730 CCTACTTGAGGGTGGAGGGTAGG - Intronic
1128523921 15:68395718-68395740 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1128671609 15:69578111-69578133 CCTAGATGGGGGTGGAGGGCTGG + Intergenic
1128739737 15:70075514-70075536 ACTGAGTGGGAGTAGAGGGCAGG + Intronic
1129158396 15:73732898-73732920 CTTTCTTGGGGGTGGAGGACAGG + Intergenic
1129229782 15:74190778-74190800 CAGGCTTGGGGGTTGAGGGCAGG + Intronic
1129644885 15:77420384-77420406 CCTGATTGGCTGCGGAGGGCGGG + Intergenic
1130405342 15:83595344-83595366 CCTGCTTGAGGGTGGAGGTTGGG + Intronic
1130847304 15:87759241-87759263 CCTGAATGGGAGGGGATGGCAGG + Intergenic
1130915244 15:88299743-88299765 GCTGCTTGGGAATGCAGGTCTGG + Intergenic
1131086032 15:89576126-89576148 CCTGCTTAGGGGTGGGCGGCAGG - Exonic
1131273644 15:90961877-90961899 CGTGCTTGAGGGTGAAGGGCAGG - Exonic
1131308009 15:91262610-91262632 TCTACTTGGGGGTGGAGGGTGGG - Intronic
1131438493 15:92441260-92441282 CCTCCTAGGGAGTCCAGGGCAGG + Intronic
1131602562 15:93864181-93864203 CCTGCTTGAGGGTGGAGGATAGG - Intergenic
1131956173 15:97738673-97738695 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1131982924 15:98013005-98013027 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1132144640 15:99421777-99421799 CCTCCTTGAGAGTGGAGAGTGGG - Intergenic
1132289017 15:100686334-100686356 CCAGCTGGAGAGTGGAGGGAAGG + Intergenic
1132293984 15:100721573-100721595 GCTGCTGGGGAAAGGAGGGCGGG + Intergenic
1132445027 15:101908808-101908830 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1202983821 15_KI270727v1_random:391062-391084 CCTGCTTGGGGGAGCAGGGAAGG - Intergenic
1132554528 16:566688-566710 CCTGCTTGGGGGTGGCAGCCTGG + Intergenic
1132642628 16:984723-984745 CCGTCTTGGGGGTGGTGGGCGGG - Exonic
1132675791 16:1120817-1120839 CTTGCTTGGCAGTGGGGGTCCGG - Intergenic
1132871853 16:2118898-2118920 CCTGGTTGCCAGTGGGGGGCTGG - Intronic
1133102181 16:3486289-3486311 CCTGCATCGGAGGGCAGGGCAGG - Exonic
1133206705 16:4238389-4238411 CCTGCTTGGGTGTAGTGGGCTGG - Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133261976 16:4556789-4556811 GCAGCTGGGCAGTGGAGGGCAGG - Exonic
1133454951 16:5933944-5933966 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1133535872 16:6701937-6701959 CCTGCTTGAGGATGGAGGGTGGG + Intronic
1133706196 16:8357336-8357358 CCTACTTGAGGGTGGAGGTCTGG + Intergenic
1133786297 16:8976055-8976077 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
1134040439 16:11064303-11064325 GCTGCTTTGGAATGGAGGCCAGG + Intronic
1134102240 16:11460634-11460656 GCTGCCTGGCAGAGGAGGGCAGG - Intronic
1134391899 16:13827730-13827752 CCTTCTTGAGGGTGGAGGGTCGG - Intergenic
1134520674 16:14917998-14918020 CCTGGTTGCCAGTGGGGGGCTGG + Intronic
1134550901 16:15137976-15137998 CCTGGTTGCCAGTGGGGGGCTGG - Intronic
1134689986 16:16184841-16184863 CCAGCCTGGGACTGGAGGGTGGG - Intronic
1134708346 16:16316649-16316671 CCTGGTTGCCAGTGGGGGGCTGG + Intergenic
1134715561 16:16356682-16356704 CCTGGTTGCCAGTGGGGGGCTGG + Intergenic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1134951256 16:18351996-18352018 CCTGGTTGCCAGTGGGGGGCTGG - Intergenic
1134959196 16:18395477-18395499 CCTGGTTGCCAGTGGGGGGCTGG - Intergenic
1135007460 16:18839341-18839363 CCTACTTGAGGGTGGGGGGCAGG - Intronic
1135469308 16:22715199-22715221 CCTACTTGTGGGTGGAGGGTAGG + Intergenic
1135533008 16:23270641-23270663 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1136045281 16:27610258-27610280 CCAGCCTGGGAGGGGAGAGCAGG + Intronic
1136170859 16:28488505-28488527 CCAGCTGGGTAGTGAAGGGCTGG + Intronic
1136678019 16:31931964-31931986 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1136683137 16:31979332-31979354 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136730692 16:32409265-32409287 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
1136772384 16:32852517-32852539 ACTGTTGGGGAGTGGGGGGCTGG + Intergenic
1136783771 16:32922888-32922910 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136886013 16:33930918-33930940 CCAGCAAGGGAGTGGAGGCCTGG + Intergenic
1136898232 16:34009000-34009022 ACTGTTGGGGAGTGGGGGGCTGG - Intergenic
1137357685 16:47782380-47782402 CCTATTTGGGGGTGGAGGGTGGG - Intergenic
1137463318 16:48685764-48685786 CCTGCTTGGGGGTGGAGGTTGGG + Intergenic
1137476739 16:48815881-48815903 CCTATTGGGGAGTGGAGGGTGGG + Intergenic
1137547053 16:49411620-49411642 CCTGCATGGGTGAGGAGGGAGGG - Intergenic
1137837139 16:51603459-51603481 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1138083830 16:54115962-54115984 TCTGCTGGGGTGTGGAGGGGAGG - Exonic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1138186626 16:54982387-54982409 CGGGCTGGGGGGTGGAGGGCGGG - Intergenic
1138752916 16:59445763-59445785 CCTCCTTGAGGATGGAGGGCGGG - Intergenic
1139107197 16:63841045-63841067 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1139294823 16:65891387-65891409 CCTGTTTGAGGGTGGAGGGTGGG - Intergenic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139515006 16:67447560-67447582 ACAGCTGGGGAGTGGAGGGCCGG + Intronic
1139650762 16:68361103-68361125 GGTGCTTGGGGGAGGAGGGCAGG - Exonic
1139667750 16:68470317-68470339 CCTGCTTGGAGGTGGAGTGATGG + Intergenic
1140056083 16:71526856-71526878 TCTGCTGGGGAGTGGAAGACAGG + Intronic
1140283455 16:73576875-73576897 CCTACTTGAGCGTGGAGGGTGGG - Intergenic
1140334731 16:74094740-74094762 CCTGAGTGGGAGGGCAGGGCAGG - Intergenic
1140545348 16:75802660-75802682 CCTACCTGAGGGTGGAGGGCGGG - Intergenic
1140572787 16:76128302-76128324 CCTACTTGAGAGCAGAGGGCGGG - Intergenic
1140595475 16:76404036-76404058 CTTACTTGAGAGTGGAGGGTGGG + Intronic
1140685426 16:77429426-77429448 TCTACTTGGGGGTGGAGGGTCGG + Intronic
1140775780 16:78247790-78247812 CCTGCTTGGGTGAGGAGCACAGG - Intronic
1140781591 16:78301843-78301865 CCTTCTTGGGGTTGGAGGGCAGG + Intronic
1140873762 16:79131136-79131158 CCTGCTTGGGAAGGAAGGCCCGG - Intronic
1140942132 16:79731988-79732010 CCCACTTGAGGGTGGAGGGCAGG + Intergenic
1141128470 16:81418017-81418039 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1141579691 16:84988747-84988769 CCTGCTTGTGAGTGTGGGGTAGG - Exonic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141610866 16:85180434-85180456 AGGGCTTGGGAGTGGAGGGCCGG - Intronic
1141918608 16:87119600-87119622 CCTGCCTGGGAGTGGGGAACGGG + Intronic
1142116450 16:88358524-88358546 CCTGGGTGGGAGTGGCAGGCTGG - Intergenic
1142151006 16:88512549-88512571 CCTGCTGGGGCCTGGGGGGCAGG - Intronic
1142373209 16:89694348-89694370 CCTCCCTGGGAGTGGGAGGCTGG - Intronic
1202995705 16_KI270728v1_random:108004-108026 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203022392 16_KI270728v1_random:420346-420368 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203074807 16_KI270728v1_random:1114615-1114637 ACTGTTGGGGAGTGGGGGGCTGG + Intergenic
1203086428 16_KI270728v1_random:1186890-1186912 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1142589710 17:997369-997391 CCTGCGTGGGAGGTGAGGCCGGG + Exonic
1142669777 17:1482778-1482800 CCAGTGTGGGAGGGGAGGGCAGG - Intronic
1143148184 17:4789883-4789905 GCGGCGTGGGAGCGGAGGGCGGG + Exonic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143906925 17:10216424-10216446 CCTGCCTGGGAGTGCAGCCCAGG + Intergenic
1144232266 17:13219910-13219932 CCTACTTAAGGGTGGAGGGCAGG - Intergenic
1144232429 17:13221228-13221250 CCTACTCGAGAGTAGAGGGCGGG + Intergenic
1144351018 17:14396484-14396506 GCTGCTTGGGATGGGTGGGCTGG + Intergenic
1144379882 17:14684207-14684229 CCTGCTGGAGAATGGAGGGTGGG - Intergenic
1144385365 17:14744493-14744515 CCTGGTTTGGAGTGCAGGGGCGG - Intergenic
1144577236 17:16436808-16436830 CCTCCTTGGGAGGGGAAGCCAGG - Exonic
1144602685 17:16632165-16632187 CCTGCATGTCAGTTGAGGGCAGG - Intronic
1144642252 17:16944009-16944031 CTTGGTGGGGAGAGGAGGGCAGG - Intronic
1144790421 17:17855323-17855345 CAGGCTTGGGTTTGGAGGGCGGG - Intronic
1144956040 17:19019401-19019423 CCTGCAGGCGAGTGGAAGGCAGG - Exonic
1145838479 17:27973158-27973180 TCTGCTTGACAGTGGAGTGCTGG + Intergenic
1145855786 17:28155773-28155795 CCTGTCGGGGGGTGGAGGGCTGG + Intronic
1146225877 17:31065829-31065851 ACTGCCTGGGAGTGGAGAGGGGG + Intergenic
1147144046 17:38475041-38475063 CCAGCAAGGGAGTGGAGGCCTGG - Intronic
1147190390 17:38735103-38735125 CCACCTTGGGGGTGGGGGGCGGG - Exonic
1147517731 17:41138051-41138073 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1148093217 17:45034999-45035021 CCTGCTTGGGAGAGGCCAGCGGG + Exonic
1148171620 17:45525838-45525860 CCTGTTTGGGTGGGGAGGGGAGG - Intergenic
1148277750 17:46320571-46320593 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148299957 17:46538426-46538448 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148364402 17:47042711-47042733 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148466691 17:47869194-47869216 CCAGCTTGGCAGGGGAGGGGAGG - Intergenic
1148818358 17:50346428-50346450 CCTGCTGGGGAAGGGAGTGCCGG - Intronic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149280680 17:55102274-55102296 CCTGTCTTGGGGTGGAGGGCTGG - Intronic
1149395220 17:56234500-56234522 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1149596130 17:57865740-57865762 CCTGCTTGGGTTGGGTGGGCTGG - Intronic
1149742043 17:59055766-59055788 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1150094657 17:62362981-62363003 CCTGTCGGGGGGTGGAGGGCTGG + Intergenic
1150402546 17:64870873-64870895 CCTGTTTGGGTGGGGAGGGGAGG - Intronic
1150423751 17:65060061-65060083 CCTACTTGAGGGTGGAAGGCAGG + Intergenic
1150439647 17:65180798-65180820 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1150459934 17:65341845-65341867 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1150615104 17:66764370-66764392 CCTGGTAGAGAGTGGAAGGCTGG + Intronic
1150631267 17:66882031-66882053 CATGCTGGGGAATGGAGGGAGGG + Intronic
1150831670 17:68526759-68526781 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1151060710 17:71090571-71090593 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1151069807 17:71196035-71196057 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1151253590 17:72857132-72857154 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1151290596 17:73147168-73147190 CCAGCCTGGGAGTGGGGGTCAGG - Intergenic
1151973508 17:77471269-77471291 CCTGCTTGGGGGTAGGGGACAGG - Intronic
1152287738 17:79422400-79422422 CCGGCCTGGGAGTGGAGGGCCGG - Intronic
1152323922 17:79624714-79624736 GCTGCCTGTGAGTGGAGGGTCGG - Intergenic
1152361997 17:79837158-79837180 GCTGCTTGGTGGTGGAGGGGTGG - Intronic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1153140968 18:1972065-1972087 ACTCCTTGGGAGTGGAGGGATGG + Intergenic
1153329150 18:3855273-3855295 CCTACTTGAGGGTGGAGGGAGGG + Intronic
1153360140 18:4185408-4185430 CCTACTTGGGAGTCGAGGGTTGG - Intronic
1153399906 18:4672516-4672538 CCTACTTGAGTGTGGAGGGTAGG + Intergenic
1153450231 18:5219054-5219076 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
1153876744 18:9379505-9379527 CCTACTTGAGGGTGGAGGACGGG + Intronic
1153982414 18:10321678-10321700 CCTGCTGGGGAGGGCAGGACTGG - Intergenic
1154183115 18:12154961-12154983 TCTGCTTGAGAGTGGAAGGTGGG + Intergenic
1154338957 18:13487813-13487835 CCTGCCTTGGAGTGGAGTGCTGG + Intronic
1155110112 18:22706412-22706434 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1155722899 18:29041304-29041326 CCTGTTGGGGGGTGGGGGGCGGG - Intergenic
1156168511 18:34453579-34453601 CCTACTTGAGAGTGGAGAGTGGG + Intergenic
1156181998 18:34615740-34615762 CCTACTTCAGAGTGGAGGGTGGG - Intronic
1156191469 18:34726090-34726112 CCTGTCGGGGAGTGGGGGGCTGG + Intronic
1156258859 18:35425973-35425995 CCTACTTGAGGGTGGAGGGAGGG + Intergenic
1157144339 18:45146238-45146260 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1157337020 18:46748064-46748086 CCTGTCAGGGGGTGGAGGGCTGG + Intronic
1157368386 18:47087538-47087560 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1157916600 18:51669705-51669727 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1157987786 18:52459348-52459370 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1158313431 18:56184309-56184331 CCTGCTTGAGGGTGGAGGTTGGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158688762 18:59641439-59641461 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1159178152 18:64865958-64865980 CCTGCTGTGGGGTGGAGGGAGGG - Intergenic
1159905535 18:74087385-74087407 CCTACTTGAGGGTGGAGGGTTGG - Intronic
1160138884 18:76301001-76301023 CCTGCTTGAGGGTAGAGGGTGGG + Intergenic
1160290016 18:77583714-77583736 CCTGTTGGGGGTTGGAGGGCTGG + Intergenic
1160551004 18:79693883-79693905 CCTGCAGGGGAGCGGAGGGGCGG - Intronic
1160640285 19:124903-124925 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1160758998 19:773127-773149 GCTGCCTGGGAGTGAGGGGCTGG + Intergenic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1162304013 19:9860568-9860590 CCTGGATGGGGCTGGAGGGCGGG + Intronic
1162332143 19:10036957-10036979 CTTGCTTGGGATTGGCTGGCAGG - Intergenic
1163059439 19:14748128-14748150 CCTGCTTGAGGGTGGAGAGTGGG - Intronic
1163181036 19:15602171-15602193 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1163452026 19:17384002-17384024 CTTGCCTGTGACTGGAGGGCTGG + Intergenic
1163531948 19:17855255-17855277 CCTGGGTTGGAGTGGAGGGAGGG - Intergenic
1164509288 19:28884414-28884436 CCTGCTTGAGGGTGGAAGGTGGG - Intergenic
1164799603 19:31065300-31065322 CCTGCTTGGGCCAGGTGGGCAGG + Intergenic
1165383963 19:35499768-35499790 ACAGTTTGGAAGTGGAGGGCAGG - Intronic
1165731928 19:38151466-38151488 CCTGCTTGGAAGTGGAGAACTGG + Intronic
1166025522 19:40080667-40080689 CCTACTTGAGAGTAGAGGGTGGG + Intronic
1166398640 19:42461544-42461566 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1166409127 19:42544717-42544739 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1166584984 19:43937752-43937774 GGGGGTTGGGAGTGGAGGGCAGG - Intergenic
1166744826 19:45136646-45136668 CCTCCTTGGGGGTGGAGGCCTGG - Intronic
1166824687 19:45601515-45601537 CCTGCTTGGGAGTGGGGTAGGGG - Intronic
1166939368 19:46353504-46353526 CCAGCTTGGGGCTGGAGGGGTGG + Intronic
1166995221 19:46716811-46716833 TCACCTTGGGGGTGGAGGGCAGG + Exonic
1167056166 19:47112626-47112648 ACTGCTTGGGCGTGGCGGGAGGG + Intronic
1167517414 19:49931048-49931070 GGAGCTGGGGAGTGGAGGGCAGG + Intronic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
1168078160 19:53991730-53991752 CCTGCTCGGGAGTCGGGGGTGGG + Intergenic
1168102247 19:54147467-54147489 GCTGCTTGGCAGTGGGGGCCTGG - Intronic
924959619 2:22250-22272 TCTGCTTGAGGGGGGAGGGCGGG - Intergenic
925404082 2:3594894-3594916 CCGGCTTTGGGGTGGGGGGCAGG - Intronic
925788515 2:7456920-7456942 CCTGCCTGGTAGGGAAGGGCAGG + Intergenic
926394384 2:12426188-12426210 CCTGCTTGTGAATGGATGGCAGG + Intergenic
926527441 2:13998757-13998779 CCTGTCGGGGAGTGGGGGGCTGG + Intergenic
926556091 2:14359838-14359860 CCTACTTGAGAGTGGAGGATGGG + Intergenic
926661282 2:15469830-15469852 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
926794484 2:16607706-16607728 CCTGCTTGGGAGGCTAAGGCAGG - Intronic
926866878 2:17370022-17370044 CCTGTTTTGGAGTGGGGGGAGGG - Intergenic
926981868 2:18580930-18580952 CCTACTTGAGGGTGGAGGGTGGG + Intronic
927320212 2:21735034-21735056 CCTGTTTGGGAGTGGAGTGCGGG + Intergenic
927376700 2:22424809-22424831 CCTACTTGAGAGTGGATGGAGGG - Intergenic
927387176 2:22548190-22548212 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927565616 2:24110273-24110295 CCTGCTTGAGAGTGGAGGGTGGG + Intronic
927603854 2:24468479-24468501 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
928233976 2:29524034-29524056 CCTGGGTGTGGGTGGAGGGCAGG + Intronic
928322494 2:30294960-30294982 CCTGCTGGGGAATGGAGTGAGGG - Intronic
929582652 2:43092688-43092710 ACTGCTTGGGGCTGGATGGCTGG + Intergenic
929598857 2:43192608-43192630 CCTACTTGGGAGTCTAAGGCAGG + Intergenic
929869356 2:45745255-45745277 CCTGGTGGGGAGAGGAGGCCCGG + Intronic
930147244 2:48019790-48019812 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
930233639 2:48868049-48868071 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
930365616 2:50435795-50435817 CCTTCTTGAGGGTGGAGGGAAGG + Intronic
930475897 2:51881723-51881745 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930931739 2:56892993-56893015 CCTGCTGTGGGGTGGAGGGAAGG - Intergenic
931502170 2:62881233-62881255 CCTACTTGTGGGTGGAGGGTGGG + Intronic
931643434 2:64400996-64401018 CCTGCTAGGAAGGGGAGGTCTGG + Intergenic
931668647 2:64627536-64627558 CCTGCCTGAGAGGGGAGGGAGGG + Intergenic
931921676 2:67023790-67023812 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
931983020 2:67714399-67714421 CCTACTTGAGAGTGGAGGGTAGG - Intergenic
932033478 2:68215123-68215145 CCTACTTGACAGTGGAGGGTGGG + Intronic
932205477 2:69877244-69877266 CCTGTTTGGGAATGGAGAGTGGG + Intronic
932222575 2:70011098-70011120 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
932296543 2:70628397-70628419 CCTCCTTGAGGGTGGAGGGTAGG - Intronic
932666907 2:73705371-73705393 GCTGGTTGGGAGTGGAGGGCTGG + Intergenic
932827161 2:74952030-74952052 CCTGCTTGAGGGTGGAGGGTGGG + Intergenic
933604515 2:84368286-84368308 CCTACTTGAGAGTGAAGGGTGGG + Intergenic
934315027 2:91909984-91910006 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
934655851 2:96116559-96116581 CCTGCAGGGGAGTGGGGAGCGGG + Intergenic
934656455 2:96118919-96118941 CCTGCGTGGCCGTGGAGAGCTGG - Intergenic
934662238 2:96149101-96149123 CCTGCTTGGGGGTGCACGCCAGG - Intergenic
935715961 2:105939220-105939242 CCTGCATGGGGGTGTAGAGCAGG + Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936238699 2:110768700-110768722 CCTACTTGAGAGAGGAGGGTGGG - Intronic
936857120 2:116972049-116972071 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
937397731 2:121553183-121553205 CCTACTTGAGGGTGGAGGGTGGG + Intronic
937451259 2:122003491-122003513 GCTGCCAGGGTGTGGAGGGCAGG + Intergenic
937503227 2:122506405-122506427 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
937946061 2:127338482-127338504 CCTGCGAGAGGGTGGAGGGCAGG - Intronic
938215971 2:129515629-129515651 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
938395021 2:130939053-130939075 CCTACTTGAGGGTGGAGGGCAGG - Intronic
938623408 2:133082034-133082056 CCTACTTGAGGGTGGAGGGTGGG - Intronic
939710928 2:145519283-145519305 CCTGTCTGGGAGTGGGAGGCTGG - Intergenic
939947828 2:148431539-148431561 CCTACTTGAGAGTGGAGGTGGGG - Intronic
940033577 2:149289893-149289915 CCTGCTTGGTGGTGGAGGGAGGG + Intergenic
940160781 2:150711129-150711151 TCTGCGTGGGGGTGGAGGGGTGG + Intergenic
940260940 2:151779081-151779103 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
940989982 2:160086981-160087003 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
941124961 2:161573553-161573575 CCTACTTGAGAGTGGAGGATGGG - Intronic
941818045 2:169817758-169817780 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
941860935 2:170279614-170279636 CCTACTTGAGGGTGGAGGGTGGG - Intronic
942002164 2:171658861-171658883 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
942198076 2:173542672-173542694 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
942216668 2:173727658-173727680 CCTGCTTGAGGTTGGAGGGTGGG + Intergenic
942445176 2:176072771-176072793 CCTGCTTGGGGGTCGGGGTCGGG + Intergenic
942493658 2:176516214-176516236 CTTTCTTGGGAGAGCAGGGCAGG + Intergenic
942532174 2:176922915-176922937 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
942901797 2:181129067-181129089 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
943037912 2:182768973-182768995 CCTGTTGGGGAGTTCAGGGCTGG - Intronic
943164719 2:184306356-184306378 CCTATTTGAGAGTGGAGGGTAGG - Intergenic
943205486 2:184887964-184887986 CCTACTTGAGAGTGGAGGTTGGG + Intronic
943312017 2:186337547-186337569 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
943500816 2:188687436-188687458 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
944021301 2:195107701-195107723 CCTACTTGAGAGTGGAGGGTAGG + Intergenic
944085854 2:195847484-195847506 CCTACTTGAGGGTGGAGGGTGGG + Intronic
944090816 2:195909074-195909096 CCTGTTTGAGGGTGGAGGGTGGG + Intronic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
944691327 2:202161013-202161035 TGTGCATGAGAGTGGAGGGCAGG + Intronic
944774183 2:202945461-202945483 TCTACTTGAGAGTGGAGGGTGGG - Intronic
944876936 2:203971968-203971990 CCAGGTTGGGAGTGGAAGGAAGG - Intergenic
944899886 2:204203439-204203461 CCTGCTTTGGAGTTGAAGCCAGG + Intergenic
945031146 2:205664877-205664899 CCTGCTTGAGGGTGGAGGGAGGG - Intergenic
945160924 2:206889688-206889710 CCTTCTTGAGAGTGGAGGGAAGG - Intergenic
945346716 2:208726603-208726625 CCTACTTGAGACTGGAGGGTAGG - Intronic
945382903 2:209162766-209162788 CCTGTTGGAGAGTGGAGGGTGGG - Intergenic
945728693 2:213505790-213505812 CCTGACTGGGTGTGGAGGGATGG - Intronic
945798584 2:214395678-214395700 CCTACTTGAGGGTGGAGGGTGGG - Intronic
946591309 2:221251101-221251123 CCTACTTGAGGGTGGAGGACAGG + Intergenic
946878329 2:224152396-224152418 CCTACTTGAGAGTGGAAGGTGGG - Intergenic
946887021 2:224231449-224231471 ACTGCTTGTGGGTGGAGGGTGGG - Intergenic
947220274 2:227785044-227785066 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947257766 2:228183830-228183852 TGTGATTGGGAGTGGGGGGCAGG - Intergenic
947469449 2:230387046-230387068 CTTGCGTGGGAGAGGAGGGGAGG + Intronic
947516659 2:230811327-230811349 TCTTACTGGGAGTGGAGGGCAGG - Intronic
947779354 2:232743560-232743582 TCTACTTGGGGGTGGAAGGCAGG - Intronic
947940426 2:234049692-234049714 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947998539 2:234548403-234548425 TCTACTTGGGGGTGGAGGGTGGG + Intergenic
948118006 2:235507950-235507972 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
948373457 2:237505180-237505202 CCTGATGCAGAGTGGAGGGCAGG + Intronic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948635168 2:239330032-239330054 GCAGCTTGGGCTTGGAGGGCAGG - Intronic
948726602 2:239938115-239938137 ACTGCTGGGGAGTGGGGTGCTGG - Intronic
948741954 2:240054025-240054047 CGTGCTCGGGTGTGGAGGGAGGG - Intergenic
948757185 2:240166580-240166602 CCTGCCTGTGTGTGGTGGGCGGG + Intergenic
948920715 2:241064731-241064753 CCTGCGTGGGTGTGGAGGGGCGG - Intronic
949054621 2:241921063-241921085 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1168852929 20:989068-989090 CCAGCTTGGGAGATGGGGGCCGG - Intronic
1168858702 20:1029271-1029293 AGTGCTTGGGAGGGGAGAGCAGG - Intergenic
1168882871 20:1223148-1223170 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
1169024637 20:2358856-2358878 CCTACTTGGGGGTGGAGGGTGGG - Intergenic
1169142374 20:3233782-3233804 CCAACTTGGGAGAAGAGGGCTGG - Intronic
1169150391 20:3285013-3285035 TCAGAATGGGAGTGGAGGGCAGG - Intronic
1169177309 20:3528579-3528601 CCTGCTTGAGGGTGGAGAGTGGG + Intronic
1170917514 20:20642041-20642063 CCTGCTTGGGAGAGGAGGACAGG - Intronic
1171117905 20:22542476-22542498 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1171232051 20:23494963-23494985 CCTCCTGGAGAATGGAGGGCGGG - Intronic
1171422229 20:25025008-25025030 CCTGCTTGGGGATGTAGGTCTGG - Intronic
1171498180 20:25572323-25572345 CCTCCCTGGGAGTGCAGTGCTGG + Intronic
1172109801 20:32538284-32538306 CCTGATTGTGGGTGGGGGGCAGG - Intronic
1172402465 20:34661361-34661383 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1172784363 20:37456949-37456971 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1173517649 20:43676269-43676291 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174794480 20:53510755-53510777 CCAGGGTGGGACTGGAGGGCAGG - Intergenic
1175116925 20:56689343-56689365 CCAGCTGGGGAGTCCAGGGCTGG + Intergenic
1175327995 20:58142903-58142925 GCTGCTGGGGTGTGGAGGCCTGG - Intergenic
1175490033 20:59373945-59373967 CCTCCTTGGGGGTTGGGGGCAGG + Intergenic
1175689271 20:61054034-61054056 CCTCCTTGTGGGTGGAGGGAGGG - Intergenic
1175776778 20:61658762-61658784 GCTGCCTGGGAGTGGGGGGGTGG - Intronic
1175837594 20:62006126-62006148 CCTGCGTGGGACAGGTGGGCAGG - Intronic
1175903677 20:62369758-62369780 CCAGTCTGGGAGTGGAGGGGAGG + Intergenic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176962172 21:15171680-15171702 CCAGCCTGGGCGAGGAGGGCGGG - Intergenic
1177658553 21:24052048-24052070 CCTGTTGTGGGGTGGAGGGCAGG - Intergenic
1177758811 21:25379453-25379475 TCTACTTGGGGATGGAGGGCGGG + Intergenic
1178019351 21:28391806-28391828 CCTACTTGAGAGTGGAGGATGGG + Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178343039 21:31802088-31802110 ACTGTTTGGTAGTGGAGGGAGGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1178489517 21:33040230-33040252 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1178661295 21:34509911-34509933 GCTACTTGAGAGTGGAGGGTGGG - Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1179164328 21:38924129-38924151 CTTGCTCTGGAATGGAGGGCGGG + Intergenic
1179359343 21:40690924-40690946 CCTACTTCGGGGTGGAGGGTGGG + Intronic
1179495557 21:41769362-41769384 CCCGCCTGGGAGTGCAGTGCAGG + Intergenic
1179937530 21:44614611-44614633 CCTGCCTGGGGGTGTTGGGCTGG + Intronic
1180541782 22:16455868-16455890 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1181111312 22:20604548-20604570 CCTGCAAGGGAGGCGAGGGCAGG + Intergenic
1181235534 22:21445885-21445907 CCTTCTTCCGAGTGGAGTGCCGG - Exonic
1181326315 22:22051111-22051133 CTTGTTTGGGGGTGGGGGGCTGG - Intergenic
1181548481 22:23620189-23620211 GCTGCTTGGGAGGTGAGGGAGGG - Intronic
1181860790 22:25816491-25816513 CCTGTCTGGGGGTGGGGGGCTGG - Intronic
1182591140 22:31381111-31381133 CCTACTTGAGGGTGCAGGGCGGG - Intergenic
1182850429 22:33469510-33469532 CCCACTTGGGTGTGGAGGGTGGG + Intronic
1183025205 22:35060032-35060054 CCTGCTTGAGAGTGGAGGGTAGG + Intergenic
1183094040 22:35541483-35541505 CCTACCTGGGAATGGCGGGCCGG - Exonic
1183235975 22:36618029-36618051 CCTGGGTGGAGGTGGAGGGCAGG + Intronic
1183350185 22:37330646-37330668 CCTGCTTCTGATTGGAAGGCTGG - Intergenic
1183358784 22:37372770-37372792 TCTGCTGGGGTGTGCAGGGCCGG - Exonic
1183365178 22:37403181-37403203 CCTGCCTGGGGGTGGGGGGAGGG - Intronic
1183767637 22:39893663-39893685 TCTGCTTGGGAGTGGTGGTGGGG - Intronic
1184156538 22:42671211-42671233 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1184259774 22:43307997-43308019 CCTGCTTGGGATTGGGTGGGGGG - Intronic
1184647618 22:45904673-45904695 CCTACTTGAGGGTGGAGGGTCGG - Intergenic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1184822623 22:46921237-46921259 CCTGCCTGAGGGTGGAGAGCGGG - Intronic
1185231046 22:49683026-49683048 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1185274259 22:49943625-49943647 CCTGCAGGGGCCTGGAGGGCTGG - Intergenic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
949120417 3:377309-377331 TGTACTTGGGAGTGGAGGGGCGG + Intronic
949287477 3:2423926-2423948 CCTGCTGTGGGGTGGAGGGAGGG + Intronic
949321186 3:2812116-2812138 CCTGTTAGAGAGTGGAGGGCGGG + Intronic
949376380 3:3394591-3394613 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
949712393 3:6886338-6886360 CCTGTTTGGGAGTGAGGGGCTGG + Intronic
950487065 3:13280163-13280185 CCGGCTGGGAAGTGCAGGGCTGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950613132 3:14138873-14138895 CCTGCTCAGGGGTGGTGGGCAGG + Intronic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
950860922 3:16146608-16146630 CCTCCCTGCGAGTGGAGGGGGGG + Intergenic
951070317 3:18320638-18320660 CCTACTTGAGGGTGGAGGGTGGG - Intronic
951171294 3:19544804-19544826 CCTGTCTGGGAGTTGGGGGCTGG + Intergenic
951517908 3:23582053-23582075 CCTACTTGAGGGTGGAGGGTGGG - Intronic
951764890 3:26186677-26186699 CCCGTCTGGGAGTGGAGGGTGGG + Intergenic
952413500 3:33069956-33069978 CCTACTTGAGGGTGGAGGGTGGG - Intronic
952846937 3:37695715-37695737 CTTGCTTGGGAGAGCAGGACAGG - Intronic
952881245 3:37987340-37987362 CCTGCTAGGGGGAGGAGGGAGGG + Intergenic
953079636 3:39603748-39603770 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
953080741 3:39615146-39615168 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
953745143 3:45568373-45568395 CGTGCTTGAGGGTGGAGGGTGGG - Intronic
953745217 3:45568789-45568811 CCTGCTTGAGGGTGGAGGGAGGG - Intronic
953752194 3:45617406-45617428 CCTGCCTGGGAGTGTAACGCAGG - Intronic
953842754 3:46402889-46402911 TCTACTTGAGACTGGAGGGCGGG - Intergenic
954197053 3:49003104-49003126 ACTGCTGGGGAGGGGTGGGCAGG + Intronic
954362271 3:50128387-50128409 CCTGCTTGGCAGAGCTGGGCTGG - Intergenic
954379780 3:50213314-50213336 CCTGCCTGGCAGTGGAGGAGAGG + Intronic
954452816 3:50580786-50580808 CCTGCTTGGTAGTGGTGTGGGGG + Exonic
954583605 3:51716828-51716850 TCAGCTTGGGAGTGCAGAGCAGG + Intronic
954698993 3:52441959-52441981 CCTGCTTGGGTGTGGGCTGCTGG - Intronic
954960298 3:54558567-54558589 CCTACTTGAGGGTGGAGGGTGGG - Intronic
955049891 3:55400270-55400292 TCTGCTTGAGAGTGGACGGTAGG + Intergenic
955263091 3:57414538-57414560 CCTCCTTGAGAGTGGAGCGGGGG - Intronic
955886243 3:63601495-63601517 TCTACTTGAGAGTGGAGGGTGGG - Intronic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
956113729 3:65897461-65897483 CCTGCTGTGGGGTGGGGGGCAGG + Intronic
956295543 3:67709363-67709385 CCTCCATGGGAGTGGGGAGCTGG + Intergenic
956396036 3:68827033-68827055 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
956737576 3:72249713-72249735 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
956933236 3:74070342-74070364 CCTACTTGGGAGTGGAGGGTGGG + Intergenic
957899857 3:86475099-86475121 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
957951327 3:87131166-87131188 GCTACTTGGGGGTGGAGGGTGGG - Intergenic
958009133 3:87853222-87853244 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
958063769 3:88516971-88516993 CCTGCTTGAGGGTGGAGGGCAGG - Intergenic
958259686 3:91366264-91366286 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
958514966 3:95102457-95102479 TCTGCTTGAGAGTGGAGGATGGG + Intergenic
958773109 3:98449467-98449489 CCTGTTAGGGAGTGGGGGGTGGG + Intergenic
958866334 3:99505952-99505974 TCTGCTTTGGAGGGGAGGGTTGG - Intergenic
958874731 3:99603284-99603306 CCTACTTGAGGGTGGAGGGCGGG - Intergenic
959041553 3:101427844-101427866 CCTGTTGGGGAGTGGGGGGCTGG - Intronic
959128243 3:102317615-102317637 CCTGCTTGAAAGTGGAGGGTGGG - Intronic
959215835 3:103448903-103448925 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
959268753 3:104177328-104177350 CCCACTTGAGAGTGGAGAGCAGG - Intergenic
959285408 3:104402213-104402235 CCTACTTGAGACTGGAGGGTGGG + Intergenic
959310799 3:104734397-104734419 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
959610591 3:108290490-108290512 TCTACTTGAGAGTGGAGGGTGGG - Intergenic
959950245 3:112173430-112173452 CCTACTTGAGAGTGGAGTGTAGG - Intronic
960033821 3:113083111-113083133 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
960081897 3:113550912-113550934 CCTGCTGGAGGGTGGAGGGTGGG - Intronic
960146648 3:114210891-114210913 CCTGTTGAGGGGTGGAGGGCTGG + Intergenic
960197404 3:114786290-114786312 CCTGTTGGGGAGTGGGGGTCTGG - Intronic
960342628 3:116493101-116493123 CCTACTTGAGGGTGGAGGGTGGG + Intronic
960719832 3:120615262-120615284 CCTGCTGGTGAGTGGGGGGCTGG - Intergenic
960907974 3:122620718-122620740 GCTGCCTGGGAGGGGAGGGTGGG + Intronic
961044394 3:123698849-123698871 TCTGCTTGTGAGGGGAAGGCAGG + Intronic
961388373 3:126537283-126537305 CCTGGCGGGGAGTGGAGGACAGG + Intronic
961918720 3:130404005-130404027 CCTGCTTGGGGGTAGAGAGGAGG - Intronic
962073902 3:132060209-132060231 TCTACTTGAGAGTGGAGGGTGGG - Intronic
962123540 3:132589864-132589886 TCTGCTTGAGGGTGGAGGGTGGG - Intronic
962174213 3:133135847-133135869 CTTGTTTGGGAGTGGAGGGAGGG + Intronic
962233482 3:133687188-133687210 CCTGTTTTGGAGTGGGGGGAGGG + Intergenic
962265126 3:133939290-133939312 CCAGCTGGGGAGTGGAGAGAGGG + Intronic
962470325 3:135702061-135702083 CCTATTTGAGAGTGGAGGGTGGG + Intergenic
962691679 3:137905411-137905433 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
962713840 3:138110294-138110316 CCTGTTGGGGGATGGAGGGCTGG + Intronic
962955250 3:140259962-140259984 CCTACTTGAGGGTGGAGGGTGGG + Intronic
963035040 3:141018817-141018839 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
963069925 3:141295688-141295710 CCTGTTGTGGAGTGGGGGGCTGG - Intergenic
963329529 3:143898726-143898748 CCTACTTGAGAGTAGAGGGCAGG + Intergenic
963576486 3:147066812-147066834 CCTATTTGGGGGTGGAGGGCAGG + Intergenic
963579770 3:147110662-147110684 CCTACTTGAGAATGGAGGGTGGG - Intergenic
963597644 3:147347720-147347742 CCTACTTGGGAGGCTAGGGCAGG + Intergenic
963823077 3:149921449-149921471 CCTGTTGGGGGGTGGAGGGCTGG - Intronic
963831207 3:150011608-150011630 CCTACTTGAGGGTGGAGGGTGGG + Intronic
963993847 3:151684269-151684291 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
964111135 3:153088967-153088989 CCTGTTGGGGAGTCGGGGGCTGG - Intergenic
964177462 3:153841452-153841474 TCTACTTGAGGGTGGAGGGCAGG - Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
964646944 3:158968826-158968848 TCTGCTAGGGAGTGGAGAGAGGG - Intronic
964868445 3:161287541-161287563 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
965036719 3:163449339-163449361 CCTACTTGAAAGTGGAGGGTGGG + Intergenic
965466776 3:169039569-169039591 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
966091032 3:176136558-176136580 CCGACTTGGGGGTGGAGGGTGGG - Intergenic
966442714 3:179964152-179964174 CCTGCTTGAAGGTGGAGGGTGGG - Intronic
966663497 3:182444006-182444028 CCTACTTGAGGATGGAGGGCGGG + Intergenic
967215241 3:187204096-187204118 CTTGCTTGGGAGTTGAGGGGAGG - Intergenic
967269897 3:187724888-187724910 CCTGCGGGGATGTGGAGGGCAGG - Intronic
967314091 3:188134460-188134482 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
967434128 3:189424972-189424994 CCTCCTTGGGACTGGAGGGCTGG + Intergenic
967605531 3:191440912-191440934 CCCACTTGGGTGTGGAGGGTGGG + Intergenic
967619074 3:191610030-191610052 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
967708517 3:192679696-192679718 CCTGGTTGGCAGTGGTGGACGGG - Intronic
968040469 3:195584701-195584723 ACTGCTTGGGGGTGGGGGCCGGG + Intergenic
968260003 3:197313643-197313665 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968665253 4:1817863-1817885 ATTGCTTGGGAGTGGGAGGCTGG - Intronic
968861260 4:3172561-3172583 CCTCCTGGGGAGTGAAGGGAAGG - Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969348933 4:6586955-6586977 CCTGCTGGTGCCTGGAGGGCGGG - Intronic
970797537 4:19931452-19931474 CCTGCTTGAGAGTGGAGGGTAGG + Intergenic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
971413152 4:26396646-26396668 CCTATTTGGGAGTGGGAGGCGGG + Intronic
971602635 4:28614776-28614798 CCAGCTTGAGGGTGGAGGGTGGG - Intergenic
971829501 4:31672403-31672425 CCTCCTTGAGGGTGGAGGGTGGG - Intergenic
972125909 4:35765418-35765440 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
972674470 4:41246126-41246148 CTTGATTTGGAGTGAAGGGCAGG + Intergenic
973067888 4:45820199-45820221 CCTGTTTGGGGGTGGGGGACTGG + Intergenic
973116006 4:46460202-46460224 CCTGCCTGAGGGTGGAGGGAGGG - Intronic
973149716 4:46872314-46872336 CCTACTTGAGGGTGGAGGGTGGG + Intronic
973289079 4:48452357-48452379 TCTACTTGAGAGTGGAGGGTGGG + Intergenic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
974169136 4:58243852-58243874 CCTGTCTGGGGGTGGAGGGCTGG + Intergenic
974230560 4:59108750-59108772 CCTGTCTGGGGGTGGAGGGCTGG - Intergenic
974444608 4:61963412-61963434 CCTTCTTGAGAGTGGAGGGTGGG - Intronic
974515307 4:62900363-62900385 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
974678790 4:65134022-65134044 CCTACTTGAGGATGGAGGGCAGG + Intergenic
974765996 4:66347269-66347291 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
974807091 4:66894583-66894605 CCTCTTTGGGAGGGGAGGCCTGG - Intergenic
974854386 4:67441893-67441915 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
975358655 4:73440210-73440232 CCTGTCAGGGAGTGGAGTGCAGG - Intronic
975443319 4:74436854-74436876 GCTGCTTGGAGGTGGGGGGCAGG + Intergenic
975525264 4:75341843-75341865 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
975598028 4:76068619-76068641 CCTACTTGAGGGTGGAGGGTGGG + Intronic
975950201 4:79761410-79761432 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
976001816 4:80383173-80383195 CCTACTTGAGGGTGGAGGGTGGG + Intronic
976661578 4:87545624-87545646 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
976851619 4:89553551-89553573 CCTACTTGAGATTGGAGGGTGGG - Intergenic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
977049846 4:92116108-92116130 CCTGTTGGGGGGTGGAGGGAGGG - Intergenic
977195063 4:94047939-94047961 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
977266626 4:94863181-94863203 CCTACTTGATGGTGGAGGGCAGG + Intronic
977886551 4:102258351-102258373 TCTGCTTGGGAGTGAAGGACTGG + Intronic
977947260 4:102928069-102928091 CCTGTCGGGGGGTGGAGGGCTGG + Intronic
978252990 4:106655610-106655632 CCTACTTGAGAGTAGAGGGTGGG + Intergenic
978287054 4:107091831-107091853 CCTACTTGAGGGTGGAGGGTGGG + Intronic
978347719 4:107788905-107788927 TCTGCTTTGGAGTGGATGCCAGG + Intergenic
978949486 4:114540449-114540471 CCTCCTTGAGGGTGGAGGGTAGG - Intergenic
979208479 4:118071410-118071432 CCTACTTGAGGGTGGAGGGTAGG - Intronic
979281910 4:118878198-118878220 CCTACTTGAGGGTGGAGGGTAGG + Intronic
979590597 4:122475258-122475280 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
979741932 4:124161798-124161820 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
980002635 4:127508341-127508363 CCTGCTGTGGTGTGGAGAGCTGG - Intergenic
980635869 4:135501959-135501981 CCTGCTTGAGGGTGGAGGGAGGG + Intergenic
980747272 4:137034692-137034714 TCTACTTGCGAGTGGAGGGTGGG + Intergenic
981079029 4:140619943-140619965 CCTCCTTGAGGGTGGAGGGTGGG - Intergenic
981200216 4:141971688-141971710 CCTGTTTGGGGGTCGGGGGCTGG + Intergenic
981275193 4:142891352-142891374 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
981412249 4:144446162-144446184 CCTGTTAGGGGGTGGTGGGCTGG + Intergenic
981632568 4:146837337-146837359 CCTGCTTGAGAATGGAGGGTGGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982024161 4:151235187-151235209 CCTACTGGAGGGTGGAGGGCGGG - Intronic
982690520 4:158542950-158542972 CCTACTTGAGGGTGGAGGGTGGG + Intronic
983029551 4:162782786-162782808 CCTCCTTGGGTGAGGGGGGCGGG + Intergenic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983155640 4:164344216-164344238 CCTACTTGAGGGTGGAGGGAAGG + Intronic
983522077 4:168719728-168719750 CCTGCTTGAGGGTGGAGAGCGGG - Intronic
983548206 4:168985899-168985921 CCTACTTGAAAGTGGAGGGTGGG + Intronic
984793605 4:183636903-183636925 ACTGTTGGGGAGTGGAGGGGGGG - Intergenic
984861959 4:184248706-184248728 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
984947764 4:184983243-184983265 CCTGCGGCAGAGTGGAGGGCAGG - Intergenic
985379291 4:189375153-189375175 CCTGCTTGAGAGTGGAGGGTGGG - Intergenic
987013961 5:13798047-13798069 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
987320931 5:16768785-16768807 GCTGCTTGGGAGGAGAGGGTGGG - Intronic
987394521 5:17409694-17409716 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
987427005 5:17785002-17785024 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988055449 5:26088420-26088442 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988724698 5:33914849-33914871 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
989126941 5:38063904-38063926 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
989298900 5:39864849-39864871 CCTGCTTGAGGGTTGAGGGTGGG - Intergenic
989490739 5:42049409-42049431 CCTGGTTGAGGGTGGAGGGTTGG + Intergenic
989760460 5:45009574-45009596 CCTACCTGAGAGTGGAGGGTGGG + Intergenic
989794666 5:45452555-45452577 CCTACTTGAGGGTGGAGGGTGGG - Intronic
990175779 5:53106541-53106563 CCTACTTGAGGGTGGAGGGTGGG + Intronic
990687056 5:58316394-58316416 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
991024635 5:62016471-62016493 CCAGAGTGGGAGTGGAGGGTGGG + Intergenic
991455636 5:66800535-66800557 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
992054695 5:72976778-72976800 CCTGTTTGGGGGTTGGGGGCTGG - Intronic
992313872 5:75532237-75532259 CCTACTTGAGGGTGGAGGGTGGG - Intronic
992593320 5:78318689-78318711 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
992744049 5:79801925-79801947 CTCACTGGGGAGTGGAGGGCTGG - Intergenic
992809666 5:80374034-80374056 CCTACTTGAGAGTGGAAGGTGGG - Intergenic
992857993 5:80883604-80883626 CCTCCTTGAGGGTGGAGGGTGGG - Intergenic
993062412 5:83054676-83054698 CCTACTTGAGGGTGGAGGGTGGG + Exonic
993273929 5:85831841-85831863 CCTGCTTGAGGGTGGAAGGTGGG + Intergenic
993345038 5:86772466-86772488 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
993413383 5:87598105-87598127 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
993985195 5:94589013-94589035 CCTGTTGGCGGGTGGAGGGCTGG + Intronic
994388838 5:99165384-99165406 CCTGCTGGGGGGTGGGGGGATGG - Intergenic
994535969 5:101029793-101029815 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
994567226 5:101465616-101465638 ACTGCTAGAGAGTGGAGGGAGGG - Intergenic
994621383 5:102166944-102166966 CCTGCTGTGGGGTGGAGGGAGGG + Intergenic
994748655 5:103710915-103710937 CCTCCTGGGGAGTGTAGGCCTGG + Intergenic
994830971 5:104783611-104783633 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
994956109 5:106535176-106535198 CCTACTTGGGAGTGGAGGGTGGG - Intergenic
995628984 5:114112321-114112343 CCTGTTTGGAGGTGGGGGGCTGG + Intergenic
995717975 5:115099171-115099193 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
995778610 5:115752175-115752197 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
996032548 5:118721924-118721946 CCTACTTGACTGTGGAGGGCTGG + Intergenic
996141430 5:119913817-119913839 GGTCCTTGGGAGTGGAAGGCAGG - Intergenic
996142339 5:119927800-119927822 CCTACTTGAAAGTGGAGGGTGGG - Intergenic
996888244 5:128385209-128385231 CCTACTTGAGAGTGGAAGGTGGG - Intronic
997099730 5:130955917-130955939 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
997618981 5:135272599-135272621 CCTGCATGGGAGTGGCGGGGAGG + Intronic
997790905 5:136761189-136761211 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
998017559 5:138744645-138744667 CCTACTTGAGAGCGGAGGGTGGG - Intronic
998236530 5:140402558-140402580 CCTGCTTTGGAGTTGGGGGTGGG + Intronic
998536801 5:142940470-142940492 CCTACTTGACAGTGGAGGGCGGG - Intronic
998539125 5:142962951-142962973 CCTACTTGAGAGTGGAGGGTGGG - Intronic
998594834 5:143517835-143517857 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
998604738 5:143622101-143622123 CTTACTTGGGGGTGGAGGGTAGG + Intergenic
998827042 5:146113174-146113196 GCTGCTTGGGAGTGTGAGGCAGG - Exonic
999405384 5:151302565-151302587 GCTGGTTGGGGGTGGGGGGCAGG + Intronic
999480590 5:151944677-151944699 CCTGTTGGGGAGTGAGGGGCTGG - Intergenic
999567378 5:152879822-152879844 CCTGCTTGAGGGTGGAGGGTAGG + Intergenic
1000435923 5:161208723-161208745 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1000642552 5:163719808-163719830 CCTACTTGGAGGTGGAGGGTGGG + Intergenic
1000759016 5:165197920-165197942 ACTGCTTGAGGGTGGAGGGTGGG + Intergenic
1000997884 5:167977163-167977185 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1001037908 5:168311167-168311189 GCTGCCTGGGAGGGGAGGGGAGG - Intronic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1001206277 5:169766220-169766242 CCTGCTTGAGGGTAGAGGGTGGG - Intronic
1001244371 5:170094961-170094983 CTTACTTGGGAGTGCAGGTCCGG + Intergenic
1001317425 5:170653834-170653856 CCAGGGTGGGAGTGGAAGGCTGG - Intronic
1001377185 5:171272182-171272204 CCTACTTGAGAGTGGAGAGTTGG + Intronic
1001402098 5:171451630-171451652 GCTGGGTGGGGGTGGAGGGCAGG - Intronic
1001565239 5:172695800-172695822 CCTGCTTAGGAGGGCTGGGCCGG + Intergenic
1001706325 5:173743649-173743671 CTGGCTTTGGAGTGGAGGGAAGG + Intergenic
1001707291 5:173750768-173750790 TCTGCATGGGATGGGAGGGCTGG - Intergenic
1001871443 5:175159617-175159639 CATGATGGGGAGTGGAGGGGTGG + Intergenic
1001960960 5:175880230-175880252 GCTACTTGGGAGTGGGGTGCAGG - Exonic
1001992893 5:176132861-176132883 CATGGGTGGGAGTGGAGTGCGGG + Intergenic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002452432 5:179326487-179326509 CGGGCATGGGAGTGGGGGGCGGG - Intronic
1002495614 5:179609435-179609457 CCGGCTTGGGGTAGGAGGGCAGG - Exonic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002650336 5:180687058-180687080 CCTCCTTGGTGGTGAAGGGCAGG + Intergenic
1002667837 5:180839603-180839625 CCTACTTGAGGGTGAAGGGCAGG + Intergenic
1002737063 5:181401469-181401491 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1002747634 6:73310-73332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1003014348 6:2455994-2456016 CCTGCTGGAGAGAGCAGGGCAGG + Intergenic
1003762803 6:9199522-9199544 CATGCTTGGGAGTGAAGCCCAGG - Intergenic
1003764557 6:9220447-9220469 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1003993057 6:11506858-11506880 CCTCCTTGAGGGTGGAGGGAGGG + Intergenic
1004050302 6:12071285-12071307 CCTCCTTGATAGTGGGGGGCTGG + Intronic
1004164448 6:13243747-13243769 CCTGCATGAGGGTGGAGGGTAGG - Intronic
1004564704 6:16785349-16785371 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1004784403 6:18950490-18950512 CCTACTTGAGAGTGGAGGGTAGG + Intergenic
1004813319 6:19284748-19284770 CCTACTTGAGAGTGGAGGATGGG + Intergenic
1004818059 6:19333850-19333872 CCTACTTGAGGGTGGAGGGAGGG - Intergenic
1005020834 6:21416915-21416937 CCTACTTGGGAGTCTAAGGCAGG + Intergenic
1005291137 6:24380033-24380055 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1006073607 6:31515313-31515335 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
1006151969 6:31994533-31994555 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1006158271 6:32027271-32027293 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1006642376 6:35496077-35496099 CCTGCTAGGGGAGGGAGGGCTGG - Intronic
1006683166 6:35811729-35811751 CCTGCCAGGCACTGGAGGGCTGG + Intronic
1006924294 6:37646017-37646039 CCTGCTTGGGACCAGAGGACAGG + Intronic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1007179822 6:39921929-39921951 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1007334802 6:41148044-41148066 CCTGCTGGGGAGTGGAGAGGTGG - Intergenic
1007504949 6:42328495-42328517 CCTGCTTGAGGGTGGAGGCTGGG - Intronic
1007627244 6:43253546-43253568 CCTGCATGGGGGTGGAGGTGGGG - Exonic
1007633407 6:43284961-43284983 CCTGCTTGAGAGCAGAAGGCAGG - Exonic
1007748786 6:44059265-44059287 CCTGTCTGGGAGGAGAGGGCAGG - Intergenic
1007920106 6:45599696-45599718 CTTGCTTTGGAGTGAAGTGCAGG + Intronic
1008265006 6:49414272-49414294 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1008779531 6:55086215-55086237 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1008802996 6:55392717-55392739 CCTGCTAGAGGGTGGAGGGTGGG + Intronic
1008995549 6:57654099-57654121 CCTGTTGGGGAGTGGGGGGCTGG + Intergenic
1009386612 6:63091580-63091602 GCTGTTTTGGGGTGGAGGGCTGG + Intergenic
1009446961 6:63754340-63754362 CCTGTTGTGGAGTGGGGGGCTGG - Intronic
1009468660 6:64004607-64004629 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1009688698 6:66997928-66997950 CCTGTCAGGGGGTGGAGGGCTGG + Intergenic
1009805291 6:68594783-68594805 CCTGTAAGGGGGTGGAGGGCTGG - Intergenic
1009997310 6:70910323-70910345 CCTACTTGAGGGTGGAGGGTAGG - Intronic
1010343604 6:74786088-74786110 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1010607090 6:77904459-77904481 CCTACTTGAGAGTGGGGGGTGGG - Intronic
1010839567 6:80632748-80632770 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1010888013 6:81268251-81268273 CCTGTAGGGGAGTGGAGGACTGG - Intergenic
1010939883 6:81904324-81904346 CCTGCGTGAGTGTGGAGGGAGGG + Intergenic
1011056431 6:83208715-83208737 TCTACTTGACAGTGGAGGGCGGG + Intergenic
1011105289 6:83773017-83773039 CCTGTTGGGGAGTTGGGGGCAGG - Intergenic
1011271573 6:85585229-85585251 CCTGCTGGGGAGTGGGGGACTGG + Intronic
1011281456 6:85681924-85681946 CCTCCTTGAGGGTGGAGGGTTGG - Intergenic
1011314143 6:86012663-86012685 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1011418300 6:87145594-87145616 CCTGTTGTGGGGTGGAGGGCAGG + Intergenic
1011628906 6:89305790-89305812 CCTACTTGAGTGTGGAGGGTGGG + Intronic
1012253196 6:97002623-97002645 CCTACTTGAGAGTGGAGGGTTGG - Intronic
1012349584 6:98233885-98233907 CCTGTTGGGGTGTAGAGGGCTGG - Intergenic
1012393745 6:98772021-98772043 CCTGATTGGCAGGTGAGGGCAGG - Intergenic
1012485653 6:99719881-99719903 CCTACTTGTGGGTGGAGGGTGGG - Intergenic
1012585910 6:100922375-100922397 CTTTCTTGAGAGTGGAGGGTGGG + Intergenic
1012585917 6:100922407-100922429 TCTACTTGAGAGTGGAGGGTAGG + Intergenic
1012598664 6:101069098-101069120 CCTGTTGGGGTGTGGGGGGCTGG + Intergenic
1012991807 6:105933825-105933847 CCTACTTGAGGGTGGAGGGTTGG - Intergenic
1013316754 6:108950616-108950638 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1013537380 6:111075756-111075778 CCTGCTTGGGAGGAGAGTGTGGG - Intergenic
1013876473 6:114836686-114836708 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1013976672 6:116087012-116087034 CCTGCATGGGAATGGAAGTCAGG + Intergenic
1014075447 6:117229864-117229886 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1014244304 6:119050984-119051006 CCTACCTGAGAGTGGAGGGTGGG + Intronic
1014340269 6:120196908-120196930 CCTACTTGGGAGTCTGGGGCAGG + Intergenic
1014344682 6:120253191-120253213 CCTGTCAGGAAGTGGAGGGCAGG + Intergenic
1015521552 6:134136521-134136543 CCTGCTGTGGAGTGGGGGGAGGG - Intergenic
1015567675 6:134590431-134590453 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1015706987 6:136098923-136098945 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1015743396 6:136483351-136483373 CCTTCTTGAGGGTGAAGGGCGGG + Intronic
1015931100 6:138360531-138360553 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1016084690 6:139898723-139898745 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1016238089 6:141892176-141892198 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1016523355 6:144971854-144971876 CCTGTTGAGGAGTGGGGGGCTGG - Intergenic
1016549827 6:145267119-145267141 CCGGCTTGGGACTAGAGGGAAGG - Intergenic
1016660976 6:146579746-146579768 CCTGTTTGGGGGTGGGGGGTTGG - Intergenic
1016670873 6:146706034-146706056 GCTGCTTGGGAGGGTAAGGCAGG - Intronic
1016683553 6:146856903-146856925 CCTGTTGGGGAGTGGGGGACTGG + Intergenic
1016768248 6:147819319-147819341 CCTACTTGGGGGTGGAGGATAGG + Intergenic
1016777934 6:147925832-147925854 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1017636367 6:156447497-156447519 CCTGCATGGGAGAGGTGGGCAGG - Intergenic
1017762063 6:157577012-157577034 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1017929418 6:158939212-158939234 CGTGCTCGGTGGTGGAGGGCGGG - Intergenic
1018240307 6:161767754-161767776 CCTGGCTGGGGGTGGGGGGCTGG + Intronic
1018269887 6:162065718-162065740 CCTGCCATGGGGTGGAGGGCTGG - Intronic
1018320847 6:162607049-162607071 CCAGCTTGGGAGTGGGTGGGTGG + Intronic
1018671628 6:166182542-166182564 TCTACTTGAGAGTGGAGGGTAGG - Intergenic
1019099323 6:169615375-169615397 TCTGCTTGAGGGTGGAGGGTGGG - Intronic
1019183054 6:170204367-170204389 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1019183210 6:170205540-170205562 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
1019242159 6:170677039-170677061 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1019309737 7:354133-354155 CCTGCTACGGAGTGAAGGACAGG - Intergenic
1019517146 7:1445070-1445092 CCTCCGTGGGAGTGGGGGCCAGG + Exonic
1019614399 7:1952599-1952621 CACGCATGGGAGGGGAGGGCTGG + Intronic
1020169171 7:5831762-5831784 CTTCCTTGGGAGTGAAGGTCTGG - Intergenic
1020550068 7:9592942-9592964 CCTACTTGAGTGTGGAGGGTGGG + Intergenic
1020985940 7:15134451-15134473 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1021072385 7:16256756-16256778 CTTGTTGGGGAGTGGGGGGCTGG + Intronic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1021407480 7:20289098-20289120 CCTGCTTAAGGGTGGAGGGAGGG + Intergenic
1021419442 7:20428897-20428919 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1021500258 7:21324826-21324848 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1021530095 7:21634654-21634676 CCTAGTTGAGAGTGGAGGGCAGG + Intronic
1021611969 7:22466372-22466394 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1021618484 7:22527096-22527118 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1022221972 7:28322594-28322616 CCTGTCGGGGAGTGGGGGGCTGG - Intronic
1022467027 7:30658885-30658907 GCTGCTGGGGAGTGTAGGGATGG + Intronic
1022693205 7:32678632-32678654 CTTGAGTGGGAGTGGAGGGAAGG - Intergenic
1022694899 7:32695031-32695053 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1022739083 7:33104297-33104319 CCCACTTGAGGGTGGAGGGCAGG + Intronic
1022920885 7:35013206-35013228 CTTGAGTGGGAGTGGAGGGAAGG - Intronic
1022928078 7:35076549-35076571 CCTACTTGAGGGTGGAGGGTTGG + Intergenic
1022984885 7:35642798-35642820 CGTACTTGAGAGTGGAGGGTGGG + Intronic
1023014895 7:35956978-35957000 CCTGTCAGGGGGTGGAGGGCTGG - Intergenic
1023290812 7:38667205-38667227 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1023406361 7:39837330-39837352 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1023457145 7:40352460-40352482 CCTACTTGAGAGTAGAGGGAAGG - Intronic
1023505447 7:40895303-40895325 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1023571330 7:41575597-41575619 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1023685029 7:42724870-42724892 CCTGCTTGGGAGGGCAAGGTAGG - Intergenic
1024106259 7:46089986-46090008 CCTACTTGATAGTGGAGGGTGGG - Intergenic
1024223394 7:47305174-47305196 CATGCTTGTGGGTGCAGGGCTGG - Intronic
1024312407 7:47981022-47981044 CCTGTTGGGGGGTGGAGGCCTGG + Intergenic
1024566934 7:50688991-50689013 CCTGCTGGAGGGTGGAGGCCAGG + Intronic
1024581925 7:50807496-50807518 CCTGCTGGGGTGTGCAGGCCGGG + Intergenic
1024726284 7:52200030-52200052 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1024848317 7:53677608-53677630 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1024927272 7:54630467-54630489 CCTGCTTGAGAGTGGAGAGAGGG - Intergenic
1025061121 7:55809253-55809275 CCTCCTTGAGGGTGGAGGGTGGG + Intronic
1025843525 7:65174561-65174583 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025879520 7:65521406-65521428 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1025893918 7:65681182-65681204 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025937789 7:66051008-66051030 CTGGGTTGGGAGTGGAGAGCAGG - Intergenic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026116535 7:67500449-67500471 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1026547509 7:71336493-71336515 CCTACTTGAAAGTGGAGGGAGGG - Intronic
1026606202 7:71818180-71818202 CCTGGTTGGGGGTGAAGGGTGGG + Intronic
1026774558 7:73223361-73223383 CCAGCTTGGGTGGGGAGGGGAGG - Intergenic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1027015416 7:74776750-74776772 CCAGCTTGGGTGGGGAGGGGAGG - Intronic
1027072615 7:75169205-75169227 CCAGCTTGGGTGGGGAGGGGAGG + Intergenic
1027356847 7:77365384-77365406 TCTTCTTGAGAGTGGAGGGTGGG - Intronic
1027754136 7:82189010-82189032 CCTACTTGAGTGTAGAGGGCGGG + Intronic
1027876355 7:83774256-83774278 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1028752061 7:94393617-94393639 CCTAGTAGGGAGTGGAGGGTTGG + Intergenic
1028757969 7:94459791-94459813 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1028780971 7:94736110-94736132 CCTGCTGGAGGGTGGAGGGTGGG + Intergenic
1029195150 7:98800281-98800303 TCTACTTGAGGGTGGAGGGCAGG - Intergenic
1029250106 7:99230093-99230115 CCTACCTGAGGGTGGAGGGCGGG - Intergenic
1029420545 7:100469669-100469691 CCAGCTGGGGGCTGGAGGGCAGG - Intronic
1030379004 7:108790000-108790022 CCTTCTTGAGAGTGAAGGGCAGG - Intergenic
1030521827 7:110607156-110607178 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1030522888 7:110620347-110620369 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1030699976 7:112627426-112627448 CCTACTTGAGAGTGGAGGGTGGG - Intergenic
1030807922 7:113938730-113938752 CCTGCTTGAGGGTGGAGGGTAGG - Intronic
1030993242 7:116326813-116326835 CCTGCTTGAGCGTGGAGGGTGGG - Intronic
1031023878 7:116659269-116659291 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031405471 7:121380541-121380563 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1031705364 7:124974703-124974725 CCTGTTAGGGTGTGGGGGGCTGG - Intergenic
1031911644 7:127523052-127523074 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1032238295 7:130142389-130142411 CCTGCATGGGATTCTAGGGCTGG + Intergenic
1032514544 7:132496873-132496895 CCTCCTTGGGAGGGGAGAGTTGG - Intronic
1032625383 7:133586235-133586257 CCTGCTTGAGGGTGGAGGAAAGG - Intronic
1032960940 7:137033336-137033358 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1033605661 7:142926527-142926549 CATGCTCGGCAGTGTAGGGCAGG + Intronic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034401776 7:150866471-150866493 CCTGTTGGAGAGTGGAGGGTGGG + Intergenic
1034680334 7:152923662-152923684 CCTGATTGTGGGAGGAGGGCAGG + Intergenic
1034724803 7:153325367-153325389 CCAGCCTGGGATTGGAGGGGAGG + Intergenic
1034950449 7:155293124-155293146 TCTGCATTGGAGTGGAGGGTGGG - Intergenic
1035121164 7:156568738-156568760 CCTGTTCTGGAGTGGAGGGCAGG + Intergenic
1035505959 8:131112-131134 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1036055053 8:5242635-5242657 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1036435340 8:8728032-8728054 CCTGGTTGAGGGTGGAGGGTGGG + Intergenic
1036490058 8:9216680-9216702 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1036585858 8:10122684-10122706 CCTCCTTGAGTGTAGAGGGCAGG - Intronic
1036750370 8:11440031-11440053 CCTGGGTGGGAGTGGGGGGAGGG - Intronic
1036764983 8:11543759-11543781 CCTGCTCGGGAGGTGAGGACAGG - Intronic
1037061500 8:14516297-14516319 CCTCCTTGAGGGTGGAGGGTGGG - Intronic
1037253828 8:16928830-16928852 CCTACTTGAGGGTGGAGGGTCGG + Intergenic
1037300938 8:17451364-17451386 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1037320274 8:17634808-17634830 CCTACCTGGGGGTGGAGGGTGGG + Intronic
1037323773 8:17668825-17668847 CCTGCCTGAGGGTGGAGGGCGGG - Intronic
1037371794 8:18187695-18187717 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1037400695 8:18492571-18492593 CATGCTTGAGGGTGGAGGGTGGG - Intergenic
1037404054 8:18522821-18522843 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1037820471 8:22132539-22132561 CCAGCCTGGGAGTGGGAGGCCGG - Intronic
1038854338 8:31314692-31314714 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1038949711 8:32401134-32401156 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1038990823 8:32865845-32865867 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1039140979 8:34387984-34388006 CCTGTTGTGGAGTGGGGGGCAGG - Intergenic
1039158950 8:34595577-34595599 CATTCTTGGGTTTGGAGGGCAGG + Intergenic
1039378495 8:37061687-37061709 CATGCTTGGGAGATGAGGGTGGG + Intergenic
1041162190 8:55056622-55056644 CCTGCTTGAGGGTGGAGGATAGG + Intergenic
1041221392 8:55655156-55655178 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1041507850 8:58621098-58621120 CCTGCTTGAGGGTGGAGGATGGG - Intronic
1041564179 8:59257966-59257988 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1041655355 8:60344409-60344431 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
1041791876 8:61705237-61705259 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1042109666 8:65367442-65367464 CCTGCATGGGAAGGGTGGGCTGG - Intergenic
1042111489 8:65385998-65386020 CCTGTTGGGGTGTGGAGGCCTGG + Intergenic
1042399513 8:68330289-68330311 CCAACTTTGGAGGGGAGGGCTGG + Intronic
1042401024 8:68347111-68347133 TCTACTTGAGAGTGGAGGGTGGG - Intronic
1043506981 8:80911816-80911838 CCTACTTGAGGATGGAGGGCAGG - Intergenic
1043569434 8:81585992-81586014 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1043633232 8:82363440-82363462 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1043636787 8:82394340-82394362 CCTGCTTGACGGTGGAGGGTGGG - Intergenic
1043693396 8:83186494-83186516 TCTACTTGGGGGTGGAGGGTGGG + Intergenic
1043695794 8:83215655-83215677 CCTACTTGAGAGTGGAGGATGGG - Intergenic
1043738615 8:83777766-83777788 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1043777400 8:84287152-84287174 CATGCTTGGGAGTAGGGGTCAGG + Intronic
1044010997 8:86994335-86994357 CCTGGTAGGGACTGGTGGGCAGG + Intronic
1044053388 8:87538392-87538414 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1044166105 8:88985735-88985757 CCTACTTGGAGGTGGAAGGCTGG - Intergenic
1044170574 8:89046741-89046763 CCTACTTGAGGGTGGAGGGCAGG - Intergenic
1044435655 8:92159632-92159654 CTTACTTGAGAGTGGAGGGTGGG + Intergenic
1044557927 8:93584843-93584865 TCTACTTGAGGGTGGAGGGCAGG + Intergenic
1044662890 8:94608823-94608845 CCTCCTTGAGGGTGGAGGGTGGG + Intergenic
1045127459 8:99107996-99108018 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1045202282 8:99996104-99996126 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1045205545 8:100035951-100035973 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1045952911 8:107871896-107871918 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1046072032 8:109267274-109267296 CCTACTTGAGGGTGGAGGGAGGG - Intronic
1046290741 8:112156608-112156630 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1046722067 8:117631625-117631647 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1046865362 8:119143442-119143464 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1046886179 8:119369700-119369722 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1046940328 8:119924888-119924910 CCTACTTGAGTGTGGAGGGTGGG - Intronic
1046975478 8:120271216-120271238 CCTACTTGTGGGTGGAGGGTAGG + Intronic
1047025081 8:120815148-120815170 CCTGCTTGAGGGTGCAGGACGGG - Intergenic
1047219875 8:122910730-122910752 CCTGCTGGGGGGTGGGGGGTGGG + Intronic
1047311549 8:123696654-123696676 CCTGGGTGGGAGGGAAGGGCAGG + Intronic
1048071129 8:131022270-131022292 CCTGCCTGGGGGTGGAGGGTAGG - Intronic
1048683121 8:136868877-136868899 CCTACTTGTGATTGGAGGGTGGG + Intergenic
1048716101 8:137272027-137272049 CCTGCTTGGGGGCAGAGGGTGGG + Intergenic
1049811222 8:144573449-144573471 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1050145444 9:2562354-2562376 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1050310088 9:4343908-4343930 CCTACCTGAGAGTGGAGGGTGGG + Intronic
1050461724 9:5883002-5883024 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1050609655 9:7338301-7338323 CTGGATTGGGAGTGGAGGGGGGG - Intergenic
1050891086 9:10825343-10825365 TCTACCTGGGAGTGGAGGGTGGG - Intergenic
1051384672 9:16494823-16494845 CCTGTTGTGGGGTGGAGGGCTGG + Intronic
1051481827 9:17569977-17569999 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1051893411 9:21965694-21965716 CCTGCTGGCGAGTGGAGCGTAGG + Intronic
1052261104 9:26517157-26517179 CCTGCTTGGGAAGGGTTGGCAGG - Intergenic
1052380110 9:27761267-27761289 TGTGTTGGGGAGTGGAGGGCAGG - Intergenic
1052395153 9:27929501-27929523 CCTGGGTGGGGGTGGAGGGAAGG + Intergenic
1052735476 9:32338039-32338061 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1053558442 9:39162807-39162829 CCTACTTGAGGGTGGAGGGTAGG + Intronic
1053771657 9:41486303-41486325 CCTTCTTGGGAGTGGAGATAGGG - Intergenic
1053822560 9:41983032-41983054 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1053873385 9:42517909-42517931 CCTACCTGAGAGTGGAGGGTGGG + Intergenic
1054262288 9:62879565-62879587 CCTACCTGAGAGTGGAGGGTGGG + Intergenic
1054268944 9:62948843-62948865 CCTACCTGAGAGTGGAGGGTGGG - Intergenic
1054608016 9:67204334-67204356 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1054750478 9:68899916-68899938 CCTACTTGAGGGTGGAGGGCGGG - Intronic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055029089 9:71754056-71754078 CCTGTTGAGGGGTGGAGGGCTGG + Intronic
1055301857 9:74890814-74890836 CCTCCTTGAGAGTGGAGGGTGGG - Intergenic
1055387806 9:75782566-75782588 CTTACTTGAGAGTGGAGGGTGGG - Intergenic
1055760892 9:79606524-79606546 CCTGTTGGGGAGTGGGGGACTGG - Intronic
1055990985 9:82105347-82105369 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1056289493 9:85128382-85128404 CCTGGCTGGGAGTGGAGGATGGG + Intergenic
1056298867 9:85221361-85221383 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1056715241 9:89023074-89023096 CCTTCTTTGGAAGGGAGGGCAGG + Intronic
1057186151 9:93058621-93058643 CCTGGGCGGGCGTGGAGGGCGGG + Intergenic
1057217747 9:93238824-93238846 CCTGCTTGGAGGTGGGGAGCCGG - Intronic
1057408041 9:94791332-94791354 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1057492898 9:95536270-95536292 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1057756672 9:97844113-97844135 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1057768546 9:97945493-97945515 CCTGTCTGGGGGTGGGGGGCAGG - Intergenic
1058053308 9:100427306-100427328 CCTGCTTGCGAGAGGAGCCCAGG + Intronic
1058528362 9:105882555-105882577 CCTGTTGGGGAATGGGGGGCTGG - Intergenic
1058831363 9:108820210-108820232 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1058943040 9:109832049-109832071 CCTGTCTGTGAGTGGAGGTCAGG - Intronic
1059016306 9:110519705-110519727 CCTGATGGAGAGTGGAGGGTGGG + Intronic
1059839760 9:118200764-118200786 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1060172036 9:121469799-121469821 CCTCCTGGGGTGTGCAGGGCAGG - Intergenic
1060232154 9:121833371-121833393 CCTTCCCGGGAGTGGAGAGCAGG - Intronic
1060690459 9:125653526-125653548 CCTGCTTAGGGGAGAAGGGCAGG + Intronic
1061032083 9:128091335-128091357 GCTGCCTGTGATTGGAGGGCTGG + Intronic
1061288176 9:129635969-129635991 CCTGCTTGGCAGTGGAGACCTGG + Exonic
1061798723 9:133102989-133103011 CCTGGATGGGAGTAGAGGGGAGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1061975420 9:134065947-134065969 ACTACTTCGGAGTGTAGGGCAGG + Intronic
1062036110 9:134383300-134383322 CCTGAGTGGGTGTGGCGGGCTGG + Intronic
1062175284 9:135158591-135158613 CCTCCTTGGGAGTGGGGAGATGG + Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062221682 9:135419425-135419447 CCTGCTGGGGAAGGGAGGGATGG - Intergenic
1062250569 9:135591801-135591823 CCTGCCTGGGGAGGGAGGGCAGG - Intergenic
1062339769 9:136088773-136088795 CAGGCCTGGGCGTGGAGGGCGGG + Intronic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062568042 9:137171902-137171924 CATGGCTGGGAGTGGAGTGCGGG + Exonic
1062691354 9:137843378-137843400 CCTACTTAGGAGTGGAGGGTGGG - Intronic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203602350 Un_KI270748v1:26261-26283 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1185732441 X:2472319-2472341 CCTGCTGGAGGGTGGAGGGTGGG + Intronic
1185829335 X:3284875-3284897 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1185881971 X:3749405-3749427 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1185908625 X:3961421-3961443 CCTACTTGAGGGTGGAGGGTTGG + Intergenic
1186009449 X:5113054-5113076 CCTACTTGAGATTGGAGGGTGGG + Intergenic
1186012481 X:5150504-5150526 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1186082356 X:5946829-5946851 CCTGCTGGAGGGTGGAGGGTAGG - Intronic
1186310434 X:8311899-8311921 CCTGCTTGAGGATGGAGGGTGGG + Intergenic
1186334505 X:8572282-8572304 CCTGCTTGGGGGAGGTGGGGAGG - Intronic
1186378206 X:9031613-9031635 CCTACTTGAGGGTGGAGGGTAGG + Intronic
1186402336 X:9271349-9271371 CCTACATGAGGGTGGAGGGCAGG - Intergenic
1186586039 X:10874035-10874057 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1186605635 X:11087591-11087613 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1186616667 X:11195652-11195674 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1186632399 X:11364195-11364217 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1186813241 X:13210506-13210528 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1186850917 X:13579245-13579267 CCTATTTGAGAGTGGAGGGTGGG - Intronic
1187054289 X:15727339-15727361 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1187132452 X:16515960-16515982 CCTACTTGAGGGTGGAGGGTTGG + Intergenic
1187173738 X:16875752-16875774 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1187261310 X:17687399-17687421 CCTGCTTGGGGGTGGAGATGGGG - Intronic
1187289184 X:17935986-17936008 CCCCCTTGAGAGTGGAGGGTGGG - Intergenic
1187330326 X:18332865-18332887 CCTGCTTGGGAGGCCAAGGCAGG + Intronic
1187665457 X:21604309-21604331 CCTGCTGTGGAGTGGGGGGAGGG + Intronic
1187712052 X:22064297-22064319 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1187746429 X:22414219-22414241 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1187755867 X:22525539-22525561 TCTACTTGAGAGTGGAGGGAGGG + Intergenic
1187820296 X:23280240-23280262 CCTACTTGAGGGTGGAGGGCGGG + Intergenic
1188014195 X:25090075-25090097 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1188035060 X:25308017-25308039 CCTATTTGAGAGTGGAGGGCAGG - Intergenic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188205778 X:27355963-27355985 CCTCCTTGGGGGTGGCGGGGCGG - Intergenic
1188228013 X:27625851-27625873 CCTATTTGTGAGTGGAGGGTGGG + Intronic
1188313051 X:28641212-28641234 CCTGTTGGGGAGTGGTGGGCTGG - Intronic
1188463891 X:30456419-30456441 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1188471018 X:30539274-30539296 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1188879352 X:35472723-35472745 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189095661 X:38136390-38136412 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1189099882 X:38177736-38177758 CGTGCTGGGGAGTGGATTGCTGG + Intronic
1189132065 X:38509905-38509927 CCTACTTGAGGGTGGAGGGTAGG + Intronic
1189136441 X:38555600-38555622 CCTAATTGGGAGTTGAGGGAGGG - Intronic
1189304563 X:39977158-39977180 GCTGCTTGGGAATGGGGGACAGG + Intergenic
1189611235 X:42738346-42738368 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1189840666 X:45073020-45073042 CCTGCTGTGGGGTGGAAGGCAGG - Intronic
1189876654 X:45443172-45443194 CCTGCTTGAGAGTGGACGGTGGG - Intergenic
1190167929 X:48088555-48088577 CCTACTTGAGAGTGGAGGGAGGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1190515236 X:51216832-51216854 TCTACTTGAGAGTGGAGGGTGGG - Intergenic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191206435 X:57838728-57838750 CCTACTTGAAAGTGGAGGGTGGG - Intergenic
1191821307 X:65311987-65312009 CCTGTCTGGGAGTAGGGGGCAGG + Intergenic
1191878718 X:65822936-65822958 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1191951809 X:66601132-66601154 CCTGCTTGGAATATGAGGGCAGG - Intronic
1192288631 X:69766431-69766453 CCTACTTGAGAGTGAAGGGTGGG - Intronic
1192311540 X:70019736-70019758 CCTTCTTGCGAGTGGAGAGTGGG + Intronic
1192339001 X:70246746-70246768 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1192354821 X:70391768-70391790 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1192678082 X:73221371-73221393 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1192687010 X:73317891-73317913 CCTACTGGAGAGTGGAGGGTTGG - Intergenic
1192722162 X:73710541-73710563 CCTACTTGAGTGTGGAGGGTGGG + Intergenic
1192767510 X:74157173-74157195 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1192788634 X:74358009-74358031 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1193019399 X:76774933-76774955 CCTGTTGGACAGTGGAGGGCTGG - Intergenic
1193166682 X:78289111-78289133 CCTGTCGGGGGGTGGAGGGCTGG - Intronic
1193270464 X:79523762-79523784 CCTACTTGAGAGTGGAAGGCAGG + Intergenic
1193507074 X:82357782-82357804 CCTGCTGTGGGGTGGGGGGCGGG + Intergenic
1193512774 X:82426171-82426193 CCTACTTGAGAGTGGAGGGAGGG - Intergenic
1193609558 X:83612909-83612931 CCTACTTGAGGGTGGAGGGAGGG - Intergenic
1193631236 X:83890615-83890637 ACTACTTGAGAGTGGAGGGTGGG - Intergenic
1193748743 X:85316873-85316895 CCTACTTGAGGGTGGAGGGTGGG - Intronic
1193767417 X:85547166-85547188 CCTGCTGGAGGGTGGAGGGTGGG + Intergenic
1193825158 X:86216356-86216378 CCTGTTTGGGGGTGGTGGGCTGG - Intronic
1193869953 X:86784969-86784991 CCTGCTAGAGGGTGGAGGGTGGG + Intronic
1193909807 X:87290119-87290141 CCTGTTGGGGGGTGGCGGGCTGG - Intergenic
1193998988 X:88403503-88403525 TCTACTTGGGTGTGGAGGGTGGG - Intergenic
1194096268 X:89642890-89642912 CCTGTTGGGGGGTGGAGGCCTGG + Intergenic
1194167434 X:90536276-90536298 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1194234432 X:91364697-91364719 CCTACTTGAGGGTGGAGGGAGGG + Intergenic
1194406503 X:93502725-93502747 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1194407189 X:93511269-93511291 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1194415843 X:93610623-93610645 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1194425600 X:93733651-93733673 CCTACTTGAGGGTGGAGGGTAGG - Intergenic
1194536648 X:95113496-95113518 CCTGTTTGAGGGTGGAGGGTGGG - Intergenic
1194593452 X:95830016-95830038 TCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1194851062 X:98869831-98869853 CCTACTTGAGTGTGGAGAGCGGG - Intergenic
1194989760 X:100534513-100534535 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1194990013 X:100537275-100537297 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1195013065 X:100752310-100752332 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
1195210395 X:102648642-102648664 CATGCTTGGGGGTGGTGGGTGGG + Intergenic
1195412188 X:104579597-104579619 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1195448556 X:104981981-104982003 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1195591321 X:106630748-106630770 CCTACTTGAAAGTGGAGGGTGGG + Intronic
1195979724 X:110564356-110564378 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1195992041 X:110692320-110692342 CCAGCTTGGGAGTTGGGGGTGGG + Intronic
1196015145 X:110931316-110931338 CCTACTTGGGGATGGAGGGTGGG + Intergenic
1196040430 X:111197076-111197098 CCTACTTGAGAGTGGAGGGTGGG - Intronic
1196166949 X:112545954-112545976 CCTGTTTGGGGGTTGGGGGCTGG - Intergenic
1196277430 X:113783356-113783378 CCTGTTGGGGGGTGGAGGCCCGG + Intergenic
1196487755 X:116233308-116233330 CCTACTTGAGAGTGGAGGCTGGG - Intergenic
1197045066 X:121986444-121986466 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
1197045494 X:121992276-121992298 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1197107800 X:122736426-122736448 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1197177011 X:123496734-123496756 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1197573236 X:128176140-128176162 CCTGCTTGGGGGTGGAAGGTGGG + Intergenic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1197647728 X:129036166-129036188 CAGGCATGGGAGTGAAGGGCAGG + Intergenic
1197791073 X:130254751-130254773 CCTACTTGAGGGTGGAGGGTGGG + Intronic
1198068433 X:133123364-133123386 CCTTCTTGAGGGTGGAGGGTGGG - Intergenic
1198107035 X:133471635-133471657 TCTACTTGAGAGTGGAGGGTGGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198482759 X:137056081-137056103 CTTTCTTGGGAGGGCAGGGCAGG + Intergenic
1198945459 X:142008161-142008183 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1199174216 X:144765757-144765779 CCTGCTTAGGAGAGGATTGCAGG - Intergenic
1199193592 X:145001243-145001265 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1199292969 X:146125177-146125199 CCTGCTGGGGTGTGGTGGGCTGG + Intergenic
1199321955 X:146450291-146450313 CCTGCTTCAGAGTGAAGGCCTGG + Intergenic
1199677303 X:150199344-150199366 CCTGCCTGTGAGGGGAGGGAAGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200045763 X:153400561-153400583 CTGACTTGGGGGTGGAGGGCGGG - Intergenic
1200513697 Y:4114054-4114076 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1200954774 Y:8931781-8931803 CCAGTTTGGGAGTGGGGGCCTGG + Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201249054 Y:12037455-12037477 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1201384304 Y:13421756-13421778 TCTACTTGAGAGTGGAGGGTAGG + Intronic
1201399485 Y:13589222-13589244 CCTACTTGAGGGTGGAGGGTAGG + Intergenic
1201587766 Y:15580234-15580256 CCTACTTGAGAGTGGAGGGTGGG + Intergenic
1201790251 Y:17832013-17832035 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1201811303 Y:18073976-18073998 CCTACTTGAGGGTGGAGGGTGGG - Intergenic
1201905066 Y:19079022-19079044 CCTGCTTAGGAGGCTAGGGCAGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic
1202351895 Y:24001759-24001781 CCTACTTGAGGGTGGAGGGTGGG + Intergenic
1202518884 Y:25668360-25668382 CCTACTTGAGGGTGGAGGGTGGG - Intergenic